Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL473o23ex.5                          5 END     1           3       20                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012769670 Xl3.1-PBX0013E12.5 - 28 ESTs
                                                                       ..-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-PBX0013E12.5                       CTGGGAACTACGTTGCACGCCGCGCTAGGTAATGACTGAACCGAGGGGTGGAAGTAGCTTGTCCTTGTGCCATTACCATTTCCGGCTCTTACTTTCTTTTCGGATCCTTCAGCTTTAGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCAGTCAGTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACAACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGTACAAGGACAGTTGGCATCTCTGACAAAGGATTTGAGAAAAGCTTTTCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTCTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATATCTTAAGTGCTGTACAAATGTGACACGGCCCCATTAAGTTATCATTATACTCAAAAAAGCATTTGCACTGCCAGTAAGGTTTTACCTGTGTGAAAGCGCTACCAGACACAATATTAATTTATTAAAAGGACATTTGTTTACTGGGCTAGAACCAGAAAGAGAATTCTATATGTATGTACTGCTGCAATTCTGACAAAGATTTCTCATGCCTGATGAGGAAATACCAAATGCTTAGCTCTGTAAAATAGCAGTCATATGTATCTGAGTGAAAAAGTAAAGTTGGTTTTATCAGTGGACTGCTCTTTTTTACATTATTTGAATTCTACTTCTTGTTTTAATATTTAAATCTGCCAG
                                                  Xl3.1-CHK-1012688361                             ACTACGTTGCACGCCGCGCTAGGTAATGACTGAACCGAGGGGTGGAAGTAGCTTGTCCTTGTGCCATTACCATTTCCGGCTCTTACTTTCTTTTCGGATCCTTCAGCTTTAGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCAGTCAGTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACAACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGTACAAGGACAGTTGGCATCTCTGACAAAGGATTTGAGAAAAGCTTTTCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTCTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATATCTTAAGTGCTGTACAAATGTGACACGGCCCCATTAAGTTATCATTATACTCAAAAAAGCATTTGCACTGCCAGTAAGGTTTTACCTGTGTGAAAGCGCTACCAGACACAATATTAATTTATTAAAAGGACATTTGTTTACTGGGCTAGAACCAGAAAGAGAATTCTATATGTATGTACTGCTGCAATTCTGACAAAGATTTCTCATGCCTGATGAGGAAATACCAAATGCTTAGCTCTGTAAAATAGCAGTCATATGTATCTGAGTGAAAAAGTAAAGTTGGTTTTATCAGTGGACTGCTCTTTTTTACATTATTTGAATTCTACTTCTTGTTTTAATATTTAAATC
                                                      consensus depths                            2     2     3     3     3     3     5     5     5     5     6     6     6     7     6     8     7     9    11    12    15    15    15    15    15    15    14    15    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    17    17    17    17    17    17    17    17    17    17    17    17    17    18    17    18    17    19    18    19    19    19    19    19    19    19    19    19    19    19    19    19    19    22    20    23    20    23    20    24    20    24    19    23    19    23    18    22    17    21    17    21    16    21    16    21    15    19    15    19    15    19    15    19    15    19    15    19    16    20    14    19    14    19    12    18     9    17     9    16     8    16     7    15     7    15     7    15     7    15     6    15     7    13     8    14     8    14     8    13     9    14     9    14     9    13     9    13     9    14     9    14     9    14     9    14     8    14     9    14     9    13     7    11     8    11     8    11     7    11     8    10     8    10     8    10     8    10     7    10     7     9     3     7     3     4     3     3     2     2     2     2     2     2     2     2     2     2
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGTACAAGGACAGTTGGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATTTGAGAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAGCTAAAATACTTCTAGCAAAGATGAAATACTTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                       --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------T---
                                               BLH ATG     171     164                       
