Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL191i17.5.5                         37 PI      73        477     1542                Aldehyde dehydrogenase 1 family, member A2 [Xenopus tropicalis]
     2   0.0    0Xl3.1-IMAGE:4031401-IMAGp.5.5              10 PI      95          1     1231                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6881174.3                       3 PI      86       1453     1644                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012769907 Xl3.1-IMAGE:4033392-IMAGp.5 - 22 ESTs
                                                                       -50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4033392-IMAGp.5                                                   CCACCTGTCTAAAGGGTAAAGAGACTTCAAACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCATTAGCAACTTGGAAATAAAATACACAAAGATTTTTATAAACAATGAATGGCACAATTCTGTAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATGGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAGCCAGCTGAACAAACTCCACTGACTGCTATCTACATGGGGTCTTTAATAAAGGAGGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCCGGAGCAGCTATATCTTATCATATGGATATAGACAAAGTGGCTTTCACTGGTTCAACAGAGGTTGGAAAGCTGGTAAAAGAAGCAGCAGGAAAGAGCAACCTTAAAAGAGTCACACTTGAACTTGGTGGAAAAAGCCCTAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAGCATGCACACAATGGCCTGTTCTATCATCAGGGCCAGTGTTGCATAGCAGGATCCAGGATCTTTGTTGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTACTTGGAGATCCTCTTACTCCTGGTGTATGCCAAGGACCACAGATTGACAAAGAACAATACAACAAAATCCTTGAATTGATTGAGAGTGGAAAGAAAGAAGGCGCAAAGTTGGAATGTGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATTAGCCCCACAGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAAACAATTGACGAAGTTATTAAGAGGGCAAACAATACCAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGATATGGACAAAGCAATATTAATGTCTACAGCTCTTCAGGCTGGAACTGTTTGGATAAATTGCTACAGTGCCATGTCTCCACAAAGCCCTTTCGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGCGAATATGGCCTGCATGAATACACTGAAGTCAAGACGGTTATCATGAACATTTCACAGAAGAATTCCTAAAGATGTCACGTCACCAATATCCTGAATGCCTGGAGGATCGTGGAAACACTGCCATATTTGTGTGCATAAATCTCATGATAACAACAGCTGCAAATATTTGTGG
                                                  Xl3.1-CHK-1012689439                                                         GTCTAAAGGGTAAAGAGACTTCAAACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCATTAGCAACTTGGAAATAAAATACACAAAGATTTTTATAAACAATGAATGGCACAATTCTGTAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATGGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAGCCAGCTGAACAAACTCCACTGACTGCTATCTACATGGGGTCTTTAATAAAGGAGGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCCGGAGCAGCTATATCTTATCATATGGATATAGACAAAGTGGCTTTCACTGGTTCAACAGAGGTTGGAAAGCTGGTAAAAGAAGCAGCAGGAAAGAGCAACCTTAAAAGAGTCACACTTGAACTTGGTGGAAAAAGCCCTAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAGCATGCACACAATGGCCTGTTCTATCATCAGGGCCAGTGTTGCATAGCAGGATCCAGGATCTTTGTTGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTACTTGGAGATCCTCTTACTCCTGGTGTATGCCAAGGACCACAGATTGACAAAGAACAATACAACAAAATCCTTGAATTGATTGAGAGTGGAAAGAAAGAAGGCGCAAAGTTGGAATGTGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATTAGCCCCACAGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAAACAATTGACGAAGTTATTAAGAGGGCAAACAATACCAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGATATGGACAAAGCAATATTAATGTCTACAGCTCTTCAGGCTGGAACTGTTTGGATAAATTGCTACAGTGCCATGTCTCCACAAAGCCCTTTCGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGCGAATATGGCCTGCATGAATACACTGAAGTCAAGACGGTTATCATGAACATTTCACAGAAGAATTCCTAAAGATGTCACGTCACCAATATCCTGAATGCCTGGAGGATCGTGGAAACACTGCCATATTTGTGTGCATAAATCTCATGATAACAACAGCTGCAAATATTTGTGGTGCTGG
