Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:4032423.5                       4 PI      90        176      622                Death-associated protein-like 1-A

 This cluster: approximate FL confidence score = 82%

 1012769751 Xl3.1-IMAGE:7765254.3 - 28 ESTs
                                                                       ..0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7765254.3   TCACCAGGTACAAATGCTATGCTGGCTGTTCCCTGCACTGGGCAAGTCTGCAGATGTGACTTTGTGCTGATTCTATAAACCAAGAAAACAAAAGAGAAACCCTCCTACCCCCCTCCCTTTCCTGTATAAAAGCTGCACTGGGAGCAGAAGGTGGTAAACAAGTGTGAGAGCAGCAGAGACTGATTATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACTGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGAAAAAATTTGTTATGTGCTTTTTTTCAAT
                                                  Xl3.1-CHK-1012688282         GGTACAAATGCTATGCTGGCTGTTCCCTGCACTGGGCAAGTCTGCAGATGTGACTTTGTGCTGATTCTATAAACCAAGAAAACAAAAGAGAAACCCTCCTACCCCCCTCCCTTTCCTGTATAAAAGCTGCACTGGGAGCAGAAGGTGGTAAACAAGTGTGAGAGCAGCAGAGACTGATTATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACTGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGAAAxxATTTGTTATGTGCTTTTT
                                                      consensus depths        2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     4     5     6     7    12    14    19    19    21    22    22    22    25    25    26    27    26    27    27    27    27    27    27    27    27    27    26    27    27    27    26    27    27    27    27    27    27    27    27    27    27    27    27    27    26    27    27    27    26    27    25    25    25    25    26    26    25    26    26    26    26    26    25    26    26    26    25    25    23    23    19    20    19    20    18    19     8    11     2     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                               ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------GC
                                               BLH ATG     185     201   
                                               BLH MIN     185      29   
                                               BLH MPR     185      29   
                                               BLH OVR     185      57   
                                               CDS MIN     185      38   
                                               EST CLI     188      38   
                                               ORF LNG     185       1   
                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 3e-009     XP_001179737.1 PREDICTED: similar to death-associated protein [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================
                                                                                                                                                                                                                                                                           PROTEIN --- Gg ---- 4e-011     NP_001026174.1 death-associated protein [Gallus gallus] ================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                     PROTEIN --- Dr ---- 1e-017     NP_571648.1 death associated protein 1b [Danio rerio] ========================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                        PREDICTED = Mm ==== 2e-021     NP_083999.1 hypothetical protein LOC76747 [Mus musculus] =====================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                  PREDICTED = Hs ==== 4e-022     NP_001017920.1 hypothetical protein LOC92196 [Homo sapiens] ========================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                  PREDICTED = Cf ==== 2e-023     XP_849683.1 PREDICTED: similar to death associated protein 1b [Canis familiaris] ===================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                  PROTEIN === Bt ==== 5e-025     NP_001020517.1 early epithelial differentiation-associated protein [Bos taurus] ====================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 3e-056     Q28CI6.1 Death-associated protein-like 1 [Xenopus tropicalis]  =====================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 3e-059     A3KMU5.1 Death-associated protein-like 1-B [Xenopus laevis]  =======================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7765254.3                                                        ATGTGA---------------------------------------------------------------------------------------------------------TGA------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------ATG------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------TAG---------------------------TAA------TAA---------------------------------TGATAA------------TGA
                                                                   ORF                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                              ]
  3   1   2      seed Te2N 5g3  in                    IMAGE:7765254.3p TGTCACCAGGTACAAATGCTATGCTGGCTGTTCCCTGCACTGGGCAAGTCTGCAGATGTGACTTTGTGCTGATTCTATAAACCAAGAAAACAAAAGAGAAACCCTCCTACCCCCCTCCCTTTCCTGTATAAAAGCTGCACTGGGAGCAGAAGGTGGTAAACAAGTGTGAGAGCAGCAGAGACTGATTATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACTGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld Te2N 5g3  in                    IMAGE:7765254.5p   TCACCAGGTACAAATGCTATGCTGGCTGTTCCCTGCACTGGGCAAGTCTGCAGATGTGACTTTGTGCTGATTCTATAAACCAAGAAAACAAAAGAGAAACCCTCCTACCCCCCTCCCTTTCCTGTATAAAAGCTGCACTGGGAGCAGAAGGTGGTAAACAAGTGTGAGAGCAGCAGAGACTGATTATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACTGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGaaaaaaaaaaaaaaaaaaaaaaaGGG
  5  -1   2       bld Egg4                   IMAGE:3743824-IMAGp.IMAGp                                                                                                                              TGTAATTTTGATAACAAAGAAAAATAGTaaaaaaaaaaaaaCTTGACGCCTATGCGGCGGAATTCCCTAAAGAGCTGAAAGTGCAGAGTTTTCCCCAAACCCTAAAGGCTGGTCATTTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCCCCTGAGAAAAAAGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTTTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGGTAGAGAAGCTCAACCATGACTTTTCTGGAGAAGCAGCACAGATTGCGCCCCAAAAACCCAGACCTACCGTTGAGAAGATCATTATGCCAAAAAGGCTTTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTTTGGTGTCATGTACATAAGTAAAATAAAGGTCACTTCCTGAATCTGTTTTGTTCCCCTTTTGATAAAGCCCTTTGCCTTGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaCTCCGGGCCTAGGCGGCCGCG
  5   1   2       bld Tad2 5x3                        IMAGE:6932201.5p                                                                                                                                                           GGTAAACAAGTGTGAGAGCAGCAGAGACTGATTATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCCCCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACCGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCCTGAATCTGGTTTTGTACCACTTTTTGATAAAGCACTTTTGCATTGCCAAAN
  5   1   2       bld Ova1 5x3                          Ova1-nuc_04.5p                                                                                                                                                            GAAAACAAGTGTGAGAGCAGCAGAGACTGATTATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCNTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACNTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACCGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGaaaaaaaaaaaaaaaa
  5   1   2       bld Gas7 5x3                        IMAGE:4083941.5p                                                                                                                                                                    CCCGGGGAGCAGCAGAGACTGATTATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACCGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTC
  5   1   2       bld Tad1 5x3                        IMAGE:6877898.5p                                                                                                                                                                           GGGAGCAGAGACTGATTATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCCCCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACCGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCNCnnnnnanaannnnannnnnnnnnnnnnnAACATGTC
