Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xl340e04.5                           80 PI      94          1      434                (no blast hit)

 This cluster: approximate FL confidence score = 88%

 1012769734 Xl3.1-IMAGE:8076133.5 - 15 ESTs
                                                                       ..-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8076133.5                                                                                                                                                                                                                                                                                                     GGCAAGATGTGCGACTTTTCAGAAGATCAGATTATCGACTTCAAGGAGTCCTTCCAACTATTTGACCGTGTCGGCGATGGCAAAATCTACTACAGCCAGTGTGGGGACGTCATGCGGGCACTGGGGCAGAACCCCACTAATGCCGAGGTGATGAAGGTTTTGGGAAACCCAAAGTCTGAAGACCTGAACACAAAGACCCTTGAGTTTGAACAGTTCCTCCCCATGCTGCAAGCAATTGCCAAGAACAAGGATTTGCCTGGACTGGAAGAATTGCTCGAAGGGTTCAAAGTCTTTGACAAGGAAGGAAATGGCTTTGTTATGGGCTCTGAGATGCGTCATGTCCTTGTTTCTCTGGGAGAGAAGTTGTCAGAAGATGAAGTAGAGACCCTTTTAAGTGCTCATGAAGATGCAAATGGCTCCATTAATTATGAAGAGTTTGTCAGGCAGATCTTATCTTCGTGACTTCACTCCGTGGAACTTATCCGGACGGTGTTAAACGGCTGAAGTTTCTCCATAGTTCCTCTGCTCAGTGGGGATGAAGTGTGTGTGTGGGGGGGAATTAGTTAATTTACTCCAACCGTTCACTAGAGTGGAATACAGTCTATGTAGCAAGTGCCTTTTCTGCTTCCTCGTCATCCAAGCCCCTTCTTTGCTCAGAAGTGATGAATTCTC
                                                  Xl3.1-CHK-1012691779                                                                                                                                                                                                                                                                                                           ATGTGCGACTTTTCAGAAGATCAGATTATCGACTTCAAGGAGTCCTTCCAACTATTTGACCGTGTCGGCGATGGCAAAATCTACTACAGCCAGTGTGGGGACGTCATGCGGGCACTGGGGCAGAACCCCACTAATGCCGAGGTGATGAAGGTTTTGGGAAACCCAAAGTCTGAAGACCTGAACACAAAGACCCTTGAGTTTGAACAGTTCCTCCCCATGCTGCAAGCAATTGCCAAGAACAAGGATTTGCCTGGACTGGAAGAATTGCTCGAAGGGTTCAAAGTCTTTGACAAGGAAGGAAATGGCTTTGTTATGGGCTCTGAGATGCGTCATGTCCTTGTTTCTCTGGGAGAGAAGTTGTCAGAAGATGAAGTAGAGACCCTTTTAAGTGCTCATGAAGATGCAAATGGCTCCATTAATTATGAAGAGTTTGTCAGGCAGATCTTATCTTCGTGACTTCACTCCGTGGAACTTATCCGGACGGTGTTAAACGGCTGAAGTTTCTCCATAGTTCCTCTGCTCAGTGGGGATGAAGTGTGTGTGTGGGGGGGAATTAGTTAATTTACTCCAACCGTTCACTAGAGTGGAATACAGTCTATGTAGCAAGTGCCTTTTCTGCTTCCTCGTCATCCAAGCCCCTTCTTTGCTCAGAAGTGATGAATTCTCATTCTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                         10    12    11    12    11    12    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    12    13    12    13    12    13    12    13    12    13     6    13     6    12     6    12     6    12     7    13     7    13     7    12     7    11     7    11     6    11     5    11     4    11     5    10     4    10     4    10     4    10     4    10     5    10     5    10     4    10
