Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk138m18ex.5                        25 END     15         53       60                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xlk130f03ex.5                         6 PI      93          1      684                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012769806 Xl3.1-IMAGE:6634743-IMAGp.5 - 28 ESTs
                                                                       -40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:6634743-IMAGp.5                                         TGTATAGACTGGAGGCCACTCTGCTTCTAGGACAGGACTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTTCAGCGCTACTACTGAACAATACGACTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGCAATAACACCATCTGTGACCTGGACTTTAGCGGTGTTTCAAGTAAGGAGAATGAAAATTTCTGGATCGGGGGGCTAAGCATACTTACCACAGTTCCGGGTTTCCTGCTGCCCCTGCTCCTTATGACCATCTTTTACTGCTTCATCGGTGGCAAAGTGACCATGCATTTCCAAAACCTAAAGAAGGAGGAACAGAAGAAAAAGAGGCTTCTTAAGATCATTATTACACTGGTTGTGGTGTTTGCTATCTGCTGGCTGCCTTTCCATATTCTGAAAACCATTCACTTTCTAGACCTCATGGGCTTCCTGGAACTTTCTTGCTCTGCACAGAACATCATTGTCAGCCTGCACCCCTATGCCACCTGCTTGGCATACGTTAATAGCTGCTTAAACCCTTTCCTTTATGCCTTCTTTGACTTGCGATTCCGCTCTCAATG
                                                  Xl3.1-CHK-1012688306                                               GACTGGAGGCCACTCTGCTTCTAGGACAGGACTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTTCAGCGCTACTACTGAACAATACGACTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGCAATAACACCATCTGTGACCTGGACTTTAGCGGTGTTTCAAGTAAGGAGAATGAAAATTTCTGGATCGGGGGGCTAAGCATACTTACCACAGTTCCGGGTTTCCTGCTGCCCCTGCTCCTTATGACCATCTTTTACTGCTTCATCGGTGGCAAAGTGACCATGCATTTCCAAAACCTAAAGAAGGAGGAACAGAAGAAAAAGAGGCTTCTTAAGATCATTATTACACTGGTTGTGGTGTTTGCTATCTGCTGGCTGCCTTTCCATATTCTGAAAACCATTCACTTTCTAGACCTCATGGGCTTCCTGGAACTTTCTTGCTCTGCACAGAACATCATTGTCAGCCTGCACCCCTATGCCACCTGCTTGGCATACGTTAATAGCTGCTTAAACCCTTTCCTTTATGCCTTCTTTGACTTGCGATTCCGCTCTCAATGTTTTTT
                                                      consensus depths                                              2     6     4    13     7    15     8    16    10    19    11    21    11    21    14    21    17    21    17    21    18    21    18    21    18    21    18    22    19    22    19    22    19    22    20    22    19    22    21    22    23    24    23    24    23    24    23    24    23    25    23    25    23    25    23    25    23    25    23    25    22    25    20    24    22    24    22    24    22    24    22    24    22    24    22    24    21    24    21    24    21    24    21    24    19    24    19    24    19    23    19    23    17    23    19    23    18    21    18    21    16    20    17    21    11    17    11    16    12    15    10    13     8    13     8    13     9    13     7    12     5    10     5    10     5    10     6     9     6     9     6     9     6     8     6     8     6     8     6     8     5     6     4     6     4     6     4     6     4     6     5     7     5     7     4     6     4     6     4     6     3     4     2     3     2     3     2     3     2     3     2     3     2     3
                                                                   SNP                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                         ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                     ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------A--
                                               BLH ATG      67     464                                         
                                               BLH MIN      37     137                                         
                                               BLH OVR      67      90                                         
                                               EST CLI       1      37                                         
