Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 50%

 1012769575 Xl3.1-IMAGE:6637345.5 - 32 ESTs
                                                                       ......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6637345.5                                                                                                                                                                                                               ACAAGCATAGTCGAATTGTGGCGCGGGCTCTCTTACCAGTTATTGGTGAATCGCATTGGCTGGATTCAGTTAGGCGCTGCCATGACGGGAGGCAAGGAGCTTGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTGCTGGAAATTTCTTCATCTCTGAAAGCCCTTAAAGAAGAGTGTGTGGACCTCTGCAGCTCTGTGACTGATGGTGATAAGGTTATTCAGAGTTTGAGACTGGCCTTGACTGATTTTCATCAACTGACTATAGCCTTTAATCAAATTTATGCGAATGAGTTCCAGGAGCACTGTGGCCATCCTGCCCCTCATATGAGCCCTATGGGACCCTTTTTCCAATTTGTCCACCAGTCCCTTAGCACCTGCTTTAAGGAGCTTGAATCCATCGCCCAATTTACGGAAACTTCGGAGAATATTGTAGATGTGGTGAGGGAGAGGCATCAGTCTAAGGAGAAATGGGCTGGAAGCACAATATCCACTCTGTGTGAAAAAATGAAAGAACTGAGACAGAGCTATGAGGCATTCCAACAAAGTTCATTGCAGGACTGAAGAACTGAGCTTTTGGTTTCTTTGTGCCGAACTTCAGTGCTATCGCAAAAAACATGTGCTTTTCAAAATGACTGCCTATAACTTTGACACATGATGAAGACTGGACAGTTGAACTTGTACTGATTCATTCAGCAATGCACATATTTTTATATTTATTTAATGTGGTACACATTGAAAACAGATTGAAGAGCATACATATATGGTCAAGCACATTGATGTAGAATTTAGTTTTAAACATTTCTCCCATGCCTTTTCATGTTGCATAAAGGGAACCCATAAAAACAACTGTTCAGCTAGAATAAACTTACATGTCAAAAAAAGTTGTCTCGTTTTCCATCAAAAGATACTGTCTTGTCTCTGGTGAATCAATGGTTATTTCAACTGTAGCATAACAAATGTAACTCTTTTAAGGATGTTATCTTTAAAAACAACAAGGTAATAAACGACCTTTTGCTGTTAAGTAGTAGTGGCTACTTTTTGTACCATTGTGCAGCAACTGTTTTACTGTATAAAGAATTTCTAGCTGTTTGTGTCAAGAAAATATGAAATTGCTATAGGCAGAATATTGAGTGCCTATTTGGTTATACATTTAGGTTAACTCGTTCAGACAGGGGCGTGGTTGCCTATGTATATACAATTTAATAAAATAAAGCTATAGCCCATTTAAAGCAG
                                                  Xl3.1-CHK-1012687843                                                                                                                                                                                                                     ATAGTCGAATTGTGGCGCGGGCTCTCTTACCAGTTATTGGTGAATCGCATTGGCTGGATTCAGTTAGGCGCTGCCATGACGGGAGGCAAGGAGCTTGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTGCTGGAAATTTCTTCATCTCTGAAAGCCCTTAAAGAAGAGTGTGTGGACCTCTGCAGCTCTGTGACTGATGGTGATAAGGTTATTCAGAGTTTGAGACTGGCCTTGACTGATTTTCATCAACTGACTATAGCCTTTAATCAAATTTATGCGAATGAGTTCCAGGAGCACTGTGGCCATCCTGCCCCTCATATGAGCCCTATGGGACCCTTTTTCCAATTTGTCCACCAGTCCCTTAGCACCTGCTTTAAGGAGCTTGAATCCATCGCCCAATTTACGGAAACTTCGGAGAATATTGTAGATGTGGTGAGGGAGAGGCATCAGTCTAAGGAGAAATGGGCTGGAAGCACAATATCCACTCTGTGTGAAAAAATGAAAGAACTGAGACAGAGCTATGAGGCATTCCAACAAAGTTCATTGCAGGACTGAAGAACTGAGCTTTTGGTTTCTTTGTGCCGAACTTCAGTGCTATCGCAAAAAACATGTGCTTTTCAAAATGACTGCCTATAACTTTGACACATGATGAAGACTGGACAGTTGAACTTGTACTGATTCATTCAGCAATGCACATATTTTTATATTTATTTAATGTGGTACACATTGAAAACAGATTGAAGAGCATACATATATGGTCAAGCACATTGATGTAGAATTTAGTTTTAAACATTTCTCCCATGCCTTTTCATGxxxxAxAAAGGGAACCCATAAAAACAACTGTTCAGCTAGAATAAACTTxxATGTCAAAAAAAGTTGTCTCGTTTTCCATCAAAAGATACTGTCTTGTCTCTGGTGAATCAATGGTTATTTCAACTGTAGCATAACAAATGTAACTCTTTTAAGGATGTTATCTTTAAAAACAACAAGGTAATAAACGACCTTTTGCTGTTAAGTAGTAGTGGCTACTTTTTGTACCATTGTGCAGCAACTGTTTTACTGTATAAAGAATTTCTAGCTGTTTGTGTCAAGAAAATATGAAATTGCTATAGGCAGAATATTGAGTGCCTATTTGGTTATACATTTAGGTTAACTCGTTCAGACAGGGGCGTGGTTGCCTATGTATATACAATTTAATAAAATAAAGCTATAGCCCATTTA
