Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7201993.5                      13 PI      90         36     1209                Cleavage and polyadenylation specificity factor subunit 4

 This cluster: approximate FL confidence score = 95%

 1012769567 Xl3.1-IMAGE:6867239.5 - 32 ESTs
                                                                       .......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6867239.5                                                          GTTTCCCAGAGTGCCCTGCTCTAGGTTGAGAAATCGATCGTAGGCGTCGTGCGGCTTTCTGTTGGTCGAGTCTGATGCTGATATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGCCTCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAAGCCAGAATTCTCCTGTCAGCCAACAGCGTTCTCCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCAGGGAAACCGGGGACCTAGGCCACTGGACCAGGTTACCTGCTATAAGTGCGGGGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCCTGAGTGGGCAGTAACGAGTGCTTTGGGGTATGGACATAATGGACAGTCAATTTTAATTTTAACATCAAGATGCTGGAGACTTTTTCCTTGTTCTATGTAAATATTGGACTCTTTTTCTGCTATTTACTCTGAGCAGTTGATAGGAATCTTCTCCTTCCAAGAACTGTTTGGCAAAGAGAGTTTTTGCCAATAACTATTTTTTTAAATAAAAAATGTAAATGAATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGACAAGATCAAATGCCAACAGTTCTCTTGAATTTAACATTGTTAATAAACTCTATTTTAGTGA
                                                  Xl3.1-CHK-1012687845                                                                CAGAGTGCCCTGCTCTAGGTTGAGAAATCGATCGTAGGCGTCGTGCGGCTTTCTGTTGGTCGAGTCTGATGCTGATATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGCCTCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAAGCCAGAATTCTCCTGTCAGCCAACAGCGTTCTCCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCAGGGAAACCGGGGACCTAGGCCACTGGACCAGGTTACCTGCTATAAGTGCGGGGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCCTGAGTGGGCAGTAACGAGTGCTTTGGGGTATGGACATAATGGACAGTCAATTTTAATTTTAACATCAAGATGCTGGAGACTTTTTCCTTGTTCTATGTAAATATTGGACTCTTTTTCTGCTATTTACTCTGAGCAGTTGATAGGAATCTTCTCCTTCCAAGAACTGTTTGGCAAAGAGAGTTTTTGCCAATAACTATTTTTTTAAATAAAAAATGTAAATGAATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGACAAGATCAAATGCCAACAGTTCTCTTGAATTTAACATTGTTAATAAACTCTATTT
                                                      consensus depths                                                               2     3     2     3     3     5     5     6     6     7     7    11    13    13    16    17    15    18    16    18    18    18    18    20    18    20    18    20    18    20    19    21    18    21    18    21    18    22    18    22    17    22    17    21    17    21    17    21    19    21    19    20    19    20    19    20    19    20    19    20    19    20    19    21    19    23    19    23    19    23    21    23    20    22    19    21    19    21    20    22    20    22    20    22    20    22    20    22    20    22    21    22    21    22    21    22    21    22    19    21    19    21    19    21    18    22    16    20    16    19    15    18    16    18    16    18    15    18    17    19    16    19    17    19    16    19    14    18    14    16    15    17    14    17    14    17    11    17    10    16    11    17    11    17    12    17    12    17    12    16    11    16    11    15    10    15    10    15    10    14    10    14    10    14    10    11     9    10    10    10    10    10    10    10     9    10     9    10    10    11    11    11    10    11    10    10     7     8     6     7     5     7     5     7     5     7     5     7     5     7     4     6     2     3     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----G-------
                                               BLH ATG     126    1318                                                          
                                               BLH MIN     126     153                                                          
                                               BLH MPR      84     153                                                          
                                               BLH OVR     126      31                                                          
                                               CDS MIN     126      14                                                          
                                               EST CLI      44      14                                                          
                                               ORF LNG     126       1                                                          
