Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6639364.5                      11 END     5          19       45                (no blast hit)
     2   2.0    0Xl3.1-xlk57m12ex.3                         10 END     1           3       10                (no blast hit)
     3   1.0    0Xl3.1-IMAGE:8321061.5                       7 END     1           3       14                glycosyltransferase-like 1B [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4   0.0    0Xl3.1-XL474m02ex.5                          7 PI      90        833     1314                glycosyltransferase-like 1B [Xenopus laevis]
     5   0.0    0Xl3.1-IMAGE:7296148.3                       2 PI      89        188      830                glycosyltransferase-like 1B [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012769850 Xl3.1-IMAGE:6636578.5 - 26 ESTs
                                                                       .....-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6636578.5                                                                                                          CAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGTGAACTGGCCGATCTCAAGGTCATTCACTGGAATTCCCCCCACAAACTCCGAGTCAAGAACAAACACGTTGAACTTTTCCGCACCCTGTACCTCACTTTCCTAGAGTACGACGGGAGCCTCCTGCGCCGGGAGCTGATTGGCTGCCCGAGTGAAGGGGAACAGCAGGGGGGCAGCCAGGCTACTTTGTCTCAGTTGGATGAGGAAGATCCATGCTATGATTTCCGACGGGAGAGTGTTGCGTCCCACCGCGTCCACCTGTCCTTCCTCCCGCATCTGACTCCTCCCCCAGACCCCTACGATGTCACACTGGTTGCACAGCTCTCTATGGACCGGCTGCAGATGTTGGAGTTGATTTGTCGGCACTGGGAAGGCCCAATGAGCCTGGCCTTGTATCTGTCAGACGCAGAAGCCCAGCAGTTCCTACGTTATGCCCAAGCCTCGGAGGTGCTTCAGTCTCGCACCAACATTGGGTACCATGTGGTATATAAGGAGGGGCAGCTGTACCCCGTTAACCTCCTGCGCAACGTGGCCCTAAAGAACTCGCACACCCCCTATGTCTTTCTGTCCGATATCGATTTCCTGCCTATGTACGGCCTCTACGAGTATCTAAGGAAATCCATAGCACAACAGGACCCCGCTGGCTCCCCCCGGGCTCTTATAGTTCCTGCGTTTGAGACTCTCCGTTATCGTCTTTCTTTCCCCAAGGCCAAGGCTGATCTGCTCTCCATGCTGGATACAGGGGCTCTCTACACCTTCAGATACCACGTGTGGGAGAAAGGCCACGCCCCCACTGATTATGCAAAGTGGAGGACTGCAACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTCTCTTTATTTATAATTATTTATGTTGTTTATTTATAATAAATTAAAAACTTAATTCAGATGAAATTAAAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAAAATA
                                                  Xl3.1-CHK-1012688626                                                                                                                TCCGACCACACGCGCTCCGAGCAGTGTTACAGTGAACTGGCCGATCTCAAGGTCATTCACTGGAATTCCCCCCACAAACTCCGAGTCAAGAACAAACACGTTGAACTTTTCCGCACCCTGTACCTCACTTTCCTAGAGTACGACGGGAGCCTCCTGCGCCGGGAGCTGATTGGCTGCCCGAGTGAAGGGGAACAGCAGGGGGGCAGCCAGGCTACTTTGTCTCAGTTGGATGAGGAAGATCCATGCTATGATTTCCGACGGGAGAGTGTTGCGTCCCACCGCGTCCACCTGTCCTTCCTCCCGCATCTGACTCCTCCCCCAGACCCCTACGATGTCACACTGGTTGCACAGCTCTCTATGGACCGGCTGCAGATGTTGGAGTTGATTTGTCGGCACTGGGAAGGCCCAATGAGCCTGGCCTTGTATCTGTCAGACGCAGAAGCCCAGCAGTTCCTACGTTATGCCCAAGCCTCGGAGGTGCTTCAGTCTCGCACCAACATTGGGTACCATGTGGTATATAAGGAGGGGCAGCTGTACCCCGTTAACCTCCTGCGCAACGTGGCCCTAAAGAACTCGCACACCCCCTATGTCTTTCTGTCCGATATCGATTTCCTGCCTATGTACGGCCTCTACGAGTATCTAAGGAAATCCATAGCACAACAGGACCCCGCTGGCTCCCCCCGGGCTCTTATAGTTCCTGCGTTTGAGACTCTCCGTTATCGTCTTTCTTTCCCCAAGGCCAAGGCTGATCTGCTCTCCATGCTGGATACAGGGGCTCTCTACACCTTCAGATACCACGTGTGGGAGAAAGGCCACGCCCCCACTGATTATGCAAAGTGGAGGACTGCAACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTCTCTTTATTTATAATTATTTATGTTGxTxATTxAxAxxAAATTAAAAACTxAxxxxAGATGAAATTAAAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAAAATATATATT