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAACTTATCCGGACGGTGTTAAACGGCTGAAGTTTCTCCATAGTTCCTCTGCTCAGTGGGGATGAAGTGTGT
                                               BLH ATG       6     439                                                                                                                                                                                                                                                                                                     
  5   1   2       chi Thy                             IMAGE:8547395.5p GCCGAGGCAAGATGGTGAGGAAGGGCCGGGAGTTTCTGCTTAGGAATAGTCCAACGTGCGGCCTCCTAGTAGCTGATAAGACAGCAGTCTCTTATATATACATTATGTGAAGTCCGTGGGGTTGAATTAGTAATAACTGTAGGGCCGCACGTTGGTTGTGTCATTGTTAGTGAGGAGATTACGCAACGTTACAGGATTCCATTGACCTTGCGCTGTTACATTTAGCCCAATGCCGCTCTTATACGTGTAGCGGGCGGGGGAGGCTGTGTCTGTCTGATGCCTTGTCTTTCTCTTTCTACAGTGCGACTTTTCAGAAGATCAGATTATCGACTTCAAGGAGTCCTTCCAACTATTTGACCGTGTCGGCGATGGCAAAATCTACTACAGCCAGTGTGGGGACGTCATGCGGGCACTGGGGCAGAACCCCACTAATGCCGAGGTGATGAAGGTTTTGGGAAACCCAAAGTCTGAAGACCTGAACACAAAGACCCTTGAGTTTGAACAGTTCCTCCCCATGCTGCAAGCAATTGCCAAGAACAAGGATTTGCCTGGACTGGAAGAATTGCTCGAAGGGTTCAAAGTCTTTGACAAGGAAGGAAATGGCTTTGTTATGGGCTCTGAGATGCGTCATGTCCTTGTTTCTCTGGGAGAGAATTGTCAGAAGATGAAGTAGAGACCCTTTTTAGTGCTCATGAAGATGCAATGGCTCCATTATTATGAAGTGAGCAGTTGCAGGCGTTTGCTG
  5   1   2       chi Brn3                            IMAGE:8538380.5p                                                                                                                             AAAANNNNNCCTAggggtgggggggATCAAAGATTCGATTCGTCCCGGCTGTTTGCTCCTCTGTGGGCTTATGTTGAATCCCAGTTGGGTTGTGCAGCCCTGTGATTGAGCGGCCACTATTATATCACTAGGTGAGTTGCCATTGGGTGCTTTCTTTCCCAGCCATTCATACTCTAAAATGATTTCAATCATTTTTATGTGACAGACTTCAAGGAGTCCTTCCAACTATTTGACCGTGTCGGCGATGGCAAAATCTACTACAGCCAGTGTGGGGACGTCATGCGGGCACTGGGGCAGAACCCCACTAATGCCGAGGTGATGAAGGTTTTGGGAAACCCAAAGTCTGAAGACCTGAACACAAAGACCCTTGAGTTTGAACAGTTCCTCCCCATGCTGCAAGCAATTGCCAAGAACAAGGATTTGCCTGGACTGGAAGAATTGCTCGAAGGGTTCAAAGTCTTTGACAAGGAAGGAAATGGCTTTGTTATGGGCTCTGAGATGCGTCATGTCCTTGTTTCTCTGGGAGAGAAGTTGTCAGAAGATGAAGTAGAGACCCTTTTAAGTGCTCATGAAGATGCAAATGGCTCCATTAATTATGAAGAACTTATCCTGACGGTGTTAAACGGCTGAAGTTTCTCCATAGTTCCTCTGCTTCATGGGGATGAATTGTGCGTGGGGGGAATATAATAGAATAATTACTCGAACATATCCTACAATTGAATAAAGTTTTATTACACAAGATCTTTTG