  5   1   2       bld Egg1 5g                            PBX0164C11.5p CGCTTCTCCACTCACAGCTTTGAGCCCCGCCCCCTCCCGGCGTGCTTCGCATTGGTTGTTTCCCAGAGTGCCCTGCTCTAGGTTGAGAAATCGATCGTAGGCGTCGTGCGGCTTTCTGTTGGTCGAGTCTGATGCTGATATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTTCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAG
  5   1   2       bld Kid  5g                         IMAGE:7008442.5p                                  CCCACGCGTCCGCCCACGCGTCCGGTTTCCCAGAGTGCCCTGTTCTAGGTTGAGAAATCGATCGTAGGCGTCGTGCGGCTTTCTGTTGGTCGAGTCTGATGCTGATATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTACCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGCCTCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATATT
  5   1   2       bld Lmb1 5g                         IMAGE:8535239.5p                                                        AAAAAANNNNAATATCGTNNGNAAAGAGTACTAATACTATTCGTCCCGTCGTGCGGCTTTCTGTTGGTCGAGTCTGATGCTGATATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGATTACCTATGGGAACCGCAGAACAGCCGCCGCTACCTCAGCAGACACAGAATCAGCAGAAGCAAATAATAACCAGGTGTTACAAAGTCATCTTCACTCATTCGCTAAAAGCCAGAATCTCCTGTCAGCAACAGC
  5   1   2       bld Ga18 5g3  in                        xlk8p13ex.5p                                                                       GCCCNNNNTAGGTTGAGAAATCGATCGTAGGCGTCGTGCGNNTTTCTGTTGGNCGAGNCTGATGCTGATATTTGGTAGTNGNGGNGGTGCGGGACTCGGNACCGGNAACGAAAATGCAGGAGTTAATCNCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGNNCNCAACCCCTCCCATTCCCGGGCATGGACNAGNCTGGGGCTGCTGTTTGTGAATT
  5   1   2       bld Egg3 5g                         IMAGE:6322612.5p                                                                               TCCCGGGGAGAATCGATCGTAGGCGTCGTGCGGCTTTCTGTTGGTCGAGTCTGATGCTGATATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGCCTCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAAGCCAGAATTCTCCTGTCAGCCAACAGCGTTCTCCACAGACAATCGGGTGTCATGCAGTTACAAAGTGGCACCCAGGGGAAACCGGGGGACCCTAGGCCCACTGGACCAGGTTACCCTGGCTATNNAGTGCGGGGAAGAAAAGGGACATTATTGCCAAACAGAATGGC
  5   1   2       bld Ga12 5g                              XL199h10.5p                                                                                         AATCGATCGTAGGCGTCGTGCGGCTTTCTGTTGGTCGAGTCTGATGCTGATATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGG
  5   1   2       bld Ga18      in                      xlk107n11ex.5p                                                                                                      CGTCGTGCGGCTTTCTGTTGGTCGAGTCTGATGCTGATATTTGGTAGTGGTGGTGGTGCGGGANTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGNAGCTNTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGNNNNNNATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCNCCTCTACCTCAGCAGACACAGAATCAGCAGAANCAAAATAATAACCAGGTGTTACAAAGGTCATCTNCACTCNNTCAGCTAACAAGCCAGAATTCTCCTGTCAGCCAACAGNNNC
  5   1   2       bld Ooc1 5g3  in                     Ooc1-db23d10.y1                                                                                                            GGGTCGACCCACGCGTCCGGTCTGATGCTGATATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGTGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACTGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGATCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCGCTAACTGTAAATTTATGCATACCCGTTATGAATTA
  5   1   2       bld Ga12 5g3  in                         XL189a03.5p                                                                                                             GGGCTTTCTGTTGGTCGAGTCTGATGCTGATATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTANAATGCCANAGTGCTACTTCTACTCCAAGTTTGGCGAG
  5   1   2       bld Egg3 5g                         IMAGE:6867488.5p                                                                                                                 CCCCGGGCCCGGGGGTCTGATGCTGATATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGCCGCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAAGCCAGAATTCTCCCTGTCAGCCAACAGCGTTCTCCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCAGGGAAACCGGGGACCTAGGCCACTGGACCAGGTTACCTGCTATAAGTGCGGGGGAAAAAGGACATTATGCCAAACAGATGGTACAAAGGGTCACTTTGGCTTTTCCTGAAATGGGGCAGTAACCAAATTGCCTTTTGGGGGTATGGGAAATAACTGGGAAAGGT