                                                      consensus depths                                                                                                                                                                                                                    4     5     4     5     5     7     6     7     6     7     9     9    10    12    10    12    13    15    14    15    15    16    16    17    16    17    17    18    17    18    17    18    17    18    17    18    17    18    16    17    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    18    18    18    18    18    18    18    18    18    18    17    18    17    18    17    18    17    18    17    18    17    18    18    19    18    19    17    18    16    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    13    17    15    17    13    16    11    15    12    14    11    13    10    13     9    13     9    12    10    12     8    11     9    10     6     8     5     8     6     9     8    10     8    11     7    11     7    11     7    11     7    12     6    11     6    11     6    10     5     8     6     9     6    11     6    11     7    11     7    11     6    10     6    10     6    10     6    10     5    10     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     5    11     5    11     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5     9     5     9     5     9     5     9     4     8     4     7     4     7     4     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     7     6     7     6     7     6     7     7     8     7     8     6     8     6     8     6     8     6     8     6     8     6     7     6     7     6     7     4     5     4     5     2     2     2     2
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAAAAACATGTGCTTTTCAAAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTGACACATGATGAAGACTGGACAGTTGAACTTGTACTGATTCATTCAGCAATGCACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATTTATGAAAACAGATTGAAGAGCATACATATATGGTCAAGCACATTGATGTAGAATTTAGTTTTAAACATTTCTCCCATGCCTTTTCATGTTGCATCACAAGATAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACAAGATAAAAAGGGAACCCATAAAAACAACTGTT
                                               BLH ATG      82      81                                                                                                                                                                                                               
  5   1   2       bld Emb4 5g3  in                    IMAGE:4959903.5p TCGCGAGCGGTCGCCCtttttttttttttttCACACAGAGTGGATATTGTGCTTCCAGCCCATTTCTCCTTAGACTGATGCCTCTCCCTCACCACATCTACAATATTCTCCGAAGTTTCCGTAAATTGGGCGATGGATTCAAGCTCCTTAAAGCAGGTGCTAAGGGACTGGTGGACAAATTGGAAAAAGGGTCCCATAGGGCTCATATGATTGTCAGGATGGCCACAGTGCTCCTGGAACTCATTCGCATAAATTTGATTAAAGGCTGGATTCAGTTAGGCGCTGCCATGACGGGAGGCAAGGAGCTTGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTAC
  5   1   2       bld Em10 5g                         IMAGE:7978871.5p                                                                                                                                                                                                   CGGAACTCCCCCACAAGCATAGTCGAATTGTGGCGCGGGCTCTCTTACCAGTTATTGGTGAATCGCATTGGCTGGATTCAGTTAGGCGCTGCCATGACGGGAGGCAAGGAGCTTGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGGCTTGCTG
  5   1   2       chi Oo1                             IMAGE:6639969.5p                                                                                                                                                                                                      AACTCCCCCACAAGCATAGTCGAATTGTGGCGCGGGCTCTCTTACCAGTTATTGGTGAATCGCATTGGCTGGATTCAGTTAGGCGCTGCCATGACGGGAGGCAAGGAGCTTGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCCTGACACAATATCAAAGTAATGTCATAACTTGGAATCATTGTCCTCCCAGCACCGaaaaaaaaatggttggggaccctggccttaagaaaaaaaattggaagaagctttttaaaaaaaaaatttattccccccggccccctccctttttcaggggccaaccccttaaagcccccgtgagaggggaaacccccggggccctgggaaaaaattttaaaaaccccccttttaaaaaggggaagagggaaattccctctctcaaaaaaaaagcaacccccctttttttttaggggggggaaaaaaaatttgggggtttttttccggaaaaaaaactttttttcggggagaaaaactccccccccccccccccgaaaaaaccccccttttaaaaaaaaaaaaG
  5   1   2       bld Egg1 5g                            PBX0043D04.5p                                                                                                                                                                                                            CCCACAAGCATAGTCGAATTGTGGCGCGGGCTCTCTTACCAGTTATTGGTGAATCGCATTGGCTGGATTCAGTTAGGCGCTGCCATGACGGGAGGCAAGGAGCTTGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAAT
  5   1   2       bld Egg1 5g                            PBX0078A01.5p                                                                                                                                                                                                            CCCACAAGCATAGTCGAATTGTGGCGCGGGCTCTCTTACCAGTTATTGGTGAATCGCATTGGCTGGATTCAGTTAGGCGCTGCCATGACGGGAGGCAAGGAGCTTGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTGAAGGACTCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAGAATGAAGAGCTTTTAAAAGAATTATTC
  5   1   2       bld Ov1  5g                         IMAGE:8328516.5p                                                                                                                                                                                                                                    CGCGGGCTCTCTTACCAGTTATTGGTGAATCGCATTGGCTGGATTCAGTTAGGCGCTGCCATGACGGGAGGCAAGGAGCTTGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTGCTGGGAATTTCTTCATCTCTGAAGCCCTTAAAGAAGAGTGTGTGGACTCT
  5   1   2       bld Te2N 5g                         IMAGE:7768044.5p                                                                                                                                                                                                                                       CGGGCTCTCTTACAGTTATTGGTGAATCGCATTGGCTGGATTCAGTTAGGCGCTGCCATGACGGGAGGCAAGGAGCTTGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTGCTGGAAATTTCTTCATCTCTGAAAGCCCTTAAAGAAGAGTGTGTGGACCTCTGCAGCTC
  5   1   2       bld Ov1  5g                         IMAGE:6316632.5p                                                                                                                                                                                                                                                                   GCATTGGCTGGATTCAGTTAGGCGCTGCCATGACGGGAGGCAAGGAGCTTGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAGTTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTGGCTGGAAATTTTCTTCANNTCTCTGAAAAGCCCTTTAAAAGAAAGGAGTGTTGGTGGGACCCCTCTTGCAGNCTTCTGGTGGGACTGGAATGGGA
  5   1   2       bld Emb1 5g                         IMAGE:6637345.5p                                                                                                                                                                                                                                                                           TGGATTCAGTTAGGCGCTGCCATGACGGGAGGCAAGGAGCTTGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTGCTGGAAATTTCTTCATCTCTGAAAGCCCTTANAGAAGAGTGTGTGGACCTCTGCAGCTCTGTGACTGATGGTGATAAGGTTATTCAGAGTTTGAGACTGGGCTTGACTGATTTTCATCAACTGACTATAGCCCTTTAATCAAAATTTATGCGGAATGAGTTTCCAGGAGCACTGTGGGCCATC