  5   1   2       bld Eye1 5g                         IMAGE:6949597.5p                                                                                                                                                                                                                                                                                     ATTTTCCGGATGCCGAGGCAAGATGTGCGACTTTTCAGAAGATCAGATTATCGACTTCAAGGAGTCCTTCCAACTATTTGACCGTGTCGGCGATGGCAAAATCTACTACAGCCAGTGTGGGGACGTCATGCGGGCACTGGGGCAGAACCCCACTAATGCCGAGGTGATGAAGGTTTTGGGAAACCCAAAGTCTGAAGACCTGAACACAAAGACCCTTGAGTTTGAACAGTTCCTCCCCATGCTGCAAGCAATTGCCAAGAACAAGGATTTGCCTGGACTGGAAGAATTGCTCGAAGGGTTCAAAGTCTTTGACAAGGAAGGAAATGGCTTTGTTATGGGCTCTGAGATGCGTCATGTCCTTGTTTCTCTGGGAGAGAAGTTGTCAGAAGATGAAGTAGAGACCCTTTTAAGTGCTCATGAAGATGCAAATGGCTCCATTAATTATGAAGAACTTATCCGGACGGTGTTAAACGGCTGAAGTTTCTCCATAGTTCCTCTGCTCAGTGGGGATGAAGTGTGTGTGTGGGGGGGAATTAGTTAGCAATTTACTCCAACCGTTCACTAGAGTGGAAGACAGTCTATGTAGCAAGTGCCTTTTCTGCTTCCTCGTCATCCAAGCCCCTTCTTTGCTCAGAAGTGATGAATTCTCATTCTTTCTATGACACGGCAGGAGAGGCCGAGAGCTACAGATTAAACGATCATCAGAAGAAATTGTGGCTAAAGAAGTTTTTGTATTCCCCCCCATACTCCTTCCTTAAGGCAAAAGTGTGCAGAAGAAAGATAAATTATTTCCAAATTTTCCTATAATATccccccccTTTCCCAACCCTCAAAAATTAAAACGGGGGAGGTGGAAACTGTCCCTTCTATATTCTTTTCTTTTTTCCCCAAAAA
  5   1   2       bld Sp1  5x3                        IMAGE:5513095.5p                                                                                                                                                                                                                                                                                          GGAGAAGCCGAGGCAAGATGTGCGACTTTTCAGAAGATCAGATTATCGACTTCAAGGAGTCCTTCCAACTATTTGACCGTGTCGGCGATGGCAAAATCTACTACAGCCAGTGTGGGGACGTCATGCGGGCACTGGGGCAGAACCCCACTAATGCCGAGGTGATGAAGGTTTTGGGAAACCCAAAGTCTGAAGACCTGAACACAAAGACCCTTGAGTTTGAACAGTTCCTCCCCATGCTGCAAGCAATTGCCAAGAACAAGGATTTGCCTGGACTGGAAGAATTGCTCGAAGGGTTCAAAGTCTTTGACAAGGAAGGAAATGGCTTTGTTATGGGCTCTGAGATGCGTCATGTCCTTGTTTCTCTGGGAGAGAAGTTGTCAGAAGATGAAGTAGAGACCCTTTTAAGTGCTCATGAAGATGCAAATGGCTCCATTAATTATGAAGAGTTTGTCAGGCAGATCTTATCTTCGTGACTTCACTCCGTGGAACTTATCCGGACGGTGTTAAACGGCTGAAGTTTCTCCATAGTTCCTCTGCTCAGTGGGGATGAAGTGTGTATGTGGGGGGGAATTAGTTAATTTACTCCAACCGTTCACTAGAGTGGAATACAGTCTATGTAGCAAGTGCCTTTTCTGCTTCCTCGTCATCCAAGCCCCTTCTTTGCTCAGAAGTGATGAATTCTCATTCTTTCTATGACACGGCAGGAGAGGCCGAGAGCTACAGATTAACGATCATCAGAAGAAATGTGGCTAAAGAATTTTTGTATTCCCCCCATACTCTTCTTTATGCAGAGTGTCAGAGAAGATAATTATTCA
  5   1   2       bld FaBN 5x3                        IMAGE:8076133.5p                                                                                                                                                                                                                                                                                           