  5   1   2       bld Ov1  5g3  in                    IMAGE:5048819.5p                                                                                                                    CCACGCGTCCGGTCTGATGCTGATATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGTGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACTGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGATCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGAGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTATGCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGC
  5   1   2       bld Egg3 5x3                        IMAGE:6867239.5p                                                                                                                            ATTCCCGGGTGCTGATATTTGGTACCGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGCCTCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAAGCCAGAATTCTCCTGTCAGCCAACAGCGTTCTCCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCCAGGGAAACCGGGGACCTAGGCCACTGGACCAGGTTACCTGCTATAAGTGCCGGGGAGAAAGGACATTATGCCCACAGATGTACAAAAGGCCACTTGGCTTTTCCTGAATGGGCAGTAACGAGTGCTTTTGGGTATGGGCCTTATGGAACGCCCATTTTAATTTTTAACCTCCAAAA
  5   1   2       bld Te2N 5x3                        IMAGE:7203999.5p                                                                                                                               GTCTGATGCTGATATTTGGTAGTGGTGCTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGCCTCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAAGCCAGAATTCTCCTGTCAGCCAACAGCGTTCTCCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCCAGGAAACCGGGGACTTAGGCACTGGACCANGTTACCTGCTATAAGTTGCGGGGAGAAAGGACATTATGCCAACAGAATGTAACAAAAGGTCACTTGGCCTTTTCCTGAAATTGGGCAGTTACAGAAATGCCT
  5   1   2       bld Ga12 5g3  in                         XL218c09.5p                                                                                                                                    GCACGAGGATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGC
  5   1   2       bld Ga12 5g3  in                         XL218g07.5p                                                                                                                                    GCACGAGGATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGA
  5   1   2       bld Thy  5g                         IMAGE:8548626.5p                                                                                                                                      GCTGATATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTACCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGCCTCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAGCCAGAATTCTCTGTCAGCCACAGCGTTCTCACAGACAATCGTGTCATGCATTACAAGTGGCACCAGGAAACNGGGNACTAGCACTGGACAGTACTGCTTAGTGCGGGAGAGGACTATGCACGATGTCAAGGTACTGCTTCTGATGCATA
  5   1   2      seed Ga15 5g3  in                       XL475o21ex.5p                                                                                                                                       CTGATATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCANAACAGCCGCCTCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAAGCCAGAATTCTCCTGTCAG
  5   1   2       bld Egg3 5x3                        IMAGE:6323966.5p                                                                                                                                                        TCCCGGGTGCGGGACTCGGTTCCGGTAACGAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGCCTCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAAGCCAGAATTCTCCTGTCAGCCAACAGCGTTCTCCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCCAGGGAAACGGGGGACCTAGGCCACTGGACCAGGTTACCTGCTATAAGTGCGGGGGAGAAAGGACATTATGCCCAACAGATGTACAAAAGGTCCCCTTGGCTTTTCCTGAATGGGGCAGTAACGAGTGCCTTTTGGGGGGATGGGACTATATGGGACCAGGCCAATTT
  5   1   2       chi Emb1                   IMAGE:6633427-IMAGp.IMAGp                                                                                                                                                                                        TGCTGATATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGCCTCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAAGCCAGAATTCTCCTGTCAGCCAACAGCGTTCTCCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCAGGGAAACCGGGGAC
  5   1   2       chi Emb1                            IMAGE:6633427.5p                                                                                                                                                                                         GCTGATATTTGGTAGTGGTGGTGGTGCGGGACTCGGTACCGGTAACGAAAATGCAGGAGTTAATCGCTTGTGTGGACCACTTACGGTTCGATCTGGAGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAGCGGAATGTGTCCGTTCAGACATATCAGTGGAGAGAAGACGGTAGTCTGTAAACACTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGCCTCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAAGCCAGAATTCTCCTGTCAGCCAACAGCGTTCTCCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCAGGGAAACCGGGGACCTAGGCCACTGGACCAGGTTACCTGCTATAAGTGCGGGGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCCNTGAGTGGGCAGTAACGAAGTGCCTTTGGGGGTATGGGACATAATGGGGACAGTCAAATTTTANATTTTAAC
  5   1   2       bld Ga15      in                       XL447d18ex.5p                                                                                                                                                                                                                                      AGCTGGCCGTGGAACAGCAGCTGGGGGCTCAACCCCTCCCATTCCCGGGCATGGACAAGTCTGGGGGCTGCTGTTTGTGAATTTTTTCTGAAGTCGGCCTGTGGAAAAAGGCGGAATGTGTCCGTTCA
  3   1   2       chi Ga18      in                      xlk107n11ex.3p                                                                                                                                                                                                                                                                                TNCCGGNNATGGNNNAANNNNGGGGNTGCTNTTNNNNANTTTTTCNNAAGTCNGCNNNNNNAAANGNCGGAATGTNTCCGTTNAGACANNTCAGTGGAGAGAAGACGGTAGTCTGTAAACNCTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTCCTGCACGAATATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGCCTCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAAGCCAGAATTCTCCTGTCAGCCAACAGCGTTCTCCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCAGGGAAACCGGGGACCTAGGCCACTGGACCAGGTTACCTGCTATAAGTGCGGGGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCCTGAGTGGGCAGTAACGAGTGCTTTGGGGTATGGACATAATGGACAGTCAATTTTAATTTTAACATCAAGATGCTGGAGGCTTTTTCCTTGTTCTATGTAAATATTGGACTCTTTTTCTGCTATTTACTCTGAGCAGTNGATAGGANTCTTCTCCTTCCAAGAACTGTTTGGCAAAGAGAGNNNNNNCA
  3   1   2       bld Ga15      in                       XL447d18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                          TGNGAATTCCTGCNCGAATATGATATGACTAAAAATGCCAGAGTGCTACTTNTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGCCTCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAAGCCAGAATTCTCCTGTCAGCCAACAGCGTTCTCCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCAGGGAAACCGGGGACCTAGGCCACTGGACCAGGTTACCTGCTATAAGTGCGGGGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCCTGAGTGGGCAGTAACGAGTGCTTTGGGGTATGGACATAATGGACAGTCAATTTTAATTTTAACATCAAGATGCTGGAGGCTTTTTCCTTGTTCTATGTAAATATTGGACTCTTTTTCTGCTATTTACTCTGAGCAGTTGATAGGAATCTTCTCCTTCCAAGAACTGTTTGGCAAAGAGAGTTTTTGCCAATAACTATTTTTTTTAATAAAAAATGTAAATGAATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGACAAGATCAAATGCCAACAGTTCTCTGAATTAACATGT
  3   1   2       bld Ga12 5g3  in                         XL218g07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                        CANGAATATGATATGANTAAAATGCCAGAGTGTACTTCTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGGCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGCCGCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAAGCCAGAATTCTCCTGTCAGCCAACAGCGTTCTCCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCAGGGAAACCGGGGACCTAGGCCACTGGACCAGGTTACCTGCTATAAGTGCGGGGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCCTGAGTGGGCAGTAACGAGTGCTTTGGGGTATGGACATAATGGACAGTCAATTTTAATTTTAACATCAAGATGCTGGAGACTTTTTCCTTGTTCTATGTAAATATTGGACTCTTTTTCTGCTATTTACTCTGAGCAGTTGATAGGAATCTTCTCCTTCCAAGAACTGTTTGGCAAAGAGAGTTTTTGCCAATAACT
  3   1   2       bld Ga12 5g3  in                         XL218c09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAATATGATATGACTAAAATGCCAGAGTGCTACTTNTACTCCAAGTTTGGCGAGTGCAGTAACAAAGAGTGCCCGTTTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGCCGCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAAGCCAGAATTCTCCTGTCAGCCAACAGCGTTCTCCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCAGGGAAACCGGGGACCTAGGCCACTGGACCAGGTTACCTGCTATAAGTGCGGGGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCCTGAGTGGGCAGTAACGAGTGCTTTGGGGTATGGACATAATGGACAGTCAATTTTAATTTTAACATCAAGATGCTGGAGACTTTTTCCTTGTTCTATGTAAATATTGGACTCTTTTTCTGCTATTTACTCTGAGCAGTTGATAGGAATCTTCTCCTTCCAAGAACTGTTTGGCAAAGAGAGTTTTTGCCAATAACTA