  5   1   2       bld Oo1  5g                         IMAGE:5085541.5p                                                                                                                                                                                                                                                                             CACGCGTCCGGGCGCTGCCATGACGGGAGGCAAGGAGCTTGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAACGCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTGCTGGAAATTTCTTCATCTCTGAAACCCCTTAAAGAAGAGTGTGTGGACCTCTGCAGCTCTGTGACTGATGGTGATAAGGTTATTCACAGTTTTAAGACTGGCCCTTGACTGATTTTTCTCAACTGACTATACCCTCTTAATCAAATTTTATGCCCATGGAGTTCCCAGGACCACTGTGGCCCATTCCTGCCCCCTCATATTGAGGCCCTTATGGGGAACCCTTTTTTTCCCATTTTGGTCCCACCCAAGTTCCCCTTTACCCACCCTGGCTTTTAAGA
  5   1   2       bld Ga18      in                      xlk119p14ex.5p                                                                                                                                                                                                                                                                              TGGATTCAGTTAGGCGNTNNNNGACGGGAGGNAGGAGCTTGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATNCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTGTATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGNCNCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGNCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTNNTGGAAATTTCTTCATCTCTGAAAGCCCTTAAAGAAGAGTGTGTGGACCTCTGCAGCTCTGTGACTGATGGTGATAAGGNTATTCAGAGTTTGAGACTGGCCTTGACTGATTTTCATCAACTGACTATAGCCTTTAATCAAATTTATGCGAATGAGTTCCAGGAGCACTGTGGCCATCCTGCCCCTCATATGAGCCCTATGGGANCCTTTTTCCAATTTGTCCACCAGNCCCTTAGCACCTGCTTTAAGGNGCTTGAATCCATCGCCCNANTTACGGAAACTTCGNAG
  5   1   2       bld Te2                             IMAGE:7211223.5p                                                                                                                                                                                                                                                                                      TTCCCGCGAATTTCCCGGGGGATGGAGCTTGGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAAATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACaaaaaaaaaTGTTGTGACCTGCATAAGAAAAAATGAAGAACTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGGCACCCTCAGCCCTGAATGCAACCCCTGGCCTGGAGAATTCAAACCTCTTCTAAATGCAGAAGAATCTCTTCAGAAAAGAACAACCCAATCCAACAAGGGAAAAGAAATGAATAATTCTGTAAAAGCCTTGCTGGAAATTTCCTCCTCTCTGAAAGCCCTTAAAGAAGAGTGGTGTGACCTCTGCAGCTCTGTGACTGATGGGTGATAAGGGTATCAGAGTTTGAGACTGGNCTTGACTGATTTTTCATCACTGACTATAGCCTTTAATCAAATTTATGCGAATGAGTTCAANGAGCACTGTGGGCATCCTGCCCCTCATATGAGCCCTATGGGACCNTTTTCCAATTTGTCCCACAGTCCCTTAGCACTGCTTTAAGGAGCTTGAATCCCTCGCCCATTTTCGGAAACTTCGGaaaaaaatgtaaaaaTGGGGGGAGGGGAAAGGATTC
  5   1   2      seed Ga15      in                       XL462g18ex.5p                                                                                                                                                                                                                                                                                                    CGGGAGGCAAGGAGCTTGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTGCTGGAAATTTCTTCATCTCTGAAAGCCCTTAAAGAAGAGTGTGTGGACCTCTGCAGCTCTGTGACTGATGGTGATAAGGTTATTCAGAGTTTGAGACTGGCCTTGACTGATTTTCATCAACTGACTATAGCCTTTAATCA