                                                      consensus depths                                                                                                               2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     6     6     5     6     5     6     5     6     5     6     5     6     7     8     7     8     7     8     7     8     7     8     7     7     7     7     7     7     7     7     7     7     7     7     8     9     8     9     7     8     8     9     8     9    10    12    11    13    11    13    11    13    13    14    13    14    12    15    14    16    16    18    18    19    18    19    18    20    18    20    19    21    19    21    20    21    19    21    20    21    20    21    20    21    19    21    20    21    19    22    18    20    21    21    19    20    18    20    19    19    17    19    18    19    19    20    20    20    19    20    19    20    17    20    17    20    17    20    18    20    18    20    17    19    16    19    16    18    16    18    16    18    16    18    16    18     9    17     9    17     9    17     8    16     8    16     8    16     8    16     7    15     6    15     5    14     5    14     5    13     4    13     4    12     4    11     4     8     4     7
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGCCAGTTTCGTGTGCGGACAAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAATTCAGATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATTTATGTTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GACAGGGCAGGATTCCTGATTCTA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------A
  5   1   2       add Emb9                            IMAGE:7977470.5p CTGATGAATATGCTGAGCACTTCGCTGGCTGACCAGGATATATTTAATGCAGTTATCAAGAGTTCCCCTACTCTGGTGTATCAGCTGCCCTGTTACTGGAACGTGCAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGTGAACTGGCCGATCTCAAGGTCATTCACTGGAATTCCCCCCACAAACTCCGAGTCAAGAACAAACACGTTGAACTTTTCCGCACCCTGTACCTCACTTTCCTAGAGTACGACGGGAGCCTCCTGCGCCGGGAGCTGATTGGCTGCCCGAGTGAAGGGGAACAGCAGGGGGGCAGCCAGGCTACTTTGTCTCAGTTGGATGAGGAAGATCCATGCTATGATTTCCGACGGGAGAGTGTTGCGTCCCACCGCGTCCACCTGTCCTTCCTCCCGCATCTGACTCCTCCCCCAGACCCCTACGATGTCACACTGGTTGCACAGCTCTCTATGGACCGGCTGCAGATGTTGGAGTTGATTTGTCGGCACTGGGAAGGCCCAATGAGCCTGGCCTTGTATCTGTCAGACGCAGAAGCCCAGCAGTTCCTACGTTATGCCCAAGCCTCGGAGGTGCTTTCAGTCTCGCACCAACATTGGGTACATGTGGTATATAAGGGAGGGGCAGCTGTACCCCGTTAACCCTCCTGCGCAACGTGGCCCTTAAGAACTCGCACACCCCCCTATGTCTTTCTGTCCGATAAAGATTTCCTGCCCTAGTACCGGCCCTCAACCAATTATCT