                                               ORF LNG      67       5                                         
  5   1   2       bld Neu7 5g3  out                        XL033n17.5p AAGAACTTGAGTGGAGGCAGCTTTCATATCTCATAGCATCACTGTATAGACTGGAGGCCACTCTGCTTCTAGGACAGGACTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTTCAGCGCTACTACTGAACAATACGACTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGCAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCTCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAANGCAATAACACCATCTGTGACCT
  5   1   2       bld Em10 5g                         IMAGE:8318555.5p     CAAGGTTTTTCCGGGTTCCGGAATTCCCGGGATCACTGTATAGACTGGAGGCCACTCTGCTTTCTAGGACAGGACTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTTCAGCGCTACTACTGAACAATACGAGTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTTCGCTCCCGCTCCTCCATCCTT
  5   1   2       bld Em10 5x                         IMAGE:8321402.5p         AGGGGGAGCTAATAAAAAAGTTTTCGAGCCCGGAATTCCCGGGGAATCTCTTGCTTCTAGGAAAGGACTTTCTTTTTGCTTCCACACAGCCTTCAAAATGGAATAAAAAGGCTTCCTTCGCTACTACTGAACAATACGAGTACTATGATTACGCAAAATGAGACTGGTCTTCAACCATGTGATGAAACATATTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAAGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCACACACCTACATAGGTAATTAGTACAGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCTCTGGTCTTT
  5   1   2       chi Kid                             IMAGE:7012564.5p          TGGAGGCAGCTTTCATATCTCATAGCATCACTGTATAGACTGGAGGCCACGCTGCTTCTAGGACAGGACTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTTCAGCGCTACTACTGAACAATACGACTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCGAAAGCTTCACTCCCGCGCGTGGAGTCATGGAGCCTAGAGTGAGAGATGAGTAATAGAGGAGTAGAGGGGTGAGAGATGGATGGAgggggggatgggggaaaggtaagggaggagtaggaaggaggaAAAAGAAATAAAGGGAAAGAGGTAATAGTAGAAT
  5   1   2       bld Thy  5g3  out                   IMAGE:8550351.5p                                    GAGGAGCATCGAATGTAATCGTCCCCTGCTTCTAGGACAGGACTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTTCAGCGCTACTACTGAACAATACGACTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGCAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATACTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGCAATAACACCATCTGTGACCTGGACTTTAGCGGTGTTTCAAGTAAGGAGAATGAAATTTCTGGATCGGGGGGCTAGCATACTTACACAGTTCCGGTTTCTGCTGCCCTGCTCCTATGACATCTTTATGCTTCTCGTGCAAGTGACATGCTTTCAAACTAAGAAGAGACAGAGAAAGAGCTCTAGATATATACCTGTGTGTGTGCTACGCGCTGCTCAATCGAACATCCTCAACC
  5   1   2       add Ga18      out                      xlk66f13ex.5p                                       ATCACTGTATAGACTGGAGNNCACTCTGCTTCTAGGACAGGACTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTTCNNNNTACTACTGAACAATACGACTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGNNTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGCAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCNNNNNNTCACTGGCCTTTTGNNTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATACTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGNACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGNAATAACACCATCTGTGANCTGGACTTTAGCGGTGTTTCAAGTAAGGAGAATGAAAATTTCTGGATCGGGGGNNTAAGNATANTNACCACAGTTCCGGNNNCCTGCTGCCCCTNCTCCTTATGACCATCTTTTACTGCTTCATCGGNNNA
  5   1   2       bld Sp1  5g3  out                   IMAGE:4965654.5p                                          ACGCGTCCGGGAGGTTACTCTGCTTCGAGGACAGGACTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTTCAGCGCTACTACTGAACAATACGAGTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCTGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGTCTG
  5   1   2      seed Emb1 5g                IMAGE:6634743-IMAGp.IMAGp                                          CCCCGCGGTCCGGGCCACTCTGCTTCTAGGACAGGACTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTTCAGCGCTACTACTGAACAATACGACTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGCAATAACACCATCTGTGACCTGGACTTTAGCGGTGTTTCAAGTAAGGAGAATGAAAATTTCTGGATCGGGGGGCTAAGCATACTTACCACAGTTCCGGGTTTCCTGCTGCCCCTG