  3   1   2       bld DMZ                                 rxl238e20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCTGCATATTGACCCAGAATCAAAGATAAAAGACTGCCCGTGGTATGACAGGGGCTTCTGTAAGCACGGACCCCTCTGCAGACACCGGCATACTCGAAGAGTTATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTTATGCATCCCCGTTTTGAATTACCTATGGGAACCGCAGAACAGCCGCCTCTACCTCAGCAGACACAGAATCAGCAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAAGCCAGAATTCTCCTGTCAGCCAACAGCGTTCTCCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCAGGGAAACCGGGGACCTAGGCCACTGGACCAGGTTACCTGCTATAAGTGCGGGGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCCTGAGTGGGCAGTAACGAGTGCTTTGGGGTATGGACATAATGGACAGTCGATTTTAATTTTAACATCAAGATGCTGGAGACTTTTTCCTTGTTCTATGTAAATATTGGACTCTTTTTCTGCTATTTNCTCTGAGCAGTTGATAGGAATCTTCTCCTTCCAAGAACTGTTTGGCAAAGAGAGTTTTTGCCAACTAATTATTTTTTTAAATAAAAAATGTAAATGAATTTTnATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGACAAGATCAAATGCCAACAGTTCTCTGAATTAAC
  3   1   2       bld Ga18 5g3  in                        xlk8p13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCCCGTTTTGANNNNCCTATGGGAACCGCAGAACAGCCNNCTCTNCCTCAGCAGACACAGAATCAGCAGAAGCAANATAANNNCCAGGTGTTACAAAGGTCATCTTCNCTCATTCAGCTAACAAGCCAGAATTCTCCTGTCANCCAACAGCGTTCTCCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCAGGGAANCCGGGGNCCTAGGCCACTGGNCCAGGTTACCTGCTATAAGTGCGGGGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCCTGAGTGGGCAGTAACGAGTGCTTTGGGGTATGGACATAATGGACAGTCAATTTTAATTTTAACATCAAGATGCTGGAGACTTTTTCCTTGTTCTATGTAAATATTGGACTCTTTTTCTGCTATTTACTCTGAGCAGTTGATAGGAATCTTCTCCTTCCAAGAACTGTTTGGCAAAGAGAGTTTTTGCCAATAACTATTTTTTTAAATAAAAAATGTAAATGAATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGACAAGATCAAATNCCAACAGTCTCTG
  3   1   2       bld Ooc1 5g3  in                     Ooc1-db23d10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGCAAAATAATAACCAGGTGTTACAAAGGTCATCTTCACTCATTCAGCTAACAAGCCAGAATTCTCCTGTCAGCCAACAGCGTTCTCCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCAGGGAAACCGGGGACCTAGGCCACTGGACCAGGTTACCTGCTATAAGTGCGGGGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCCTGAGTGGGCAGTAACGAGTGCTTTGGGGTATGGACATAATGGACAGTCGATTTTAATTTTAACATCAAGATGCTGGAGACTTTTTCCTTGTTCTATGTAAATATTGGACTCTTTTTCTGCTATTTACTCTGAGCAGTTGATAGGAATCTTCTCCTTCCAAGAACTGTTTGGCAAAGAGAGTTTTTGCCAATAACTATTTTTTTAAATAAAAAATGTAAATGAATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGACAAGATCAAATGCCAACAGTTCTCTTGAATTTAACATTGTTAATAAACTCTATTTTAGTGAAAAAAAAAAAAAAAAAGGGC
  3   1   2       bld Ga12 5g3  in                         XL189a03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCAGGTGTTACAAAGGTCATNTTCACTCATTCAGNTAACAAGCCAGAATTCTCCTGTCAGCCAACAGCGTTCTCCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCAGGGAAACCGGGGACCTAGGCCACTGGACCAGGTTACCTGCTATAAGTGCGGGGAGAAAGGNCATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCCTGAGTGGGCAGTAACGAGTGCTTTGGGGTATGGACATAATGGACAGTCAATTTTAATTTTAACATCAAGATGCTGGAGACTTNTTCCTTGTTCTATGTAAATATTGGACTCTTTTTNTGCTATNTACTCTGAGCAGTTGATAGGAATNTTCTCCTTCCAAGAACTGTTTGGCAAAGAGAGTTTTTGCCAATAACTATTTTTTTAAATAAAAAATGTAAATGAATTTTTATTTnTTNTTATTTCTNTAATATAACTTTNGTACAGACAAGATCNAATGCCAACAGTTCTCTTGAATTTAACA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5048819.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCACAGACAATCGGTGTCATGCAGTTACAAAGTGGCACCCAGGGAAACCGGGGACCTAGGCCACTGGACCAGGTTACCTGCTATAAGTGCGGGGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCCTGAGTGGGCAGTAACGAGTGCTTTGGGGTATGGACATAATGGACAGTCGATTTTAATTTTAACATCAAGATGCTGGAGACTTTTTCCTTGTTCTATGTAAATATTGGACTCTTTTTCTGCTATTTACTCTGAGCAGTTGATAGGAATCTTCTCCTTCCAAGAACTGTTTGGCAAAGAGAGTTTTTGCCAATAACTATTTTTTTAAATAAAAAATGTAAATGAATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGACAAGATCAAATGCCAACAGTTCTCTTGAATTTAACATTGTTAATAAACTCTATTTTAGTGATGACTGGAAACTGC
  3   1   2       bld Ga15 5g3  in                       XL475o21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGCCACTGGACCAGGTTACCTNCTATAAGTGCGGGGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCCTGAGTGGGCAGTAACGAGTGCTTNGGGGTATGGACATAATGGACAGTCAATTTTAATTTTAACATCAAGATGCTGGAGGCTTTTTCCTTGTTCTAGGTAAATATTGGACTCTTTTTCTGCTATTTACTCTGAGCAGTTGATAGGAATCTTCTCCTTCCAAGAACTGTTTGGCAAAGAGAGTTTTTGCCAATAACTATTTTTTTTAATAAAAAA
  3   1   2       bld Ga12                                 XL162k13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGATAGGAATCTTNTCCTTCCAAGAACTGTTTGGCAAAGAGAGTTTTTGCCAATAACTATTTTTTTAAATAAAAAATGTAAATGAANTNNNATTTCTTTTTATTTNTGTAATATAACTNTTGTACAGACAAGATCAAATGCCAACAGTTCTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)