                                               BLH MIN     210      70                       
                                               BLH MPR     114      70                       
                                               BLH OVR     120     912                       
                                               CDS MIN     120      70                       
                                               ORF LNG     120      53                       
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Ce ==== 2e-011     NP_500506.1 predicted CDS, DNaJ domain (prokaryotic heat shock protein) (dnj-15)[Caenorhabditis elegans] ===========================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN --- Dm ---- 1e-026     NP_001097616.1 CG34246 CG34246-PA [Drosophila melanogaster] -----------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                               PROTEIN --- Os ---- 3e-029     NP_001066729.1 Os12g0456200 [Oryza sativa (japonica cultivar-group)] --------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                    PROTEIN --- At ---- 9e-030     NP_196259.2 DNAJ heat shock N-terminal domain-containing protein [Arabidopsis thaliana] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ag ---- 3e-036     XP_318106.2 ENSANGP00000017675 [Anopheles gambiae str. PEST] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 7e-040     XP_001195125.1 PREDICTED: similar to MGC82090 protein [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Mm ==== 9e-042     NP_705799.1 J-type co-chaperone HSC20 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                          PREDICTED - Dr ---- 2e-048     NP_001121870.1 hypothetical protein LOC100150029 [Danio rerio] --------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                     PROTEIN --- Bt ---- 5e-053     NP_001095810.1 J-type co-chaperone HSC20 [Bos taurus] --------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                     PREDICTED - Cf ---- 5e-053     XP_534725.2 PREDICTED: similar to J-type co-chaperone HSC20 [Canis familiaris] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                        PROTEIN --- Hs ---- 3e-053     NP_741999.3 J-type co-chaperone HSC20 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Xt ==== 2e-091     NP_001072422.1 hypothetical protein LOC779876 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 4e-123     NP_001086103.1 MGC82090 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-PBX0013E12.5                                                           TGA---------------TAG---------------------------------------------------------------ATG------------------------------------------ATG---ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------TAA------------------------------------------------------------------------------------TGA---------------------TAA---------------------------------------------------------------------------------------------TGATGA------------------------TAA------------ATG------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2       chi Te2N      in                    IMAGE:7202317.5p AAGCTGCGAAGCACGGACAAGGCTGGGAACTACGTTGCACGCCGCGCTAGGTAATGACTGAACCGAGGGGTGGAAGTAGCTTGTCCTTGTGCCATTACCATTTCCGGCTCTTACTTTCTTTTCGGATCCTTCAGCTTTAGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCAGTCAGTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACCACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGTACAAGGACAGTTGGCATCTCTGANCAAGGATTTGAGAAAAGCTTTTCAGCANGGTGATCTCCNAGAAGCTAAAATACTTCTAGCAAAGATGAAATACTTCTCAAATATACNAGACCCAGTAAAGAAGAAAAATATATCTTNAAGGTGCTGTACCAAATGTGGACCCGGGCCCCCTTTAGGTTTAT