  5   1   2       bld Em10                            IMAGE:8317617.5p                                                                                                          CAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGTGAACTGGCCGATCTCAAGGTCATTCACTGGAATTCCCCCCACAAACTCCGAGTCAAGAACAAACACGTTGAACTTTTCCGCACCCTGTACCTCACTTTCCTAGAGTACGACGGGAGCCTCCTGCGCCGGGAGCTGATTGGCTGCCCGAGTGAAGGGGAACAGCAGGGGGGCAGCCAGGCTACTTTGTCTCAGTTGGATGAGGAAGATCCATGCTATGATTTCCGACGGGAGAGTGTTGCGTCCCACCGCGTCCACTTGTCCTTCCTCCCGCATCTGACTCCTCCCCCAGACCCCTACGATGTCACACTGGTTGCACAGCTCTCTATGGACCGGCTGCAGATGTTGGAGTTGATTTGTCGGCACTGGGAAGGCCCAATGAGCCTGGCCTTGTATCTGTCAGACGCAGAAGCCCAGCAGTTCCTACGTTATGCCCAAGCCTCGGAGGTGCTTCAGTCTCGCACCAACATTGGGTACCATGTGGTATATAAGGAGGGGCAGCTGTACCCCGTTAACCTCCTGCGCAACGTGGCCCTAAAGAACTCGCACACCCCCTATGTCTTTCTGTCCGATATAGATTTCCTGCCTATGTACGGCCTCTACGAGTATCTAAGGAAATCCATAGCACAACAGGACCCTGCTGGCTCCCCCCGGGCTCTTATAGTTCCTGCGTTTGAGACTCTCGTTATCGTCTTTCTTTCCCCAGTCA
  5   1   2       bld DMZ       in                         xl336a22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCAGATGTTGGAGTTGATTTGTCGGCACTGGGAAGGCCCAATGAGCCTGGCCTTGTATCTGTCAGACGCAGAAGCCCAGCAGTTCCTACGTTATGCCCAAGCCTCGGAGGTGCTTCAGTCTCGCACCAACATTGGGTACCATGTGGTATATAAGGAGGGGCAGCTGTACCCCGTTAACCTCCTGCGCAACGTGGCCCTAAAGAACTCGCACACCCCCTATGTCTTTCTGTCCGATATCGATTTCCTGCCTATGTACGGCCTCTACGAGTATCTAAGGAAATCCATAGCACAACAGGACCCCGCTGGCTCCCCCCGGGCTCTTATAGTTCCTGCGTTTGAGACTCTCCGTTATCGTCTTTCTTTCCCCAAGGCCAAGGCTGATCTGCTCTCCATGCTGGATACAGGGGCTCTCTACACCTTCAGATACCACGTGTGGGAGAAAGGCCACGCCCCCACTGATTATGCAAAGTGGAGGACTGCAACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCG
  5   1   2       bld DMZ       in                         xl230f05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCAGATGTTGGAGTTGATTTGTCGGCACTGGGAAGGCCCAATGAGCCTGGCCTTGTATCTGTCAGACGCAGAAGCCCAGCAGTTCCTACGTTATGCCCAAGCCTCGGAGGTGCTTCAGTCTCGCACCAACATTGGGTACCATGTGGTATATAAGGAGGGGCAGCTGTACCCCGTTAACCTCCTGCGCAACGTGGCCCTAAAGAACTCGCACACCCCCTATGTCTTTCTGTCCGATATCGATTTCCTGCCTATGTACGGCCTCTACGAGTATCTAAGGAAATCCATAGCACAACAGGACCCCGCTGGCTCCCCCCGGGCTCTTATAGTTCCTGCGTTTGAGACTCTCCGTTATCGTCTTTCTTTCCCCAAGGCCAAGGCTGATCTGCTCTCCATGCTGGATACAGGGGCTCTCTACACCTTCAGATACCACGTGTGGGAGAAAGGCCACGCCCCCACTGATTATGCAAAGTGGAGGACTGCAACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGA
  5   1   2       bld DMZ       in                         xl271i15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCAGATGTTGGAGTTGATTTGTCGGCACTGGGAAGGCCCAATGAGCCTGGCCTTGTATCTGTCAGACGCAGAAGCCCAGCAGTTCCTACGTTATGCCCAAGCCTCGGAGGTGCTTCAGTCTCGCACCAACATTGGGTACCATGTGGTATATAAGGAGGGGCAGCTGTACCCCGTTAACCTCCTGCGCAACGTGGCCCTAAAGAACTCGCACACCCCCTATGTCTTTCTGTCCGATATCGATTTCCTGCCTATGTACGGCCTCTACGAGTATCTAAGGAAATCCATAGCACAACAGGACCCCGCTGGCTCCCCCCGGGCTCTTATAGTTCCTGCGTTTGAGACTCTCCGTTATCGTCTTTCTTTCCCCAAGGCCAAGGCTGATCTGCTCTCCATGCTGGATACAGGGGCTCTCTACACCTTCAGATACCACGTGTGGGAGAAAGGCCACGCCCCCACTGATTATGCAAAGTGGAGGACTGCAACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAAATTACCGCCTGTGCGTCCAGGCCCNT
  5   1   2       bld DMZ       in                         xl337a22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCAGATGTTGGAGTTGATTTGTCGGCACTGGGAAGGCCCAATGAGCCTGGCCTTGTATCTGTCAGACGCAGAAGCCCAGCAGTTCCTACGTTATGCCCAAGCCTCGGAGGTGCTTCAGTCTCGCACCAACATTGGGTACCATGTGGTATATAAGGAGGGGCAGCTGTACCCCGTTAACCTCCTGCGCAACGTGGCCCTAAAGAACTCGCACACCCCCTATGTCTTTCTGTCCGATATCGATTTCCTGCCTATGTACGGCCTCTACGAGTATCTAAGGAAATCCATAGCACAACAGGACCCCGCTGGCTCCCCCCGGGCTCTTATAGTTCCTGCGTTTGAGACTCTCCGTTATCGTCTTTCTTTCCCCAAGGCCAAGGCTGATCTGCTCTCCATGCTGGATACAGGGGCTCTCTACACCTTCAGATACCACGTGTGGGAGAAAGGCCACGCCCCCACTGATTATGCAAAGTGGAGGACTGCAACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGAC
  5   1   2       bld Emb1                   IMAGE:6636578-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACCCCCTATGTCTTTCTGTCCGATATAGATTTCCTGCCTATGTACGGCCTCTACGAGTATCTAAGGAAATCCATAGCACAACAGGACCCTGCTGGCTCCCCCCGGGCTCTTATAGTTCCTGCGTTTGAGACTCTCCGTTATCGTCTTTCTTTCCCCAAGTCCAAGGCTGATCTGCTCTCCATGCTGGATACAGGGGCTCTCTACACCTTCAGATACCACGTGTGGGAGAAAGGCCACGCCCCCACTGATTATGCAAAGTGGAGGACTGCAACCACCCCGTACCGGGTTGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACAT
  5   1   2       bld Emb1                            IMAGE:6636578.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCCCCTATGTCTTTCTGTCCGATATAGATTTCCTGCCTATGTACGGCCTCTACGAGTATCTAAGGAAATCCATAGCACAACAGGACCCTGCTGGCTCCCCCCGGGCTCTTATAGTTCCTGCGTTTGAGACTCTCCGTTATCGTCTTTCTTTCCCCAAGTCCAAGGCTGATCTGCTCTCCATGCTGGATACAGGGGCTCTCTACACCTTCAGATACCACGTGTGGGAGAAAGGCCACGCCCCCACTGATTATGCAAAGTGGAGGACTGCAACCACCCCGTACCGGGTTGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTANACATACCTGCCTTATCATGAACCTTCATTAGAGGAGGTGCCTGGCCCTTTAATAGGAACACGCCAGTTTCGTGTGCGGACAAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGGCATCGCGATCACGGGACGGAGACCGTCTCTCCTGGCGCATTTCAACCTCTCTCCTTATTAANAATC
  5   1   2       bld Ga15      in                       XL468p05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCTCCGTTATCGTCTTTCTTTCCCCAAGGCCAAGGCTGATCTGCTCTCCATGCTGGATACAGGGGCTCTCTACACCTTCAGATACCACGTGTGGGAGAAAGGCCACGCCCCCACTGATTATGCAAAGTGGAGGACTGCAACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTCTCTTTATTTATAATTATTTATGTTGATAATTCANATGAAATTAAAAACTGACAGGGCAGGaaaaaaaaa
  3   1   2       bld Ga15      in                       XL468p05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TNTCCGTTATNGTCTTTNTTTCCCCAAGGCCAAGGNTGATNTGCTCTCCATGNTGGATACAGGGGCTCTNTACACCTTCAGATACCACGTGTGGGAGAAAGGCCACGCCCCCACTGATTATGCAAAGTGGAGGACTGCAACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTCTCTTTATTTATAATTATTTATGT
  3   1   2       chi Ga18      out                      xlk79l19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAANNCCAAGGNNNATCTNNTNTCATGCTGGANNNNAGGGCTCTCTNNNCTCAGNNNCACGTNTGGNAGAAAGCNNCGCCCCCNCTGATTATGCAAAGTGGNGGNCTGAANNCACNNNNCGGGTGGAGTGGNNGCCAGNCTTCGAGCCATACGTGGTGGTGAGNNGGGACTGCCCNGAGTATGNCCANNGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGANCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGNCCACATNCCTCACGCNNNCAGCTTCGACATCTCCNAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGANTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAANNCTCACGGCTGAGCGGANCCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTNCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCNTGGCCCTTTAATAGGAACACGCCAGTTTCGTGTGCGGACAAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGNNNNNCTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTCTTTATTTATAATTATTTATGTTGATAATTCAGATGAAATTAAAAACTGACAGGGCAGGNTTCCTGNTTCTATTTNTAAAAAATATA
  3   1   2      seed DMZ       in                         xl230f05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGATACAGGGGCTCTCTACACCTTCAGATACCACGTGTGGGAGAAAGGCCACGCCCCCACTGATTATGCAAAGTGGAGGACTGCAACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTCTCTTTATTTATAATTATTTATGTTGATAATTCAGATGAAATTAAAAACTGACAGGGCAGGATTCCTGATTCTATTTTAAAAAATA