GAGAAGCCGAGGCAAGATGTGCGACTTTTCAGAAGATCAGATTATCGACTTCAAGGAGTCCTTCCAACTATTTGACCGTGTCGGCGATGGCAAAATCTACTACAGCCAGTGTGGGGACGTCATGCGGGCACTGGGGCAGAACCCCACTAATGCCGAGGTGATGAAGGTTTTGGGAAACCCAAAGTCTGAAGACCTGAACACAAAGACCCTTGAGTTTGAACAGTTCCTCCCCATGCTGCAAGCAATTGCCAAGAACAAGGATTTGCCTGGACTGGAAGAATTGCTCGAAGGGTTCAAAGTCTTTGACAAGGAAGGAAATGGCTTTGTTATGGGCTCTGAGATGCGTCATGTCCTTGTTTCTCTGGGAGAGAAGTTGTCAGAAGATGAAGTAGAGACCCTTTTAAGTGCTCATGAAGATGCAAATGGCTCCATTAATTATGAAGAGTTTGTCAGGCAGATCTTATCTTCGTGACTTCACTCCGTGGAACTTATCCGGACGGTGTTAAACGGCTGAAGTTTCTCCATAGTTCCTCTGCTCAGTGGGGATGAAGTGTGTGTGTGGGGGGGATTAGTTAGCAATTTACTCCAACCGTTCACTAGAGTGGAATACAGTCTATGTAGCAAGTGCCTTTTCTGCTTCCTCGTCATCAAGCCCCTTCTTGCTCAGAGTGATGATTCTCATCTTTCTAGAACGGCAGAGAGCCGAGAGCTCGATTAACATCATCCAAAATGTGCTAAAATTTTGTATCCCCCCTACTCC
  5   1   2       bld FaB  5x3                        IMAGE:8069812.5p                                                                                                                                                                                                                                                                                           GAGAAGCCGAGGCAAGATGTGCGACTTTTCAGAAGATCAGATTATCGACTTCAAGGAGTCCTTCCAACTATTTGACCGTGTCGGCGATGGCAAAATCTACTACAGCCAGTGTGGGGACGTCATGCGGGCACTGGGGCAGAACCCCACTAATGCCGAGGTGATGAAGGTTTTGGGAAACCCAAAGTCTGAAGACCTGAACACAAAGACCCTTGAGTTTGAACAGTTCCTCCCCATGCTGCAAGCAATTGCCAAGAACAAGGATTTGCCTGGACTGGAAGAATTGCTCGAAGGGTTCAAAGTCTTTGACAAGGAAGGAAATGGCTTTGTTATGGGCTCTGAGATGCGTCATGTCCTTGTTTCTCTGGGAGAGAAGTTGTCAGAAGATGAAGTAGAGACCCTTTTAAGTGCTCATGAAGATGCAAATGGCTCCATTAATTATGAAGAGTTTGTCAGGCAGATCTTATCTTCGTGACTTCACTCCGTGGAACTTATCCGGACGGTGTTAAACGGCTGAAGTTTCTCCATAGTTCCTCTGCTCAGTGGGGATGAAGTGTGTGTGTGGGGGGGAATTAGTTAATTTACTCCAACCGTTCACTAGAGTGGAATACAGTCTATGTAGCAAGTGCCTTTTCTGCTTCCTCGTCATCCAAGCCCCTTCTTTGCTCAGAAGTGATGAATTCTCATATGACACGGCAAGAGAGGCCGAGAGCTAC
  5   1   2       bld FaBN 5g                         IMAGE:8076906.5p                                                                                                                                                                                                                                                                                           GAGAAGCCGAGGCAAGATGTGCGACTTTTCAGAAGATCAGATTATCGACTTCAAGGAGTCCTTCCAACTATTTGACCGTGTCGGCGATGGCAAAATCTACTACAGCCAGTGTGGGGACGTCATGCGGGCACTGGGGCAGAACCCCACTAATGCCGAGGTGATGAAGGTTTTGGGAAACCCAAAGTCTGAAGACCTGAACACAAAGACCCTTGAGTTTGAACAGTTCCTCCCCATGCTGCAAGCAATTGCCAAGAACAAGGATTTGCCTGGACTGGAAGAATTGCTCGAAGGGTTCAAAGTCTTTGACAAGGAAGGAAATGGCTTTGTTATGGGCTCTGAGATGCGTCATGTCCTTGTTTCTCTGGGAGAGAAGTTGTCAGAAGATGAAGTAGAGACCCTTTTAAGTGCTCATGAAGATGCAAATGGCTCCATTAATTATGAAGAACTTATCCGGACGGTGTTAAACGGCTGAAGTTTCTCCATAGTTCCTCTGCTCAGTGGGGATGAAGTGTGTGTGTGGGGGGGATTAGTTAGCAATTTACTCCAACCGTTCACTAGAGTGGAATACAGTCTATGTAGCAAGTGCCTTTTCTGCTTCCTCGTCATCCAAGCCCCTTCTTTGCTCAGAAGTGATGAATTCTCATTTCTTCTATGACACGGCAGGAGAGGCCGAGAGCTACAGATTAAACGATCATCAGAAGAAATTGTGGCTAAAGAGTTTTTGTATTccccccccATACTCTCCCTAATGCAAAATGTGCAGAGAAAATAA