  5   1   2       bld Ga12 5g3  in                         XL167m09.5p                       CTGGGAACTACGTTGCACGCCGCGCTAGGTAATGACTGAACCGAGGGGTGGAAGTAGCTTGTCCTTGTGCCATTACCATTTCCGGCTCTTACTTTCTTTTCGGATCCTTCANCTTTAGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCANTCANTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTNGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCANGGCTGACTTGTTCTGTCCGGCCTGTACAACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTAATCCAGATTTCTTTAGCCAGAAGAGAGAGTGAACGAAACATATCANAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTAAA
  5   1   2       bld Egg1 5g                            PBX0094A08.5p                              ACGAGGTGCACGCCGCGCTAGGTAATGACTGAACCGAGGGGTGGAAGTAGCTTGTCCTTGTGCCATTACCATTTCCGGCTCTTACTTTCTTTTCGGATCCTTCAGCTTTAGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCAGTCAGTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACAACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCC
  5   1   2       bld Kid  5g                         IMAGE:7011709.5p                                                          CTGAACCGAGGGGTGGAAGTAGCTTGTCCTTGTGCCATTACCATTTCCGGCTCTTACTTTCTTTTCGGATCCTTCAGCTTTAGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCAGTCAGTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACAACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTGGNAGACTTTGTACANGGACAGTTGGCC
  5   1   2       bld Ga15 5g3  in                       XL422n04ex.5p                                                          CTGAACCGAGGGGTGGAAGTAGCTTGTCCTTGTGCCATTACCATTTCCGGCTCTTACTTTCTTTTCGGATCCTTCAGCTTTAGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCAGTCAGTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACAACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTANAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGT
  5   1   2       chi Ov1  5g                         IMAGE:6318324.5p                                                                               GCTTGTCCTTGTGCCATTACCATTTCCGGCTCTTACTTTCTTTTCGGATCCTTCAGCTTTAGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCAGTCAGTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACAACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTANAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTNCATGAACAAGCTAATGATGCAGATGCTAAAGCTGACATTGAAGAAGTTGGGAGACTTTTGTAACAGATGGGGGTCCCGTGCCCCCCTATTTGAAAAGCTGGAAAAGGATTCNGAAAGAAGGACCGGCAAAATCATTTTAAAAACGGGACAGGTTGGGCAATTCTCCTGAACAAAAGGGATTTTGGAGGAAAAGGCCTTTTTTCCAGCAAGAGGTGGATTCTTTCCC
  5   1   2       bld Thy  5g                         IMAGE:8550647.5p                                                                                            AAACTACCCAAGAGCCCGCACAACGTCGTTCGCGTATTCTATCCCTTAGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCAGTCAGTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACAACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGTACAAGACAGTTGGCATCTCTGACAAAGGATTTGAGAAAAGCTTTTCAGCAAGGTGATCTCCAAGAAGCTAAATACTTCTAGCAAGATGAAATACTTCTCAAATATACAGACCAAGTAAAGAGAAATATATCTTAAGTGCTGTACAAATGTGACACCGGCCCATAGTATCATTATACTCAAAAGCATTTGCACTGCCAGTAAGTTTACTGGGTGAAAGCGCTACGAACCAATTATTATAAAGGACTTTGTTTACTGGGCTAAACGAAAGAGAAATC
  5   1   2       bld Egg1 5g                            PBX0015D12.5p                                                                                                  CTCGAGGCCAGAATTCGGCACGAGGCGGATCCTTCAGCTTTAGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCAGTCAGTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACAACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAG
  5   1   2       bld Te2N 5g                         IMAGE:7204615.5p                                                                                                               GCCCTTTCTTTTCGGATCCTTCAGCTTTAGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCAGTCAGTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACAACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGTACAAGGGTAAATTGGACCCTAGCAACCAGATTTGCTGAATTGGAGAGCAGCTGAATAAAAGCGAAATAATATGAAACCNACAATAAAAAAAATATTAGAGCCaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGNCGCC
  5   1   2      seed Egg1 5g                            PBX0013E12.5p                                                                                                                           CGGATCCTTCAGCTTTAGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCAGTCAGTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACAACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGTACAAGGACAGTTGGCATCTCTGACAAAGGATTTGAGAAAAG
  5   1   2       bld Egg1 5g                            PBX0014C12.5p                                                                                                                           CGGATCCTTCAGCTTTAGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCAGTCAGTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACAACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGANAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTC
  5   1   2       bld Egg1 5g                            PBX0014D12.5p                                                                                                                           CGGATCCTTCAGCTTTAGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCAGTCAGTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACAACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACA
  5   1   2       bld FaB  5g                         IMAGE:8072598.5p                                                                                                                                      GCTTTAGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCAGTCAGTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACCACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGTACAAGGACAGTTGGCATCTCTGACAAGGATTTGAGAAAGCTTTCAGCAGGTGATCTCCNAGAACTAAATACTCTAGCAAGATGAATACTCTCAATA
  5   1   2       bld Egg1 5g                            PBX0016D12.5p                                                                                                                                           AGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCAGTCAGTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACAACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAG
  5   1   2       bld Egg1 5g                            PBX0016E12.5p                                                                                                                                           AGCGATGGAGCCGACCAGGGCGCTATTCAATTCCTGTTCCAGTCAGTGGATGCGAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACAACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGC
  5   1   2       bld Eye1                            IMAGE:6946715.5p                                                                                                                                                                                                GAATGGTAGTTCAGCGTTGGTGGAAGCGTCCAGTGATTCGGGGCTTCTGGGAATACTCTTGGCCGCGTCGATTGCCCTGTATGAAAAGTGCCGTGTCCCATAGTACCTTGCGGCCGAACTTCACTTATTCTATAAGGACTTACTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACAACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGTACAAGGACAGTTGGCATCTCTGACAAAGGATTTGAGAAAAGCTTTTCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTCTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATATCTTAAGTGCTGTACAAATGTGACACGGCCCCATTAAGTTATCATTATAACTCAAAAAAGCATTTGCACTGCCAGTAAAGGTTTTACCCTGTGTTGAAACCGCTACCCAAACACAATATTTAATTTAATAAAAAGGGACATTTTGGTTTAACTGGGCCTAGGAACCCCGGAAAGGAAAAATTCCCAATAATGTAAATGTTACCTGGCCTTGGCAAAATTTCCTGGC
