Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6957465.3.5                    67 END     1           3        1                hypothetical LOC496943 [Xenopus tropicalis]
     2   2.0    0Xl3.1-xl318p19.3.5                         36 END     6          22       16                (no blast hit)
     3   2.0    0Xl3.1-XL076g06.3                            2 END     1           3       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4   0.0    0Xl3.1-IMAGE:5080011.5                      21 PI      94         11      977                hypothetical protein LOC734970 [Xenopus laevis]

 This cluster: approximate FL confidence score = 95%

 1012769547 Xl3.1-IMAGE:5083691.5 - 27 ESTs
                                                                       .....-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5083691.5                                              GAAGAGATCGACAGAGAAAATGGCGCTAGCCAGTTTTTTGCCTGCTCCAACACAGTTATCACAGGATCAGCTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGACAAGCGTTTGGCTGCTGATGGCCGAGGGCTGCAGACTGTTCATATCAATGAGAACTTTGCTAAGCTTGCGGAAGCCTTGTACATTGCTGACAGAAAGGCTCGTGAAGCTGTGGAGATGAGGGCCCAGGTGGAGCGCAAGATGGCACAAAAGGAGAAGGAGAAAAAAGAGGAAAAACTTAGGGAATTGGCACAGAT
                                                  Xl3.1-CHK-1012688416                                                    ATCGACAGAGAAAATGGCGCTAGCCAGTTTTTTGCCTGCTCCAACACAGTTATCACAGGATCAGCTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGACAAGCGTTTGGCTGCTGATGGCCGAGGGCTGCAGACTGTTCATATCAATGAGAACTTTGCTAAGCTTGCGGAAGCCTTGTACATTGCTGACAGAAAGGCTCGTGAAGCTGTGGAGATGAGGGCCCAGGTGGAGCGCAAGATGGCACAAAAGGAGAAGGAGAAAAAAGAGGAAAAACTTAGGGAATTGGCACAGATTGCAAG
                                                      consensus depths                                                   3     3     9    11    11    13    12    14    12    14    12    14    12    14    14    14    14    14    14    14    14    14    13    14    14    14    14    14    14    15    14    15    16    17    14    17    16    17    16    17    17    18    18    18    18    19    15    20    17    20    18    21    18    22    19    21    18    22    19    21    16    21    20    21    19    21    20    21    20    21    20    21    21    21    20    21    21    21    21    21    21    21    19    21    21    21    21    21    18    21    19    20    19    20    19    22    18    21    18    22    19    23    19    23    19    23    19    23    19    22    19    22    19    22    18    21    18    21    18    21    18    21    18    20    15    20    15    20    15    19    15    18    15    18    15    18    13    18     9    17     9    17     8    16     8    15     8    14     8    12     8    11     6     9     5     8     4     5     3     4     3     4     3     3     2     2     2     2
                                               BLH ATG      19    1148                                              
                                               BLH MIN      19     223                                              
                                               BLH MPR      13     223                                              
                                               BLH OVR      19      93                                              
                                               EST CLI       6      46                                              
                                               ORF LNG      19       6                                              
  5   1   2       bld Egg3      in                    IMAGE:3379214.5p CCGGGCTCTTAGGTCACTTCCTCCATAGCCTAGCTGCACTTCCGGGAAGAGATCGACAGAGAAAATGGCGCTAGCCAGTTTTTTGCCTGCTCCAACACAGTTATCACAGGATCAGCTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTCATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAAGGGGTGCTNNTAACTCTGGTGCCAAACAGAAGGTGATTCGGATGGTGGGATGCANAAGACCCCATGGAGCCACCTCGATTCAAAATA
  5   1   2       bld Tad2 5g                         IMAGE:6936224.5p                                  GGGGACTTCCGGGAAGAGATCGACAGAGAAAATGGCGCTAGCCAGTTTTTTGCCTGCTCCAACACAGTTATCACAGGATCAGCTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTTCAAATTAATAAGAAAAATTCCACATGGGACCCTCCATCTTCCTCCAAGCGGACAGGTAATGGCATTCCCCCCAAAGCAGN
  5   1   2       bld Ga15 5g3  out                      XL430e02ex.5p                                           TCCGAAGAGATCGACAGAGAAAATGGCGCTAGCCAGTTTTTTGCCTGCTCCAACACAGTTATCACAGGATCAGCTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGTGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGGAGAATCCCCCCATGTATTTCTA