  3   1   2       bld DMZ       in                         xl336a22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGATACAGGGGCTCTCTACACCTTCAGATACCACGTGTGGGAGAAAGGCCACGCCCCCACTGATTATGCAAAGTGGAGGACTGCAACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTCTCTTTATTTATAATTATTTATGTTGATAATTCAGATGAAATTAAAAACTGACAGGGCAGGATTCCTGATTCTATTTTAAAAAATA
  3   1   2       bld Em10 5g3  out                   IMAGE:7980554.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTCTACACCCTTCAGATACCACGTGTGGAAGAAAGGCCACGCCCCCCACTGATTATGCAAAGTGGAGGACTGCAACCACCCTGTACCGGGTTGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAATACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACACGCCAGTTTCGTGTGCGGACAAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTCTTTATTTATAATTATTTATGTTGATAATTCAGATGAAATTAAAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAAAATATATATTCGTTCTTTGCAATAAAATGCGCT
  3   1   2       bld DMZ       in                         xl337a22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCAGATACCACGTGTGGGAGAAAGGCCACGCCCCCACTGATTATGCAAAGTGGAGGACTGCAACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTC
  3   1   2       bld DMZ       out                        xl238m06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACTGATTATGCAAAGTGGAGGACTGAAACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACACGCCAGTTTCGTGTGCGGACAAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTCTTTATTTATAATTATTTATGTTGATAATTCAGATGAAATTAAAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAAAATATATATTCAAGTT
  5  -1   2       bld Bla2      out                   IMAGE:7297367.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGTGTGAAAGGGCTGTGTATGACAAATCGACGACGAATACTGTAGATAAATTAGAAGCACATGCTAGTGAGGAGAAGGCAAGATTATCCGTAAGACTTGGTAAGATCGGATAGGTGTGAGGAGCTTCAAGTGGGAACCAGGGGAAGTAATGAGTGTTTCCGGGAATGGCTTCATCGGACACATGCCTTACGATTCCAGCTTCTACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCATGTGCGTCCAGGCCCTTAAGGAAGAGTTTCAGCAAGACTTGTGCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTCTTTATTTATAATTATTTATGTTGATAATTCAGATGAAATTAAAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAAAATATATATTCAAGTTTCTTTTTGCAATAAAATGCAGAAAGATTTTCTaaaaaataaaaaaaaaaaaaaaCTCGAGGGGGGCGCGTACCCAATCGCCCATAATC
  3   1   2       bld Tbd7                                 XL084j19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTCTCTTTATTTATAATTATTTATGTTGATAATTCAGATGAAATTAAAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAAAATATATATTCAAGTTTCNNTTTGCAATAAAATG
  5   1   2       bld Egg1                               PBX0132B10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGTGGAGTGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACGAG
  3   1   2       bld DMZ       in                         xl271i15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGGCGCCAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTCTCTTTATTTATAATTATTTATGTTGATAATTCAGATGAAATTAAAAACTGACCAGGGCAGGATTCCTGATTCTA