  5   1   2       bld Egg1 5g                         IMAGE:3300824.5p                                                                                                                                                                                                                                                                                            GCACGAGGAGGCAAGATGTGCGACTTTTCAGAAGATCAGATTATCGACTTCAAGGAGTCCTTCCAACTATTTGACCGTGTCGGCGATGGCAAAATCTACTACAGCCAGTGTGGGGACGTCATGCGGGCACTGGGGCAGAACCCCACTAATGCCGAGGTGATGAAGGTTTTGGGAAACCCAAAGTCTGAAGACCTGAACACAAAGACCCTTGAGTTTGAACAGTTCCTCCCCATGCTGCAAGCAATTGCCAAGAACAAGGATTTGCCTGGACTGGAAGAATTGCTCGAAGGGTTCAAAGTCTTTGACAAGGAAGGAAATGGCTTTGTTATGGGCTCTGAGATGCGTCATGTCCTTGTTTCTCTGGGAGAGAAGTTGTCAGAAGATGAAGTAGAGACCCTTTTAAGTGCTCATGAAGATGCAAATGGCTCCATTAATTATGAAGAACTTATCCGGACGGTGTTAAACGGCTGAAGTTTCTCCATAGTTCCTCTGCTCAGTGGGGATGAAGTGTGTGTGTG
  5   1   2       bld Te2  5x3                        IMAGE:7211055.5p                                                                                                                                                                                                                                                                                              AAGCCGAGGCAAGATGTGCGACTTTTCAGAAGATCAGATTATCGACTTCAAGGAGTCCTTCCAACTATTTGACCGTGTCGGCGATGGCAAAATCTACTACAGCCAGTGTGGGGACGTCATGCGGGCACTGGGGCAGAACCCCACTAATGCCGAGGTGATGAAGGTTTTGGGAAACCCAAAGTCTGAAGACCTGAACACAAAGACCCTTGAGTTTGAACAGTTCCTCCCCATGCTGCAAGCAATTGCCAAGAACAAGGATTTGCCTGGACTGGAAGAATTGCTCGAAGGGTTCAAAGTCTTTGACAAGGAAGGAAATGGCTTTGTTATGGGCTCTGAGATGCGTCATGTCCTTGTTTCTCTGGGAGAGAAGTTGTCAGAAGATGAAGTAGAGACCCTTTTAAGTGCTCATGAAGATGCAAATGGCTCCATTAATTATGAAGAGTTTGTCAGGCAGATCTTATCTTCGTGACTTCACTCCGTGGAACTTATCCGGACGGTGTTAAACGGCTGAAGTTTCTCCATAGTTCCTCTGCTCAGTGGGGATGAAGTGTGTTGTGTGGGGGGGAATTAGTTAATTTACTCCNACCGTTCACTATAGTGGAATACAGTCTATGTAGCAAGTGCCTTTTCTGCTTCCTCGTCATCCAAGCCCCTTCTTTGCTCAGAAGTGATGAATTCTCATTCTTTCTATGACACGGCAGGAGAGGCCGAGAGCTACAGATTAAACGATCATCAAACAAATTGTGGGCAAAGAAATTTTTGTATTCCCCCCCATACTCTTCCTTTATGCGAAAGTGTGCAAAGaaaaaaaaaTTATTTCAATTTTTTAATTTTCCCCCTTTCTACCTAAATAAACAGGGAATGAAtttttttttttttttttttttaaaaaaaaaaaaaaaaaaa
  5   1   2       bld FaBN 5x3                        IMAGE:8077111.5p                                                                                                                                                                                                                                                                                                