  5   1   2       bld Ov1       in                    IMAGE:8328321.5p                                                                                                                                                                                                                                                                                                    CGGGAGGCAAGGAGCTTGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTGCTGGAAATTTCTTCATCTCTGAAAGCCCTTAAAGAAGAGTGTGTGGACCTCTGCAGCTCTGTGACTGATGGTGATAAGGTTATTCAGAGTTTGAGACTGGCCTTGACTGATTTTCATCA
  5   1   2       bld Ga12      in                         XL210g15.5p                                                                                                                                                                                                                                                                                                          GAGGGGAGCTTGGGGCGGCTGTGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTGCTGGAAATTTCTTCATCTCTGAAAGCCC
  5   1   2       bld Ov1                             IMAGE:8332429.5p                                                                                                                                                                                                                                                                                                                               TGGAGTTGTACGAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTGCTGGAAATTTCTTCATCTCTGAAAGCCCTTAAAGAAGAGTGTGTGGACCTCTGCAGCTCTGTGACTGATGGTGATAAGGTTATTCAGAGTTTGAGACTGGCCTTGACTGATTTTCATCAACTGACTATAGCCTTTAATCAAATTT
  5   1   2       bld Emb1                            IMAGE:6632806.5p                                                                                                                                                                                                                                                                                                                                          GAACGGCTGCAGATGCTCTCCTGTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTGCTGGAAATTTCTTCATCTCTGAAAGCCCTTAAAGAAGAGTGTGTGGACCTCTGCAGCTCTGTGACTGATGGTGATAAGGTTATTCAGAGTTTGAGACTGGCCTTGACTGATTTTCATCAACTGACTATAGCCTTTAATCAAATTTATGCGAATGAATTTCCAGGAGCACTGTGGCCATCCTGCCCCCTCATATTGAGCCCTATGGGGAACCTTTTTTTCCAATTTTGTCCCACCAGTTCCCCTTTAGCCCACCTGGCTTTTTAAAGGGAGCCTTGGGAAATCCCATTCCGC
  5   1   2       bld Ga12                                 XL154j11.5p                                                                                                                                                                                                                                                                                                                                                                GTCCATGCTTAGAGGGTGTGTATCTCACAGATCCTCAAAGTATATATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGACATCCTACAGTGGCTGTGCTCAAGAAATTACCCTCCAGTTCAAGAACAATTATCCTCTTTAAAGGAATCTCAAACAGACACTAAAGTAAAAGAAATTGCCAAGCTATGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTGCTGGAAATTTCTTCATCTCTGAAAGCCCTTAA