  5   1   2       bld Ga18      out                     xlk135k10ex.5p                                          TGTATAGACTGGAGGNCACTCTGCTTCTAGGACAGGACTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTNCNNNNTACTACTGAACAATACGACTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGCAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCTCTAGGCTTTCACTGGCCTTTTGNTCTNCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGNNACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGNAATAACACCATCTGTGANCTGGACTTCAGCGGTGTTTCAAGNAAGGAGAATGAAAATTTCTGGATCGGGGGGCTAANNATACTTACCACAGTTCCGGGNTTCCTGCTGCCCCTGNTC
  5   1   2       bld Ga18 5g                           xlk135d11ex.5p                                             ATAGACTGGAGGNCACTCTGCTTCTAGGACAGGACTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTNNNNNCTACTACTGAACAATACGAGTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGNNTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGNCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTANCGCTACCTCTGTGGGCCACATACACTGCCCTAGGNTTTCACTGGCCTTTTGNNTCTNCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGNCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGNCTGATTCTACGTGACACACGTGTAGAAGGCAATAACACCATCTGTGACCTGNACTTTAGCGGNGTTTCA
  5   1   2       bld Tbd1 5g                              AW871859.5p                                              AGACTGGAGGCCACTCTGCTTCTAGGACAGGACTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTTCAGCGCTACTACTGAACAATACGACTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTNTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCCTGGCTGTTATCTGGCTCTTCTCAGGGCTTGTTGCCACTCCCA
  5   1   2       bld Sp1  5g                         IMAGE:4965275.5p                                                 CTGGAGGCCACTCTGCTTCTAGGACAGGACTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTTCAGCGCTACTACTGAACAATACGACTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGCAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATACTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGCAATAACACCATCTGTGACCTGGACTTTAGCGGTGTTTCAAGTAAGGAGAATGAAAATTTCTGGATCGGGNGGCTAAGCATACTTACCACAGTTCCGGGTTTCCTGCTGCCCTGCTCCTATGACATCTTTACTGCTCATCGTGGCAAGTGACATGCATTTCAAACCTAAGAAGGAGAACGAAAA
  5   1   2       bld Ga18 5x                            xlk61o02ex.5p                                                 ACTGGAGGNCACTCTGCTTCTAGGACAGGACTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTTNNNNNTACTACTGAACAATACGAGTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGANTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGNNNTCACTGGCCTTNNNNNNTNNACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGNACTCCCAAGNCTGANTCTACGTGACACACGTGTAGAAGGNAATAACACCATCTGTGANCTGGACTTTAGCGGNGNTTCAAGNAAGGAGAATGAAAATTTCTGGNTCGGGGGNTAAGNATACTTACCACAGTTCCGGGTTCCTGCTNCCCCTGNTCCNTNTGNCNTCTTTACT
  5   1   2       bld Emb1 5g                         IMAGE:6634743.5p                                                        CCACTCTGCTTCTAGGACAGGACTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTTCAGCGCTACTACTGAACAATACGACTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAAGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGCAATAACACCATCTGTGACCTGNACTTTAGCGGTGTTTCAAGTAAGGAGAATGAAAATTTCTGGATCGGGGGGGCTAAGCATACTTACCACAGTTCCGGGGTTTCCTGCTGCCCCTGGCTCCTTATGACCATCTTTTTACTGGCTTCATCGGGTGGGCAAAAGGGGACCCATGCATTTTTCccaaaaccctaaaggaaagggaagggaaccagaaagaaaaaaagaaaGGCTCTTCNTTTAANGAATCACTTTATATTAACACTTGGGGCTTGGTTGGGTGGGTTTTGGCTGTAATCGTGGCTTGGGGCTGGCCNCCTTTTTCCCAATAATTTCCTGGaaaaaaaaCCACATTTT
  5   1   2       bld Ga12 5g3  out                        XL206d14.5p                                                          ACTCTGCTTCTANGACAGGACTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTTCANCGCTACTACTGAACAATACNACTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCANGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACNCGTGTAGAAGGCAATAACACCATCTGTGACCTGGACTTTAGCGGTGTTT