  3   1   2       chi Te2N      in                    IMAGE:7202317.3p                                                                                                                                                                                                                                                                                                                                             TCTGTGCGACTACCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTCAACTGAGCAGGGCTGACTTGTTCTGTCCGGCCTGTACCACTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGTACAAGGACAGTTGGCATCTCTGACAAAGGATTTGAGAAAAGCTTTTCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTCTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATATCTTAAGTGCTGTACAAATGTGACACGGCCCCATTAAGTTATCATTATACTCAAAAAAGCATTTGCACTGCCAGTAAGGTTTTACCTGTGTGAAAGCGCTACCAGACACAATATTAATTTATTAAAAGGACATTTGTTTACTGGGCTAGAACCAGAAAGAGAATTCTATATGTATGTACTGCTGCAATTCTGACAAAGATTTCTCATGCCTGATGAGGAAATACCAAATGCTTAGCTCTGTAAAATAGCAGTCATAGTATCGAGGAAAAGAAATGTCGTTT
  3   1   2       bld Ga15 5g3  in                       XL422n04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                    GNCCTGTACAACTCTGCAGCCACCCTGATGAGAGCAAGGACTTTTTCCCAGGTTCTGGATTGTGAAAAATCATTTAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGTACAAGGACAGTTGGCATCTCTGACAAAGGATTTGAGAAAAGCTTTTCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTCTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATATCTTAAGTGCTGTACAAATGTGACACGGCCCCATTAAGTTATCGTTATACTCAAAAAAGCATTTGCACTGCCAGTAAGGTTTTACCTGTGTGAAAGCGCTACCAGCCACAATATTAATTTATTAAAAGGACATTGTTTACTGGGCTAGAACCAGAAAGAGAATTCTATATGTATGTACTGCTGCAATTCTGACAAAGATTTCTCATGCCTGATGAGGAAATACCAAATGCTTAGCTCTGTATAATAGCAGTCATATGTA
  3   1   2       bld Te2N                            IMAGE:7203661.3p                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAGCCACCTGATGAGAGCAAGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTNAATGTCAACACTCGGGAACTGCAACGAAAATACCGTAATCTTCAACGTTTGCTTCATCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGTACAAGGACAGTTGGCATCTCTGACAAAGGATTTGAGAAAAGCTTTTCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTCTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATATCTTAAGTGCTGTACAAATGTGACACGGCCCCATTAAGTTATCATTATACTCAAAAAAGCATTTGCACTGCCAGTAAGGTTTTACCTGTGTGAAAGCGCTACCAGACACAATATTAATTTATTAAAAGGACATTTGTTTACTGGGCTAGAACCAGAAAGAGAATTCTATATGTATGTACTGCTGCAATTCTGACAAAGATTTCTCATGCCTGATGAGGAAATACCAAATGCTTAGCTCTGTAAAATAGCAGTCATATGATCGAGGAAAAGTAATGTACT
  3   1   2       bld Ga12 5g3  in                         XL167m09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCAACGTTTGCTTAATCCAGATTTCTTTAGCCAGAAGAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGTACAAGGACAGTTGGCATCTCTGACAAAGGATTTGAGAAAAGCTTTTCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTCTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATATCTTAAGTGCTGTACAAATGTGACACGGCCCCATTAAGTTATCATTATACTCAAAAAAGCATTTGCACTGCCAGTAAGGTTTTACCTGTGTGAAAGCGCTACCAGACACAATATTAATTTATTAAAAGGACATTTGTTTACTGGGCTAGAACCAGAAAGAGAATTCTATATGTATGTACTGCTGCAATTCTGACAAAGATTTCTCATGCCTGATGAGGAAATACCAAATGCTTAGCTCTGTAAAATAGCAGTCATATGTATCAGAGGAAAAAG
  3   1   2       bld Ga12                                 XL168m09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCAACGTTTGCTTAATCCAGATTTCTTTAGCCAGAAGAGAGAGTGAACGAANCATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGNTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGNTAAGGCTGACANTGANGAAGTTGGAGACTTNGTACAAGGNCAGTTGGCATCTNTGACAAAGGATTTGAGAAAAGCTTTTCAGCAAGGTGATCTCCAAGAAGCTNAAATACTTCTAGCAAAGANGANATTCTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATATCTTAAGTGCTGTACAAATGTGACACGGCCCCATTAAGTTATCATTATACTCAAAAAAGCATTTGCACTGCCAGTAAGGTTTTNCCTGTGTGAAAGCGCTACCAGACACAATANTAATNTATTAAAAGGACATTTGTTTACTGGGNTNGAACCAGAAAGAGAATTCTATANGTANGTACTGNTGCAATTCTGACAAAGATTTCTCATGCCTGATGAGGAAATACCAAATGCTTAGCTCTGNAAAATAGCAGTCATATGTATCTGAGGAAAAAG
  3   1   2       bld Ga12                                 XL169l10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCAACGTTTGCTTAATCCAGATTTCTTTAGCCAGAAGAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGTACAAGGACAGTTGGCATCTCTGACAAAGGATTTGAGAAAAGCTTTTCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTCTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATATCTTAAGTGCTGTACAAATGTGACACGGCCCCATTAAGTTATCATTATACTCAAAAAAGCATTTGCACTGCCAGTAAGGTTTTACCTGTGTGAAAGCGCTACCAGACACAATATTAATTTATTAAAAGGACATTTGTTTACTGGGCTAGAACCAGAAAGAGAATTCTATATGTATGTACTGCTGCAATTCTGACAAAGATTTCTCATGCCTGATGAGGAAATACCAAATGCTTAGCTCTGTAAAATAGCAGTCATATGTATC