  5   1   2       bld Te2N                            IMAGE:7205102.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCATGCTTTGCCATTTTGATGACCTGGATCTAATTAGAGGACATGCCAGCCCTTTCAAGCAGATCTCCTTTATTGGGCAACTATTAGATGTCATCCAGTATCCTGACACAATATCAAGTAATGTCATACTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTGCTGGAAATTTCTTCATCTCTGAAAGCCCTTAAAGAAGAGTGTGTGGACCTCTGCAGCTCTGTGACTGATGGTGATAAGGTTATTCAGAGTTTGAGACTGGCCTTGACTGATTTTCATCAACTGACTATAGCCTTTAATCAAATTTATGCGAATGAGTTCCAGGAGCACTGTGGCCATCCTGCCCCTCATATGAGCCCTATGGGACCCTTTTTCCAATTTGTCCACCAGTCCCTTAGCACCTGCTTTAAGGAGCTTGAATCCATCGCCCAATTTACGGAAACTTCGGAGAATATTGTAGATGTGGTGAGGGAGAGGCATCAGTCTAAGGAGAAATGGGCTGGAAGCACAATATCCACTCTGTGTGAAAAAATGAAAGAACTGAGACAGAGCTATGAGGCATTCCAACAAGTTCATTGCAGGACTGAAGAACTGAGCTTTTTGTTTCNTTTGTGNCGAACTTCAGTGCTATCGCAAAAAACATGTGCTTTTTCAAATGACTGCCTATAACTTTGAACCATGGATGAAAAACTGGACAGTTGGACT
  5   1   2       bld Emb4                            IMAGE:5571250.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTGAATCATTGTCTCACAGCACAGAGAAAAATGTTGTGACCTGCATAAGAGAAAATGAAGAGCTTTTAAAAGAATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTGCTGGAAATTTCTTCATCTCTGAAAGCCCTTAAAGAAGAGTGTGTGGACCTCTGCAGCTCTGTGACTGATGGTGATAAGGTTATTCAGAGTTTGAGACTGGCCTTGACTGATTTTCATCAACTGACTATAGCCTTTAATCAAATTTATGCGAATGAGTTCCAGGAGCACTGTGGCCATCCTGCCCCTCATATGAGCCCTATGGGACCCTTTTTCCAATTTGTCCACCAGTCCCTTAGCACCTGCTTTAAGGAGCTTGAATCCATCGCCCAATTTACGGAAACTTCGGAGAATATTGTAAATGTGGTGAGGGAGAGGCATCAGTCTAAGGAGAAATGGGCTGGAAGCACAATATCCACTCTGTGTGAAAAAATGAAAGAACTGAGACAGAGCTATGAGGCATTCCAACAAAGTTCATTGCAGGACTGAAGAACTGAGCTTTTGGTTTCTTTTGTGCCGAACTTCAGTGCTATCNGCAAAAACATGTGCTTTTCAAAATGACTGGCCTATACTTTGACACATGATGAAGACTGGACAGNTGAAACTTGTACTGATACATTCAGCAATGCCACATATTTTTAAATTAATTAAATGTGGGAACACATTGAAAAACGAATGAAGAGCATACTTATATGGGTCAAGGCACCTTTGATG
  5   1   2       bld Egg1                               PBX0042E09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTATTCTCCAGTCCTCACTTTCAGGCCACCCTCAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTCTTCTAAATGCAGAGGAATCTCTTCAGAAAAGAGCAACCCAGTCTAGCAAGGGAAAAGATATGAGTAATTCTGTAGAAGCTTTGCTGGAAATTTCTTCATCTCTGAAAGCCCTTAAAGAAGAGTGTGTGGACCTCTGCAGCTCTGTGACTGATGGTGATAAGGTTATTCAGAGTTTGAGACTGGCCTTGACTGATTTTCATCAACTGACTATAGCCTTTAATCAAATTTATGCGAATGAGTTCCAGGAGCACTGTGGCCATCCTGCCCCTCATATGAGCCCTATGGGACCCTTTTTCCAATTTGTCCACCAGTCCCTTAGCACCTGCTTT
  5  -1   2       bld Emb4                   IMAGE:4959903-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGAGCACTGTGGCCATCCTGCCCCTCATATGAGCCCTATGGGACCCTTTTTCCAATTTGTCCACCAGTCCCTTAGCACCTGCTTTAAGGAGCTTGAATCCATCGCCCAATTTACGGAAACTTCGGAGAATATTGTAGATGTGGTGAGGGAGAGGCATCAGTTTAAGGAGAAATGGGCTGGAAGCACAATATCCACTCTGTGTGa
  5   1   2       bld Egg1                               PBX0010B02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTGTGGCCATCCTGCCCCTCATATGAGCCCTATGGGACCCTTTTTCCAATTTGTCCACCAGTCCCTTAGCACCTGCTTTAAGGAGCTTGAATCCATCGCCCAATTTACGGAAACTTCGGAGAATATTGTAGATGTGGTGAGGGAGAGGCATCAGTCTAAGGAGAAATGGGCTGGAAGCACAATATCCACTCTGTGTGAAAAAATGAAAGAACTGAGACAGAGCTATGAGGCATTCCAACAAAGTTCATTGCAGGACTGAAGAACTGAGCTTTTGGTTTCTTTGTGCCGAACTTCAGTGCTATCGCAAAAAACATGTGCTTTTCAAAATGACTGCCTATAACTTTGACACATGATGAAGACTGGACAGTTGAACTTGTACTGATACATTCAGCAATGCACATATTTTTATATTTATTTAATGTGGTACACATTGAAAACAGATTGAAGAGCATACATATATGGTCAAGCACATTGATGTAGAATTTAGTTTTAAACATTTCTCCCATGCCTTTTCATGTTGCATCACAAGATAAAAA
  5   1   2       bld Egg1                               PBX0010E02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTGTGGCCATCCTGCCCCTCATATGAGCCCTATGGGACCCTTTTTCCAATTTGTCCACCAGTCCCTTAGCACCTGCTTTAAGGAGCTTGAATCCATCGCCCAATTTACGGAAACTTCGGAGAATATTGTAGATGTGGTGAGGGAGAGGCATCAGTCTAAGGAGAAATGGGCTGGAAGCACAATATCCACTCTGTGTGAAAAAATGAAAGAACTGAGACAGAGCTATGAGGCATTCCAACAAAGTTCATTGCAGGACTGAAGAACTGAGCTTTTGGTTTCTTTGTGCCGAACTTCAGTGCTATCGCAAAAAACATGTGCTTTTCAAAATGACTGCCTATAACTTTGACACATGATGAAGACTGGACAGTTGAACTTGTACTGATACATTCAGCAATGCACATATTTTTATATTTATTTAATGTGGTACACATTGAAAACAGATTGAAGAGCATACATATATGGTCAAGCACATTGATGTAGAATTTAGTTTTAAACATTTCTCCCATGCCTTTTCATGTTGCATCACA