  5   1   2       bld Lu1                             IMAGE:4632760.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGACTTCGAGCCATACGTGGTGGTGAGACGGGACTGCCCCGAGTATGACCAGCGCTTCCTTGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATCGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAAT
  3   1   2       bld Tbd2 5g3  out                   IMAGE:3199821.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGGTAAGACGGCACTGCCCCAAGTATGACCAGCGCTTCCTTGGCTTTGGTTGAACCAAAGTGTCGCACATCATGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATTGTCCACATGCCTCACGCTCCCAGCTTAGACATCTCCAAGTTCCGGTCCAGCGAAATATACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTCCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACACGCCAGTTTCGTGTGCGGACAAACGAGCAATCGGCTGCAGTTCCATGGCCAATGGGGACGCGACTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTCTTTATTTATAATTATTTATGTTGATAATTCAGATGAAATTAAAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAAAATATATATTCAAGAATCAATTTGCAATAAAATGCTGCAAAATTTTCAGTAAAAAAAAAAAAA
  5  -1   2       bld Emb9                            IMAGE:7975849.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAGCGTTTCCTTGGTTTTGGCTGAACAAAAGTGTCGCACATCAGGGAGCTGGACGCCCAGGAATATGAACTGGTGGTTCTCCCCAACGCCTTCATTGTCCACATGCCTCACGCTCCCAGCTTCGACATCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTGGTGCAAAGACTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACACGCCAGTTTCGTGTGCGGACAAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTCTTTATTTATAATTATTTATGTTGATAATTCAGATGAAATTAAAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAAAATATATATTCGTTTCTTTTTGCAATAAAATGCTGCAAAATTGTCaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Tbd7      out                        XL098c22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACATGCCTCACGCTCNCAGCTTCGACATCTNCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGNAAGAGTTTCACCAAGACTTGTCCCGGCGCTACGGATCTGCCGCCCTAAAATACCTCACGGCTGAGCGGAACCGATGAAGCTTTTTTGGCAAAGANTCTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGTGCCTCTGCTCTTAAACATACCTGCCTTATCATGAACCTTCATTACAGGAGGTGCCTGGCCCTTTAATAGGAACACGCCAGTTTCGTGTGCGGACAAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAATCGCGATCACTGGACGGAGACCGTCTCTCCTGGCGCATTTCAATCTCTCTCTTTATTTATAATTATTTATGTTGATAATTCAGATCAAATTAAAAACTGACAGGGCAGGATTCC
  3   1   2       bld DMZ       out                        xl231f05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTCCAAGTTCCGGTCCAGCGAAAATTACCGCCTGTGNGTCCAGGCCCTTAAGGAAGAGTTTCNNCAAGACTTGTNCNGGNGTTACGGATCTGCCGCCCTAAAATACCTCNCGGCTGAGCGGAACCGATGAAGCTTTNTGGTGCAAAGTCTCTGCCATGAAACACTACAGGGGTNTAAGGACAATGGACTNTTC
  3   1   2       bld Tbd7                                 XL075j03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTNCCGGCGCTACGGATNTGCCGCCCTAAAATACCTCACGGCTGANCGGAACCGATNAAGCTTTTTGGTGCAAANACTNTGCCATGAAACACTACAGGGGTTTAAGGACAATGGACTCTTCCTGNGCCTNTGCTNTTAAACANACCTGCCTTATCATGAACCTTCATTACAGGAGGNGCCTGGCCCTTTAATAGGAACACGCCAGTTTNGTGTGCGGACAAACGAGCAATCGGCTCCAGTTCCATGGCCAACGGGGACGCGACTGCAATCGCGATCNCTGGAANAGACCGTCTCTCCTGGNGCATTTCAATCTCTCTCTTTATTTANAATTATTTATGTTGATAATTCAGATTAAATTAAAAACTGACAGGGCAGGATTCCNGATTCTATTTTTAAAAAANA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)