  5   1   2       bld Neu7 5g3  out                        XL025b17.5p                                                                            GGACTTTCTATTGCTTCCCACAGCCTTCAAAAATGGAATCAGAAGGCTTCAGCGCTACTACTGAACAATACGACTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGCAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCTCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGCAATAACACCATCTGTGACCTGGACTTCAGCGGTGTTTCAAGTAAGGAGAATGAAAATTTCTGGATCGGGGGGCTAAGCATACTTACCACAGTTCCGGGT
  5   1   2       bld Tbd7 5g3  out                        XL102f13.5p                                                                              CTTTCTATTGCTTCCACACAGCCTTCAAAAATGGAATCAGAAGGCTTCAGCGCTACTACTGAACAATACGAGTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGG
  5   1   2       bld Neu7 5g                              XL001n05.5p                                                                                    TGCTTCCACACAGCCTTCAAAAATGGNAATCAGNAAGGCTTCAGCGCTACTACTGAACAATACGACTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGCAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATACTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGCAATAACACCATCTGTGA
  5   1   2       bld Neu7 5g3  out                        XL047e10.5p                                                                                    TGCTTCCACACAGCCTTCAAAAATGGNAATCAGNAAGGCTTCAGCGCTACTACTGAACAATACGACTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGCAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATACTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGCAATAACACCATCTGTGA
  5   1   2       bld Tbd7 5g                              XL060g13.5p                                                                                          CCACACAGCCTTCAAAAATGGAATCAGNAAGGCTTCAGCGCTACTACTGAACAATACGAGTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGCAATAACACCATCTGNGACCTGGACTTTAGCGGNGTTTNAAGTAAGGAGAATGAAA
  5   1   2       bld Ga12 5g3  out                        XL144l24.5p                                                                                              CACAGCCTTCAAAAATGGAATCAGAAGGCTTCAGCGCTACTACTGAACAATACGACTACTATGATTACGCAAATGAGACTGGACTTCAACCATGTGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTAAGGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGCAATAACACCATCTGTGAC
  5   1   2       bld Tbd7      out                        XL064h24.5p                                                                                                                                                                                                    ACGAGGGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGCAATAACACCATCTGTGACCTGGACTTTAGCGGTGTTTCAAGTAAGGAGAATGAAAATTTCTGGATCGGGGGGCTAAGCATACTTACCACAGTTCCGGGTTTCCTGCTGCCCCTGCTCCTTATGACCATCTTTTACTGCTTCATCGGTGGCAAAGTGACCATGCATTTCCAAAACCTAAAGAAGGAGGAACAGAAGAAAAAGAGGCTTCTTAAGATCATTATTACACTGGTT
  5   1   2       bld DMZ       out                        xl243d10.5p                                                                                                                                                                                                                                                                                    GTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGCAATAACACCATCTGTGACCTGGACTTTAGCGGTGTTTCAAGTAAGGAGAATGAAAATTTCTGGATCGGGGGGCTAAGCATACTTACCACAGTTCCGGGTTTCCTGCTGCCCCTGCTCCTTATGACCATCTTTTACTGCTTCATCGGTGGCAAAGTGACCATGCATTTCCAAAACCTAAAGAAGGAGGAACAGAAGAAAAAGAGGCTTCTTAAGATCATTATTACACTGGTTGTGGTGTTTGCTATCTGCTGGCTGCCTTTCCATATTCTGAAAACCATTCACTTTCTAGACCTCATGGGCTTCCTGGAACTTTCTTGCTCTGCACAGAACATCATTGTCAGCC