  3   1   2       bld Eye1                            IMAGE:6949558.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTATGAGCCCTTAGGGGACCCTTTTTTCCAATTTGGTCCAACCAGTCCCTTAGCCACCTGCTTTAAAGGAGCCTGGAATCCATTCGCCCAAATTTACGGAAACTTCGGAGAATTATTGTAGATGTGGTGAGGGAGAGGCATCAGTCTAAGGAGAAATGGGCTGGAAGCACAATATCCACTCTGTGTGAAAAAATGAAAGAACTGAGACAGAGCTATGAGGCATTCCAACAAAGTTCATTGCAGGACTGAAGAACTGAGCTTTTGGTTTCTTTGTGCCGAACTTCAGTGCTATCGCAAAAAACATGTGCTTTTCAAAATGACTGCCTATAACTTTGACACATGATGAAGACTGGACAGTTGAACTTGTACTGATTCATTCAGCAATGCACATATTTTTATATTTATTTAATGTGGTACACATTGAAAACAGATTGAAGAGCATACATATATGGTCAAGCACATTGATGTAGAATTTAGTTTTAAACATTTCTCCCATGCCTTTTCATGTTGCATCACAAGATAAAAAGGGAACCCATAAAAACAACTGTTCAGCTAGAATAAACTTACATGTCAAAAAAAGTTGTCTCGTTTTCCATCAAAAGATACTGTCTTGTCTCTGGTGAATCAATGGTTATTTCAACTGTAGCATAACAAATGTAACTCTTTTAAGGATGTTATCTTTAAAAACAACAAGGTAATAAACGACCTTTTGCTGTTAAGTAGTAGTGGCTACTTTTTGTACCATTGTGCAGCAACTGTTTTACTGTATAAAGAATTTCTAGCTGTTTGTGTCAAGAAAATATGAAATTGCTATAGGCAGAATATTGAGTGCCTATTTGGTTATACATTTAGGTTAACTCGTTCAGACAGGGGCGATGTT
  5   1   2       bld Ga18      in                      xlk109h18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCCTTAGCACCTGCTTTAAGGAGCTTGAATCCATCGCCCAATTTACGGAAACTTCGGAGAATATTGTAGATGTGGTGAGGGAGAGGNATCAGTCTAAGGAGAAATGGGCTGGANNNNAATATCCACTCTGTGTGAAAAAATGAAAGAACTGAGACAGAGCTATGAGGCATTCCAACAAAGTTCATTGCAGGACTGAAGAACTGAGCTTTTGGTTTCTTTGTGCCGAACTTCAGTGCTATCGCAAAAAACATGTGCTTTTCAAAATGACTGCCTATAACTTTGACACATGATGAAGACTGGACAGTTGAACTTGTACTGATTCATTCAGCAATGCACATATTTTTATATTTATTTATGAAAACAGATTGAAGAGCATACATATATGGTCAAGCACATTGATGTAGAATTTAGTTTTAAACATTTCTCCCATGCCTTTTCATGTTGCATCACAAGATAAAAAGGGAACCCATAAAAACAACTGTTCAGCTAGAATAAACTTATATGTCAAAAAAAGTTGTCTCGTTTTCCATCAAAAGATACTGTCTTGTCTCTGGTGAATCAATGGTTATTTCAACTGTAGCATAACAAATGTAACTCTTTTAAGGATGTTATCTTTAAAAACAACAAGGTAATAAACGACCTTTTGCTGTTAAGNAGNAGTGGCTACTTTTTGTACCATTGTGCAGCAACTGTTTTACTGTATAAAGAATTTCTAGCTGTTNTGTCAAGAAAATATGAAATTNCTATAGGNAGANATTGAGTNCCTATTTGGNTNTNCATTTAGG
  3   1   2       bld Ga15      in                       XL462g18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAGAATATTGTAGATGTGGTGAGGGAGAGGCATCAGTCTAAGGAGAAATGGGCTGGAAGCACAATATCCACTCTGTGTGAAAAAATGAAAGAACTGAGACAGAGCTATGAGGCATTCCAACAAAGTTCATTGCAGGACTGAAGAACTGAGCTTTTGGTTTCTTTGTGCCGAACTTCAGTGCTATCGCAAAAAACATGTGCTTTTCAAAATGACTGCCTATAACTTTGACACATGATGAAGACTGGACAGTTGAACTTGTACTGATTCATTCAGCAATGCACATATTTTTATATTTATTTATGAAAACAGATTGAAGAGCATACATATATGGTCAAGCACATTGATGTAGAATTTAGTTTTAAACATTTCTCCCATGCCTTTTCATGTTGCATCACAAGATAAAAAGGGAACCCATAAAAACAACTGTTCAGCTAGAATAAACTTACATGTCAAAAAAAGTTGTCTCGTTTTCCATCAAAAGATACTGTCTTGTCTCTGGTGAATCAATGGTTATTTCAACTGTAGCATAACAAATGTAACTCTTTTAAGGATGTTATCTTTAAAAACAACAAGGTAATAAACGACCTTTTGCTGTTAAGTAGTAGTGGCTACTTTTTGTACCATTGTGCAGCAACTGTTTTACTGTATAAAGAATTTCTAGCTGTTTGTGTCAAGAAAATATGAAATTGCTATAGGCAGAATATTGAGTGCCTATTTGGTTATACATTTAGGTTAACTCGTTCAGACAGGGGCGTGGTTGCCCTATGTAT