  5   1   2       bld Ga18      out                     xlk127k08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCCAGATTTCTTTAGCCAGAAGTCAGAGAGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGACGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTCAATGAACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGTACAAGGACAGTTGGCATCTCTGACAAAGGATTTGAGAAAAGCTTTTCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTCTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATATCTTAAGTGCTGTACAAATGTGACACGGCCCCATTAAGTTATCATTATACTCAAAAAAGCATTTGCACTGCCAGTAAGGTTTTACCTGTGTGAAAGCGCTACCAGACACAATATTAATTTATTAAAAGGACATTTGTTTACTGGGCTAGAACCAGAAAGAGAATTCTATATGTATGTACTGCTGCAATTCTGACAAAGATTTCTCATGCCTGATGAGGAANTACCAAATGCTTAGCTCTGTAAAATAGCAGTCATATGTATCTGAGTNAAAAAGTAAAGTTGGTTTTATCAGTGGACTGCTCTTTTTTACATTATTTGAATTCTACTTCTTGTTTTNATATTTAAATCTGCCAGA
  5   1   1       add Tbd2                            IMAGE:3199404.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTGAACGAAACATATCAGAAAAGCAGTCAACAATGGTTAACAAAGCTTACAATACCCTTCTATCACCTTTAAAGCGAGGATTATATTTGGTAAATTTGATCTGTGTATATTTTTGTCCATAGTTAAGCACTTACCATATTACCACTACTTGTGACTATGTACCAATTAGTTTGATAGTATGTCTGTCCAAGAAATAATCCAAGCCCCTCTTCAAGGCATTAACAGAATCAGCCATCAAAACATCACCCGGCAGTGCATCCCACAACCTCACTGTGAAGAACCACCTATGTTGGTTCAATTGAAAGTTCTTTTCTTCTAGTTTGAAGGGGGGCCTCTGGCATGGGGATCCTCTTTATGGGTAAAAAGGTCCCTTGTTATTTGTCTATAATGTCCTGTAATATACTTGTAAAGTGTAATCATGTCCCCTTGCAAGCACCTTTTTTCCAGAAAAAACAACCCCAACCTTGATTATCTACCCTAATAATNTAATTCTTCCACCCCTAATCAGTTTGGT
  3   1   2       bld Egg6                            IMAGE:4434340.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAGCTAAATGATGCAGATGCTAAGGCTGACATTGAAGAAGTTGGAGACTTTGTACAAGGACAGTTGGCATCTCTGACAAAGGATTTGAGAAAAGCTTTTCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTCTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATATCTTAAGTGCTGTACAAATGTGACACGGCCCCATTAAGTTATCATTATACTCAAAAAAGCATTTGCACTGCCAGTAAGGTTTTACCTGTGTGAAAGCGCTACCAGACACAATATTAATTTATTAAAAGGACATTTGTTTACTGGGCTAGAACCAGAAAGAGAATTCTATATGTATGTACTGCTGCAATTCTGACAAAGATTTCTCATGCCTGATGAGGAAATACCAAATGCTTAGCTCTGTATAATAGCAGTCATAT
  3   1   2       bld Gas8                            IMAGE:3517292.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATATACAAGACCAAGTAAAGAAGAAAATAATATCTTAAGTGCTGTACAAATGTGACACGGCCCCATTAAGTTATCATTATACTCAAAAAAGCATTTGCACTGCCAGTAAGGTTTTACCTGTGTGAAAGCGCTACCAGACACAATATTAATTTATTAAAAGGACATTTGTTTACTGGGCTAGAACCAGAAAGAGAATTCTATATGTATGTACTGCTGCAATTCTGACAAAGATTTCTCATGCCTGATGAGGAAATACCAAATGCTTAGCTCTGTATAATAGCAGTCATATGTATCTGAGTGAAAAAGTAAAGTTGGTTTTATCAGTGGAAA
  3   1   2       bld Gas6                            IMAGE:3474314.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTAAGTGCTGTACAAATGTGACACGGCCCCATTAAGTTATCATTATACTCAAAAAAGCATTTGCACTGCCAGTAAGGTTTTACCTGTGTGAAAGCGCTACCAGCCACAATATTAATTTATTAAAAGGACATTGTTTACTGGGCTAGAACCAGAAAGAGAATTCTATATGTATGTACTGCTGCAATTCTGACAAAGATTTCTCATGCCTGATGAGGAAATACCAAATGCTTAGCTCTGTATAATAGCAGTCATATGTATCTGAGTGAAAAAGTAAAGTTGGTTTTAT
  5   1   2       bld Egg1                               PBX0098C03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAAAAAGCATTTGCACTGCCAGTAAGGTTTTACCTGTGTGAAAGCGCTACCAGCCACAATATTAATTTATTAAAAGGACATTGTTTACTGGGCTAGAACCAGAAAGAGAATTCTATATGTATGTACTGCTGCAATTCTGACAAAGATTTCTCATGCCTGATGAGGAAATACCAAATGCTTAGCTCTGTATAATAGCAGTCATATGTATCTGAGTGAAAAAGTAAAGTTGGTTTTATCAGTGGACTGCTCTTTTTTACATTATTTGAATTCTACTTCTTGTTTTAATATTTAAATCTGCCAGAATATGATTAATAAGAAACTCAGCAAATTGTTTTTATAACAGAGAAGTTAAGTTAAGCTTTTTCCCAAACCGATTTCCACCCCTTTGGTAGGTGGCTCATTATCATGTTACAATCAGCTAGTTAATTTATGCATGCAAATGTGCAATAGTAATGTTTTCCAATTAATACTTCACTGTGCATACATATGCTGGGGAAATAGTGATTTAATACTTGTTGGCACCACCCAGTGTATTGGTTTCTCCTTGTCTTTTACAAGGTGTATACTTTGATGTAACCTACTGTACCCAGCACCTACCATGACTAAGTAGTAAGAATAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)