GCCGAGGCAAGATGTGCGACTTTTCAGAAGATCAGATTATCGACTTCAAGGAGTCCTTCCAACTATTTGACCGTGTCGGCGATGGCAAAATCTACTACAGCCAGTGTGGGGACGTCATGCGGGCACTGGGGCAGAACCCCACTAATGCCGAGGTGATGAAGGTTTTGGGAAACCCAAAGTCTGAAGACCTGAACACAAAGACCCTTGAGTTTGAACAGTTCCTCCCCATGCTGCAAGCAATTGCCAAGAACAAGGATTTGCCTGGACTGGAAGAATTGCTCGAAGGGTTCAAAGTCTTTGACAAGGAAGGAAATGGCTTTGTTATGGGCTCTGAGATGCGTCATGTCCTTGTTTCTCTGGGAGAGAAGTTGTCAGAAGATGAAGTAGAGACCCTTTTAAGTGCTCATGAAGATGCAAATGGCTCCATTAATTATGAAGAGTTTGTCAGGCAGATCTTATCTTCGTGACTTCACTCCGTGGAACTTATCCGGACGGTGTTAAACGGCTGAAGTTTCTCCATAGTTCCTCTGCTCAGTGGGGATGAAGTGTGTGTGTGGGGGGGAATTAGTTAATTTACTCCAACCGTTCACTAGAGTGGAATACAGTCTATGTAGNCAGTGCCTTTTCTGCTTCCTCGTCATCCAAGCCCCTTCTTTGCTCAGAAGTGATGAATCTCATATGACACGGCAGGAGAGCCGAGAGCTACAGATAAACATCATCAGAGAAATTGTGCTAAGAAATTTTGTATCCCCTCAACTCTC
  5   1   2       bld Te2N 5g                         IMAGE:7768132.5p                                                                                                                                                                                                                                                                                                 CCGAGGCAAGATGTGCGACTTTTCAGAAGATCAGATTATCGACTTCAAGGAGTCCTTCCAACTATTTGACCGTGTCGGCGATGGCAAAATCTACTACAGCCAGTGTGGGGACGTCATGCGGGCACTGGGGCAGAACCCCACTAATGCCGAGGTGATGAAGGTTTTGGGAAACCCAAAGTCTGAAGACCTGAACACAAAGACCCTTGAGTTTGAACAGTTCCTCCCCATGCTGCAAGCAATTGCCAAGAACAAGGATTTGCCTGGACTGGAAGAATTGCTCGAAGGGTTCAAAGTCTTTGACAAGGAAGGAAATGGCTTTGTTATGGGCTCTGAGATGCGTCATGTCCTTGTTTCTCTGGGAGAGAAGTTGTCAGAAAAAAGGG
  5   1   2      seed Te2  5x3                        IMAGE:7208306.5p                                                                                                                                                                                                                                                                                                  CGAGGCAAGATGTGCGACTTTTCAGAAGATCAGATTATCGACTTCAAGGAGTCCTTCCAACTATTTGACCGTGTCGGCGATGGCAAAATCTACTACAGCCAGTGTGGGGACGTCATGCGGGCACTGGGGCAGAACCCCACTAATGCCGAGGTGATGAAGGTTTTGGGAAACCCAAAGTCTGAAGACCTGAACACAAAGACCCTTGAGTTTGAACAGTTCCTCCCCATGCTGCAAGCAATTGCCAAGAACAAGGATTTGCCTGGACTGGAAGAATTGCTCGAAGGGTTCAAAGTCTTTGACAAGGAAGGAAATGGCTTTGTTATGGGCTCTGAGATGCGTCATGTCCTTGTTTCTCTGGGAGAGAAGTTGTCAGAAGATGAAGTAGAGACCCTTTTAAGTGCTCATGAAGATGCAAATGGCTCCATTAATTATGAAGAGTTTGTCAGGCAGATCTTATCTTCGTGACTTCACTCCGTGGAACTTATCCGGACGGTGTTAAACGGCTGAAGTTTCTCCATAGTTCCTCTGCTCAGTGGGGATGAAGTGTGTGTGTGGGGGGGAATTAGTTAGTGTGATCCTACCGATCCCTTGAGGGGATACAGGCGAAAGAGCAAGCGGCCCTGTCTGCATCCTCCGCCGCCAAGCCCATTCTTTGCTCGGAAGTAATGAAGTCTGATTCTTTCCATGACACGCACGGAA