  3   1   2       bld Ga18      in                      xlk119p14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGNAGAGGCNTCANNCTAAGGAGAAATGGNCTNNAAGCACNATATCCNNNCTGTGNGAAAAAATGAAAGAACTGAGACAGAGCTATGAGGCATTCCAACAAAGTTCATTGCAGGNCTGAAGAACTGAGCTTTTGGTTTCTTTGTGCCGAACTTCNNNNNNNCGCAAAAAACATGTGCTTTTCAAAATGACTGCCTATAACTTTGACACATGATGAAGACTGGACAGTTGAACTTGTACTGATACATTCANCAATGCACATATTTTTATATTTATTTAATGTGGTACACATTGAAAACAGATTGAAGAGCATACATATATGGTCAAGCACATTGATGTAGAATTTAGTTTTAAACATTTCTCCCATGCCTTTTCATGTTGCATCACAAGATAAAAAGGGAACCCATAAAAACAACTGTTCAGCTAGAATAAACTTACATGTCAAAAAAAGTTGTCTCGTTTTCCATCAAAAGATACTGTCTTGTCTCTGGTGAATCAATGGTTATTTCAACTGTAGCATAACAAATGTAACTCTTTTAAGGATGTTATCTTTAAAAACAACAAGGTAATAAACGACCTTTTGCTGTTAAGTAGTAGTGGCTACTTTTTGTACCATTGTGCAGCAACTGTTTTACTGTATAAAGAATTTCTAGCTGTTTGTGTCAAGAAAATATGAAATTGCTATAGGCAGAATATTGAGTGCCTATTTGGTTATACATTTAGGTTAACTCGTTCAGACAGGGGCGTGGTTGCCTATGTATATNCAATTTAATAAAATA
  3   1   2       bld Ga12      in                         XL210g15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGGGAGAGGCATCAGTTTAAGGAGAAATGGGGCTGNAAGCACAATATCCACTCTGTGTGAAAAAATGAAAGAACTGAGACAGAGCTATGAGGCATTCCAACAAAGTTCATTGCAGGACTGAAGAACTGAGCTTTTGGTTTCTTTGTGCCGAACTTCAGTGCTATCGCAAAAAACATGTGCTTTTCAAAATGACTGCCTATAACTTTGACACATGATGAAGACTGGACAGTTGAACTTGTACTGATTCATTCAGCAATGCACATATTTTTATATTTATTTAATGTGGTACACATTGAAAACAGATTGAAGAGCATACATATATGGTCAAGCACATTGATGTAGAATTTAGTTTTAAACATTTCTCCCATGCCTTTTCATGTTGCATCACAAGATAAAAAGGGAACCCATAAAAACAACTGTTCAGCTAGAATGTCAAAAAAAGTTGTCTCGTTTTCCATCAAAAGATACTGTCTTGTCTCTGGTGAATCAATGGTTATTTCAACTGTAGCATAACAAATGTAACTCTTTTAAGGATGTTATCTTTAAAAACAACAAGGTAATAAACGACCTTTTGCTGTTAAGTAGTAGTGGCTACTTTTTGTACCATTGTGCAGCAACTGTTTTACTGTATAAAGAATTTCTAGCTGTTTGTGTCAAGAAAATATGAAATTGCTATAGGCAGAATATTGAGTGCCTATTTGGTTATACATTTAGGTTAACTCGTTCAGACAGGGGCGTGGTTGCCTATGTATATACAATTTAATAAAATAAAGC
  3   1   2       bld Ga18      in                      xlk109h18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TNAGGNAGAGGCATCAGTCTAAGGAGAAATGGNCTGGAAGCANAANATCCNCTCTGTGTGAAAAAATGAAAGNACTGAGACAGAGCTATGAGGCATTCCAACAAAGTTCATTGCAGGACTNNAGAACTGAGCTTTTGGTTTCTTTGTGCCGAACTTCANNNNTNGCAAAAAACATGTGCTTTTCAAAATGACTNNCTATAACTTTGACACATGATGAAGACTGGACAGTTGAACTTGTACTGATTCATTCAGCAATGCACATATTTTTATATTTATTTATGAAAACAGATTGAAGAGCATACATATATGGTCAAGCACATTGATGTAGAATTTAGTTTTAAACATTTCTCCCATGCCTTTTCATGTTGCATCACAAGATAAAAAGGGAACCCATAAAAACAACTGTTCAGCTAGAATAAACTTATATGTCAAAAAAAGTTGTCTCGTTTTCCATCAAAAGATACTGTCTTGTCTCTGGTGAATCAATGGTTATTTCAACTGTAGCATAACAAATGTAACTCTTTTAAGGATGTTATCTTTAAAAACAACAAGGTAATAAACGACCTTTTGCTGTTAAGTAGTAGTGGCTACTTTTTGTACCATTGTGCAGCAACTGTTTTACTGTATAAAGAATTTCTAGCTGTTTGTGTCAAGAAAATATGAAATTGCTATAGGCAGAATATTGAGTGCCTATTTGGTTATACATTTAGGTTAACTCGTTCAGACAGGGGCGTGGTTGCCTATGTANANNCANNNNANAAAATNA
  3   1   2       bld Ov1       in                    IMAGE:8328321.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAAAGTTCATTGCAGGACTGAAGAACTGAGCTTTTGGTTTCTTTGTGCCGAACTTCAGTGCTATCGCAAAAAACATGTGCTTTTCAAAATGACTGCCTATAACTTTGACACATGATGAAGACTGGACAGTTGAACTTGTACTGATTCATTCAGCAATGCACATATTTTTATATTTATTTAATGTGGTACACATTGAAAACAGATTGAAGAGCATACATATATGGTCAAGCACATTGATGTAGAATTTAGTTTTAAACATTTCTCCCATGCCTTTTCATGTTGCATCACAAGATAAAAAGGGAACCCATAAAAACAACTGTTCAGCTAGAATGTCAAAAAAAGTTGTCTCGTTTTCCATCAAAAGATACTGTCTTGTCTCTGGTGAATCAATGGTTATTTCAACTGTAGCATAACAAATGTAACTCTTTTAAGGATGTTATCTTTAAAAACAACAAGGTAATAAACGACCTTTTGCTGTTAAGTAGTAGTGGCTACTTTTTGTACCATTGTGCAGCAACTGTTTTACTGTATAAAGAATTTCTAGCTGTTTGTGTCAAGAAAATATGAAATTGCTATAGGCAGAATATTGAGTGCCTATTTGGTTATACATTTAGGTTAACTCGTTCAGACAGGGGCGTGGTTGCCTATGTATATACAATTTAATAAAATAAAGCTATAGCACATTTAAAGCAGTGTGCAAAAAAAAAAAAAAAG
  3   1   2       bld Emb4 5g3  in                    IMAGE:4959903.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTACTGTATAAAGAATTTCTAGCTGTTTGTGTCAAGAAAATATGAAATTGCTATAGGCAGAATATTGAGTGCCTATTTGGTTATACATTTAGGTTAACTCGTTCAGACAGGGGCGTGGTTGCCTATGTATATACAATTTAATAAAATAAAGCTATAGCCCATTTAAAGCAGTGTGCAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)