  5   1   2       bld Ga18      out                     xlk124e19ex.5p                                                  GAAGAGANCGACAGAGAAAATGGNNNNNGNNTTTTTGCCTGCTCCAACACAGNTATCACAGGATCAGCTAGAGGNGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGNCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTGNTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGTGTNNAGGNGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCT
  5   1   2       bld Oo1  5g                         IMAGE:5083691.5p                                                    ATCGACAGAGAAAATGGCGCTAGCCAGTTTTTTGCCTGCTCCAACACAGTTATCACAGGATCAGCTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGACAAGCGTTTTGGCTGGCTGATGGGCCGAGGGGCTGCAGACTGGGTTCATATCAATGGAGAAACTTTGCTAAAGCTTTGCGGAAAGCCTTT
  5   1   2       bld Ga15 5g                            XL473e21ex.5p                                                    ATCGACAGAGAAAATGGCGCTAGCCAGTTTTTTGCCTGCTCCAACACAGTTATCACAGGATCAGCTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTATACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGG
  5   1   2       bld Emb1 5g                         IMAGE:5154736.5p                                                      CGACAGAGAAAATGGCGCTAGCCAGTTTTTTGCCTGCTCCAACACAGTTATCACAGGATCAGCTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGGAACAGCCAAGAGTGGGAGAATCCCCCCCATGTATTTTCTAACTGGAAAGATTGCCAAGGGGTTATACCCATCCCCACTAGNACCAGCCGGTTGGGCTGCTGGATGGGCCGAGGGGCTG
  5   1   2       bld Ov1  5g3  out                   IMAGE:5048379.5p                                                       GACAGAGAAAATGGCGCTAGCCAGTTTTTTGCCTGCTCCAACACAGTTATCACAGGATCAGCTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTT
  5   1   2       bld Emb1 5g                         IMAGE:6632210.5p                                                       GTCAGCGAAAATGGCGCTAGCCAGTTTTTTGCCTGCTCCAACACAGTTATCACAGGATCAGCTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTACAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCTCTGCACAGTATATTAGGTACACACCCTCTCAACAGGTGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTTCGGATGGGGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCCAAATTAATAAGAAAAATTCCACATGGACCCTCCATCTCCTCCAGGGACAGTAAATGCATTTCCCCCCACCCAGAAAAAAATGACTTGTCAAGGGACCAACCCAAGAGTGGAAGAAATTCGCCCCCATGCATTTTTCTTAATGGGAAAAAATGGCCCAGGGGGTTAATACCCATTCCCCACTTAAAACAAAACGGTTTGGGCCTGCGTGGATGGCCCCCAAGGGCTTTCCACAC
  5   1   2       bld Ga18      in                        xlk8m15ex.5p                                                        ATCGACAGAGAAAATGGNNNNANTTTTTTGCCTGCTCCAACACAGTTGTCACAGGATCAGCTAGAGGNAGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTNNTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGaaaaaaagaaaaTGTCCAATGCCTTGNNNTNCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACANTCCAAAGATAAGGNTCTTTTCAGCAAGNACACAGACCTGGNACCTAAAGAGGNGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGNGATGNCTGTACGGGCTGCAGATAAACTGGNCCCTGCACAGTATATTAGGNACACACCCTCTCNACAGGGGGNGGNTTTTAACTCTNGNGCCNAANAGAGGGTGANTCGGATGGNGGAGANNNAAAAGGANCCCATGGNGCCANCTCGATTCNAAANNNANAAGAAAATTCCACATGGACCTNCATCTCNT
  5   1   2      seed Ga15      in                       XL468i07ex.5p                                                          AGAGAAAATGGCGCTAGCCAGTTTTTTGCCTGCTCCAACACAGTTATCACAGGATCAGCTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCTGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTANACAAGCGTTTGGCTGCTGATGGCC
  5   1   2       bld Emb1 5g                         IMAGE:6866599.5p                                                            GAGAAATGGCGCTAGCCAGTTTTTTGCCTGCTCCAACACAGTTATCACAGGATCAGCTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGAATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAAGACCCCATGGAGCCCACCTCGATTCAAAATTAATAAGGAAAATTCCACATGGGACCCTCCATCTCCTCCCAGCGACAGTAAATGCATTCCCCCCAGCCAGAAAGGGTAAGGATGTTGTTCCATCCAGTTTTTAATTGTGGACCCGCAAAACCGAAACCTGGCAAAACGCAtttttttttAAAAATTTTCCATGGGTAAGGGGGCCTCTTGGAAAAAGAATAATTTAATGCCCTTCCCC
  5   1   2       bld Gas5 5x3  out                   IMAGE:3750500.5p                                                                  TGGCGCTAGCCAGTTTTTTGCCTGCTCCAACACAGTTATCACAGGATCAGCTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAATCTCGTCAGACAGCTCTAGTGTCATCACGGCGTGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACACACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACATAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATCGCTGCACCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCC
  5   1   2       bld Ga18      out                     xlk116f02ex.5p                                                                                TTTTTTGCCTNCTCCAACACAGTTATCACAGGATCAGCTAGAGGNGAAGAAAAGCTGAGAGCACNGAAATCTCGTCAGACAGCTCTAGNGTCATCACGNCGNGAACCACCTCCCTATGGCCACAGGAAAGGATGGGTTCCCAGATCCCTCGAGGATTTTGGAGANGGCGGTNNTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTNGTNTNCAGGTGGATGCAGAAGGAAAAATAAAATATGATGNTNTTNCTCGACAGGGACAATCCAAAGATAAGG
  3   1   2       bld Ga18      in                        xlk8m15ex.3p                                                                                                                                                                                                           ANGAAANGNNNNGGTNCCCAGATNCCTCGNGNTTTGGAGANGNNNGTGCNTTNNNAGAGATACATGTGGCNNNNNCCNNCNGGACATGGGGCGNAAAAAAAGAAAATGTCCAATGCNTTGGCTGTGCAGGNGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGNCCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGANCTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCANNGATGCCTGTACGGGCTGCAGATAAACTGNNCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGACAAGCGTTTGGCTGCTGANNNNGAGGGCTGCAGACTGTTCATATCAATGAGAACTTTNCTAAGCTTNCGGAAGCCTTGTACATTGCTGACAGAAAGGCTCGTGAAGCTGTGGAGATGAGGGCCCAGNTGG
  5   1   2       bld Ga15      in                       XL512m03ex.5p                                                                                                                                                                                                                                         GATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGACAAGCGTTTGGCTGCTGATGGCCGAGGGCTGCAGACTGTTCATATCAATGAGAACTTTGCTAAGCTTGCGGAAGCCTTGTACATTGCTGACAGAAAGGCTCGTGAAGCTGTGGAGA
  3   1   2       bld Ga15      in                       XL512m03ex.3p                                                                                                                                                                                                                                         GATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATACCCACTGGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGACAAGCGTTTGGCTGCTGATGGCCGAGGGCTGCAGACTGTTCATATCAATGAGAACTTTGCTAAGCTTGCGGAAGCCTTGTACATTGCTGACAGAAAGGCTCG
  3   1   2       bld Neu7      out                        XL034d23.3p                                                                                                                                                                                                                                                                                              GGACATGGGGCGAAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGACAAGCGTTTGGCTGCTGATGGCCGAGGGCTGCAGACTGTTCATATCAATGAGAACTTTGCTAAGCTTGCGGAAGCCTTGTACATTGCTGACAGAAAGGCTCGT
  5   1   2       bld Ga15      in                       XL459l14ex.5p                                                                                                                                                                                                                                                                                                                 AAAATGTCCAATGCCTTGGCTGTGCAGGTGGATGCAGAAGGAAAAATAAAATATGATGCTATTGCTCGACAGGGACAATCCAAAGATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGACAAGCGTTTGGCTGCTGATGGCCGAGGGCTGCAGACTGTTCATATCAATGAGAACTTTGCTAAGCTTGCGGAAGCCTTGTACATTGCTGACAGAAAGGCTCGTGAAGCTGTGGAGATGAGGGCCCAGGTGGAGCGCAAGATGGCACAAAAGGAGAAGGAGaaaaaaaaaaa
  3   1   2       bld Egg3      in                    IMAGE:3379214.3p                                                                                                                                                                                                                                                                                                                               CTGGCTGTCCAGGTGGATCCAGAAGGAACAATAAATTATGATGGCTATTGCTCGACAGGGACAATCCAAGATAAGGGTTCTTTCCAGCAAGTACACAGACCTGGTACCTAAAGAGGTCATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGACAAGCGTTTGGCTGCTGATGGCCGAGGGCTGCAGACTGTTCATATCAATGAGAACTTTGCTAAGCTTGCGGAAGCCTTGTACATTGCTGACAGAAAGGCTCGTGAAGCTGTGGAGATGAGGGCCCAGGTGGA