  5   1   2       bld Bla1 5x3               IMAGE:3381563-IMAGp.IMAGp                                                                                                                                                                               TTTGGAATTTTATTGGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACTGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGaaaaaaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL451e23ex.5p                                                                                                                                                                                CAGAGACTGATTATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACTGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGAAAGCaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL470m06ex.5p                                                                                                                                                                                CAGAGACTGATTATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACCGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL451e23ex.3p                                                                                                                                                                                CAGAGACTGATTATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACTGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTG
  5   1   2       bld Egg1 5x3                        IMAGE:3301197.5p                                                                                                                                                                                    GCACGAGGATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACCGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGAAAGCATTTGTTATGTGCTTTTTTTCAATGTT
  5   1   2       bld DMZ  5g3  in                         xl228n14.5p                                                                                                                                                                                      CTGATTATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACCGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGAANAAAAAAA
  3   1   2       bld DMZ  5g3  in                         xl228n14.3p                                                                                                                                                                                      CTGATTATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACCGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCT
  3   1   2       bld Bla1 5g3  in                    IMAGE:3381563.3p                                                                                                                                                                                           TATGACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGACAAACTCATAGAAAACCTTGCAGGAAAAACCCAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACTGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGAAAAAAA
  5   1   2       bld Ooc1                              xlnoc001n06.5p                                                                                                                                                                                               ACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACTGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACT
  5   1   2       bld Ov1                             IMAGE:8332062.5p                                                                                                                                                                                               ACTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACCGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGAAAGCATTTGTTATGTGCTTTTTTTCAATGTTTGTACTACTATTATGAATTTATGATTTGATGTAATGAACACAATCCTCTattattaataatccttcataatattataaaatattttatacttaatttaataaAGGGGCGGCCGCTTTAAATATCCCCTCGAGGGGGCCCAACTTATCCTTACCCCGTTTTTTTGTAAAAAGGGTCCCCAAAAGTGAATCTATTATAAACTAGGGCCTGCCCCTTCTTTTTCACC
  5   1   2       bld Ooc1      in                      xlnoc003a01.5p                                                                                                                                                                                                CTAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACTGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGAAAAAA
  5   1   2       bld Ooc1      in                      xlnoc003m11.5p                                                                                                                                                                                                 TAAAGAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACTGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTG
  5   1   2       bld Bla1 5g3  in                    IMAGE:3381563.5p                                                                                                                                                                                                     GAGCTGAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACTGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGAAAAAA
  3   1   2       bld Ga12      in                         XL149i01.3p                                                                                                                                                                                                          GAAAGTGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGNAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGAC
  5   1   2       bld Egg1                            IMAGE:3301228.5p                                                                                                                                                                                                               GGCAAAGTTTTCCCCAAGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCT
  3   1   2       bld Ooc1 5x3  out                     xlnoc001n16.3p                                                                                                                                                                                                                               AGCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGCGAAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACTGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGAAA
  3   1   2       bld Ooc1      in                      xlnoc003a01.3p                                                                                                                                                                                                                                GCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACTGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAAAATGTTTTGTACCACTTTTGATAAAGCACTTTGCATATGAAA
  3   1   2       bld Ooc1      in                      xlnoc003m11.3p                                                                                                                                                                                                                                GCCCTAAAGGCTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACTGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGAAA
  3   1   2       bld Ga15 5g3  in                       XL470m06ex.3p                                                                                                                                                                                                                                         CTGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGGTTTCCAAAAAGCAAGGTAACGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCAAAAGCCCAGACCTACCGTTGAGAAGATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAAT
  3   1   2       bld Ga12                                 XL148i01.3p                                                                                                                                                                                                                                           TGGTCATCTCCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAGCAAGGTAGCGATGAAAACAGTGCACCTGAGAAAAATGCAAAGAAAACCTTGCAGGAGAAACCAAGNTCTGTTCTTAACATGACGAAGATGCAAGCAATGAATATATTGGCTGGTGAGCTAGAGAAGCTCAGCCATGACTTTCCTGGAGAAGCAGCACAGATTGCGCACCNAAAGCCCAGACCTACCGTTGAGAAGATCATTANGCCAAAAAGGCTCNACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGNACTCTGGTGTCATGNACNTAAGTAAAA
  5   1   2       bld Ga12      in                         XL149i01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCATTATGCCAAAAAGGCTCTACCTTATTCAACAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAATAATGGTCACTTCCTGAATCTGTTTTGTACCACTTTTGATAAAGCACTTTGCATTGAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)