  5   1   2       bld Neu7                                 XL005c20.5p                                                                                                                                                                                                                                                                                                                                    TTATCGACTTCAAGGAGTCCTTCCAACTATTTGACCGTGTCGGCGATGGCAAAATCTACTACAGCCAGTGTGGGGACGTCATGCGGGCACTGGGGCAGAACCCCACTAATGCCGAGGTGATGAAGGTTTTGGGAAACCCAAAGTCTGAAGACCTGAACACAAAGACCCTTGAGTTTGAACAGTTCCTCCCCATGCTGCAAGCAATTGCCAAGAACAAGGATTTGCCTGGACTGGAAGAATTGCTCGAAGGGTTCAAAGTCTTTGACAAGGAAGGAAATGGCTTTGTTATGGGCTCTGAGATGCGTCATGTCCTTGTTTCTCTGGGAGAGAAGTTGTCAGAAGATGAAGTAGAGACCCTTTTAAGTGCTCATGAAGATGCAAATGGCTCCATTAATTATGAAGAACTTATCCGGACGGTGTTAAACGGCTGAAGTTTCTCCATAGTTCCTCTGCTCAGTGGGGATGAAGTGTGTATGTGGGGGGGAATTA
  5   1   2       bld Brn3                            IMAGE:8536757.5p                                                                                                                                                                                                                                                                                                                                                                                                             GGACGTCATGCGGGCACTGGGGCAGAACCCCACTAATGCCGAGGTGATGAAGGTTTTGGGAAACCCAAAGTCTGAAGACCTGAACACAAAGACCCTTGAGTTTGAACAGTTCCTCCCCATGCTGCAAGCAATTGCCAAGAACAAGGATTTGCCTGGACTGGAAGAATTGCTCGAAGGGTTCAAAGTCTTTGACAAGGAAGGAAATGGCTTTGTTATGGGCTCTGAGATGCGTCATGTCCTTGTTTCTCTGGGAGAGAAGTTGTCAGAAGATGAAGTAGAGACCCTTTTAAGTGCTCATGAAGATGCAAATGGCTCCATTAATTATGAAGAACTTATCCGGACGGTGTTAAACGGCTGAAGTTTCTCCATAGTTCCTCTGCTCAGTGGGGATGAAGTGTGTGTGGGGGGAATTAGTTAGCAATTTACTCCAACCGTTCACTAGAGTGGAAGACAGTCTATGTACCAAGTGCCTTTTCTGCTTCCTCGTCATGCAAGCCCCTTTTTTGCTCAAAAGTGATGATTTCTCATTCTTTCTATGACACGGCATGAAAGGCTCGAACCTACACATTTAAATGACCTCATAAGAAATGGTGCCAATACAGTTTTGTATTCCCCTCTCCCCTTCCCTTCCTAATGCAAATTGTCTGAAATTACGATATAttactttttattttattcttttcatgcaattataaattatttctttttttcTGTAATATACAATTTACAACTTTTACAACACTGTTAGCTTTAATATCTTAATTTCTAGTTTTCTC
  5   1   0       chi Skin                            IMAGE:8643469.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCGGCCCACTGAATGAGCTCGTAAACTAATCTAGAGGTGCCAAGGGAGCAAATGCCAGTTTCTGCAGACTTGGAGATCTCAGCATCCCACAGGAAGCTCTTACTGGACTTCTGCCACCGCTCCCTGGCCTAAACTATATAGACTGTGACAAACAGCTCGGTGCACATCCCATCTGCTGCCACTGCCACATGTTTGACATGTTTGtttttttttATATTCTTTACAGAACTTATCCGGACGGTGTTAAACGGCTGAAGTTTCTCCATAGTTCCTCTGCTCAGTGGGGATGAAGTGTGTGTGTGGGGGGGAATTAGTTAATTTACTCCAACCGTTCACTAGAGTGGAATACAGTCTATGTAGCAAGTGCCTTTTCTGCTTCCTCGTCATCCAAGCCCCTTCTTTGCTCAGAAGTGATGAATTCTCATTCTTTCTATGACACGGCAGGAGAGGCCGAGAGCTACAGATTAAACGATCATCAGAAGAAATTGTGGCTAAAGAAGTTTTTGTATTCCCCCCCATACTCTTCCTTAATGCAGAAGTGTGCAGAGAAAGATAAATTATTTCAAATTTCTATATATCCCCCCTTCCAACCTCAAATAAACGGGAGTGAttttttttttttttttttcaaannnannaannnnnnnnnnnnnannnnnnaannnannannnannaaannanaannannnnanaanaaaaannnnannnnnnnnaaaaaaaaNA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)