  3   1   2       bld Ga15      in                       XL468i07ex.3p                                                                                                                                                                                                                                                                                                                                                TGCAGAAGGNAAAAATAAAATNTGATGCTATTGNTCGACAGGGNCAATCCAAAGATAAGGTTCTTTTCAGCAAGTACNCAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGACAAGCGTTTGGCTGCTGATGGCCGAGGGCTGCAGACTGTTCTATATCAATGAGAACTTTGCTAAGCTTGCGGAAGCCTTG
  3   1   2       chi Egg3                            IMAGE:3378352.3p                                                                                                                                                                                                                                                                                                                                                              TTGAAAGATGATCTTATGACTCGACAGGACCAAACCAATCATATGCTTCCATCCAGCAGGTCCATAGTCCGTGTCGAGAGCGGTCATGCGACGAAGAGTGATCTGCATCTACAAAGACTTCGTGAGGTAGCTATTAAAGAGCTCGCAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGACAAGCGTTTGGCTGCTGATGGCCGAGGGCTGCAGACTGTTCATATCAATGAGAACTTTGCTAAGCTTGCGGAAGCCTTGTACATTGCTGACAGAAAGGCTCGTGAAGCTGTGGAGATGAGGGCCCAGGTGGAGCGCA
  5   1   2       bld Tbd7      out                        XL109n19.5p                                                                                                                                                                                                                                                                                                                                                                                        GGACAATCCAAAGNATAAGGTTCTTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAACTACAAAGACCTGATGAGGAAGCTATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGACAAATCCGTGTCCCAGAAGATTGCTGCAGCGATGCCTGTACGGGCTGCAGATAAACTGGCCCCTGCACAGTATATTAGGTACACACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGACAAGCGTTTGGCTGCTGATGGCCGAGGGCTGCAGACTGTTCATATCAATGAGAACTTTGCTAAGCTTGCGGAAGCCTTGTACATTGCTGACAGAAAGGCTCGTGAAGCTGTGGAGATGAGGGCCCAGGTGGAGCGCAAGATGGCACaaaaggagaaggagaaaaaagaggaaaaaCTTAGGGAATTGGCACAGATTGCAAGA
  3   1   2       bld Ga18      in                      xlk111h01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACCCTCTCAACAGGGGGTGGCTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGACAAGCGTTTGGCTGCTGANNNNNAGGGCTGCAGACTGTTCATATCAATGAGAACTTTNCTAAGCTTNCGGAAGCCTTGTACATTGCTGACAGAAAGGCTCGTGAAGCTGTGGAGATGAGGGCCCAGGTNG
  5   1   2       bld Ga18      in                      xlk111h01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTCTCAACAGGGGGTGGNTTTTAACTCTGGTGCCAAACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGACAAGCGTTTGGCTGCTGATGGCCGNGNCNGCAGACTGTTCATATCAATGAGAACTTTGCTAAGCTTGCGNNNNNNTGTACATTGCTGACAGAAAGGCTCGTGAAGCTGTGGAGATGAGGGCCCAGGTGGAGCGCAAGATGGCACAAAAGGAGAAGGAGaaaaaaaaaa
  5   1   2       bld Eye1      out                   IMAGE:6957483.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTAACTCTGGTGCCAAAATTACCGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATCTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGTGGAGAATCCCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGACAAGCGTTTGGCTGCTGATGGCCGAGGGCTGCAGACTGTTCATATCAATGAGAACTTTGCTAAGCTTGCGGAAGCCTTGTACATTGCTGACAGAAAGGCTCGTGAAGCTGTGGAGATGAGGGCCCAGGTGGAGCGCAAGATGGCACaaaaggagaaggagaaaaaagaggaaaaaCTTAGGGAATTGGCACAGATTGCAAGAGAACGCAGAACTGGGATCAAGTCCCATACAGAAAAAGAGGATGGAGAAGCCAAAGAGAGGGATGATATTCGACATGAGAGAAGCAAGGAACGGCAATCTGAAAGGGAAATATCTAGGGCAGCCCCCGAACAAAAGGGTCAAACTCCAAAGGGAAATGAAGAACGAGGCATTCAGTTGAACGAATGGCCCCTTGGAAATTCCCTAATCCGAGGGAAATTCCAGTGGAAAAATCCCGGGTTGGACCAAACGGACCTTTTTCCAACCAAAGGCCCGAAGGGTTGGGACTTGGTGGCCTATTGCCTGGGTGGGAAGAAGGGACGAGGGTTGTATAACCGGGGGTTTGGAACCCTTCCAATGGTTTAGGGGAAAGCAGAGAAAACGGGGGCGGCAGAATACCTCCCAGCGGGACCCCCAGGTAAAGACACCGCGGTACAATAGGCGGGGTTTCATGGGGGGAGAAAAGACACCGGGGGACTCCTTTTTATTTGT
  3   1   2       bld Ga15      in                       XL459l14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGACCCCATGGAGCCACCTCGATTCAAAATTAATAAGAAAATTCCACATGGACCTCCATNTCCTCCAGCGACAGTAATGCATTCCCCCAGCAGAAAGATGACTGTCAAGGAACAGCAAGAGNGGAGAATCCCCCCATNTATTTNTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGACAAGGCGTTTGGCTGGTGATGGCCGAGGGGCNGCAGAGCTGTTCATATACAANTGAGAANCTTTGGTAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)