  5   1   2       bld DMZ       out                        xl327k24.5p                                                                                                                                                                                                                                                                                    GTCATCTTTACAGTATGGAAGGCCAAGCCAAAGAGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGCAATAACACCATCTGTGACCTGGACTTTAGCGGTGTTTCAAGTAAGGAGAATGAAAATTTCTGGATCGGGGGGCTAAGCATACTTACCACAGTTCCGGGTTTCCTGCTGCCCCTGCTCCTTATGACCATCTTTTACTGCTTCATCGGTGGCAAAGTGACCATGCATTTCCAAAACCTAAAGAAGGAGGAACAGAAGAAAAAGAGGCTTCTTAAGATCATTATTACACTGGTTGTGGTGTTTGCTATCTGCTGGCTGCCTTTCCATATTCTGAAAACCATTCACTTTCTAGACCTCATGGGCTTCCTGGAACTTTCTTGCTCTGCACAGAACATCATTGTCAGCCTGCACCCCTATGCCAC
  3  -1   2       bld Bla2                            IMAGE:7296447.3p                                                                                                                                                                                                                                                                                                                               CAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACGCTACCTCTGTGGGCCACATACACTGCCCTAGGCTTTCACTGGCCTTTTGGCTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAATATGTTCGCCAGTGTTTTTTGCCTGACCTGCCTCAGCTTTGATCGGTACCTGGCCATTGTTCATTCACTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCCTTGTATCCTTGGCTGTTATCTGGCTCTTCTCAGGGCTTTTGGCACTCCCAAGTCTGATTCTACGTGACACACGTGTAGAAGGCAATAACACCATCTGTGACCTGGACTTTAGCGGTGTTTCAAGTAAGGAGAATGAAAATTTCTGGATCGGGGGGCTAAGCATACTTACCACAGTTCCGGGTTTCCTGCTGCCCCTGCTCCTTATGACCATCTTTTACTGCTTCATCGGTGGCAAAGTGACCATGCATTTCCAAAACCTAAAGAAGGAGGAACAGAAGAAAAAGAGGCTTCTTAAGATCATTATTACACTGGTTGTGGTGTTTGCATCTGCTGGCTGCTTTCCTATTCTGAAACCATCATTTCTAACCTCAGGCTTCTGGACTTCTGCTCTGCCAGACTCATGTCACTGCACCTAGCACTGCTGCTACTATACTGCTACCTTTCTAGCTCTGATGCATCCCCAGTTTTTTTGATAGATCCAGCCCCACTCTCTATGCACACATCCTACAGTGAGATTGTGATTAT
  5   1   2       bld Tbd7      out                        XL104j02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCAATAACACCATACTGTGACCTGGNACTTTAGCGGTGTTTCAAGTAAGGAGAATGAAAATTTCTGGATCGGGGGGCTAAGCATACTTACCACAGTTCCGGGTTTCCTGCTGCCCCTGCTCCTTATGACCATCTTTTACTGCTTCATCGGTGGCAAAGTGACCATGCATTTCCAAAACCTAAAGAAGGAGGAACAGAAGAAAAAGAGGCTTCTTAAGATCATTATTACACTGGTTGTGGTGTTTGCTATCTGCTGGCTGCCTTTCCATATTCTGAAAACCATTCACTTTCTAGACCTCATGGGCTTCCTGGAACTTTCTTGCTCTGCACAGAACATCATTGTCAGCCTGCACCCCTATGCCACCTGCTTGGCATACGTTAATAGCTGCTTAAACCCTTTCCTTTATGCCTTCTTTGACTTGCGATTCCGCTCTCAATGtttttttttttNGGAT
  5   1   2       bld Tbd7      out                        XL094f06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATGACCTCTTTTACTGCTTATCGGTGGCAAAGTGACCATGCATTTCCAAAACCTAAAGAAGGAGGAACAGAAGAAAAAGAGGCTTCTTAAGATCATTATTACACTGGTTGTGGTGTTTGCTATCTGCTGGCTGCCTTTCCATATTCTGAAAACCATTCACTTTCTAGACCTCATGGGCTTCCTGGAACTTTCTTGCTCTGCACAGAACATCATTGTCAGCCTGCACCCCTATGCCACCTGCTTGGCATACGTTAATAGCTGCTTAAACCCTTTCCTTTATGCCTTCTTTGACTTGCGATTCCGCTCTCAATGttttttttttttNGGATTAAAAAAAGNC
  5   1   0       chi Ga18                               xlk77f15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCTAGACCTCATGGGCTTCCTGGAACTTTCTTGCTCTACACAAAACATCATTGTCAGCCTGCACCCCTATGCCACCTGCTTGGNTACGTTAATAGCTGCTTAAACCCTTTCCTCTATGCCTTCTTTGACTTGCGATTTCNNTCCCAATGtttttttttttttGGTTTCAAAAAAGTCCTCCAAGGACACCTCAGCAACACATCTTCCAGTTTAAGTGCACAGACTCAAAAATCTGAAATTCACTCTCTAGCCACAAAGGTATAATTGAGTAAAGGGACATTTGATGGGGTGTGGGGACAGAGACTTTGTTCTAAAGAATTTTTGGGTTAATTGAATGTTATCTCTTGTTACTGCAAAGGGAAGGTCATCTGCTGATTACAGAACAGGGACTTGCACAGTCTACTGGATCGTATCACTGTCTGTAAAATGCCCCCACTTAGTGGACATCTGGCTTTTCCTGAGTAACAGACAAACCTTAGTGAATAAGACAATCTTGCTCAGTCCCTCTCCAGAAAACAGGAGAGCTGGNTGGACAGGGTGGGAGAAACTGTTTACTGAATTTTGTTATTGATGCAAGAGGGAACTTGGTATGACATGGGTTAACATATGCTGTATATTGCTGGGTTTCTTCTTTGTATTTGCTAAGGATTTTTGCTTTCCTGTAAATATTTTGCTTGTTAAAGCACTTGTATAATTTCACAAAGCTTACACTTTTAACACATTGTTTAAAGNNAATTTTGGGAANG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)