                                                      consensus depths                                                        2     5     7     8    12    14    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    13    14    15    15    14    14    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    16    16    15    15    16    16    16    16    16    16    16    16    16    16    16    16    15    15    16    16    16    16    16    16    16    16    16    16    14    15    14    15    14    15    14    16    14    15    14    15    13    15    11    14    10    14    10    14     9    14     9    14     9    14     9    14     9    15     6    13     5    12     6    13     6    13     6    13     5    13     4    10     4     9     4     9     4     8     4     8     4     8     3     5     3     6     3     6     3     6     4     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     5     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     5     3     5     2     5     2     4
                                                                   SNP                                                                                                               -----------C
                                                                   SNP                                                                                                                                                   ----------C-
                                               BLH ATG      32     615                                                   
                                               BLH MIN      32     403                                                   
                                               BLH OVR      32      35                                                   
                                               EST CLI       9      28                                                   
                                               ORF LNG      32       7                                                   
  5   1   0       chi Kid  5g                         IMAGE:4032500.5p GAATTCCCTCCACATCGGCGACCCACGGGTCCGCTTTACTTCAGTTTATTCCACCTGTCGAAAGGGTAAAGAGACTTCAAACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCCTTAGCAACTTGGAAATAAAATACACAAAGATTTTTATAAACAATGAATGGCACAATTCTGTAACTGGAAAAAAATTTCCTGTCTACGATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATGGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGGTATTAAATCACTGCGCTACTGTGCAAGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGGGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGAGGTAACACAATTGGTGATCAGGCCAGCTGGAACAAACTCCACTGAACTGGCTATTCTACCTGGGGGTCCTTTAAATTAAAGGGAGGCCAGGAAAATTCCTCCCTGGGGGGTAATTGGAAATAATTGTTACCCCAGGAATTATGGGACCCAACCACCCCGCGGAAGGCAAAGCCAATTAGGCCCGCAATCTCCTAAATGCGGATAAATAAGAACACAAAAAGTTGGGAGCGCTTTTCCTCACCTGGGGGTACTCCATAAAAGAGAAAA
  5   1   2       bld Int2 5g                         IMAGE:8825091.5p   CCCCCTCAGATACCCAAGAGCCACCAATACAAATTCGTCCCGTTTATTCCACCTGTCTAAAGGGTAAAGAGACTTCAAACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCCTTAGCAACTTGGAAATAAAATACACAAAGATTTTCATAAACAATGAATGGCACAATTCTGTAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATAGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGGCTATTTTACTTTTACAAGACATGAGCCTGGTGGAGTGTGTGGTCAAATAATCCCATGGGAATTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTAATGCTGTGGTAACACAGTTGTCATCCAGCCCAGCTGAACAAACTCCACTGACTGCTATCTACATGGGGTCTTTTAATAAAAGGAGGCAAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCACAGCCGAGCAGCTATATCTTATCATATGGATATAGACAGTGGCTTCATGGTCACGAGGTTGAAGCTGGTGAGGAGCGCAGAGACACTAAGAGTCCACTTGAACCTTGGTGGAAAAGCCTACATCATT
  5   1   2       bld Int2 5g                         IMAGE:8821016.5p                CCCCCCGGTTTCCCGAGGGATCCCACCCAACTCGAATTCGTCCCTAAAGGGTAAAGAGACTTCAAACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCATTAGCAACTTGGAAATAAAATACACAAAGATTTTTATAAACAATGAATGGCACAATTCTGTAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATGGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAGCCAGCTGAACAAACTCCACTGACTGCTATCTACATGGGGTCTTTAATAAAGGAGGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCCGGAGCAGCTATATCTTATCATATGGATATAGACAAAGTGGCTTTCACTGGTTCACAGAGTTGGAAAGCTGGTAAAGAGCAGCAGAAGAGCACTAAAGAGTCCACACTGACTGTGAAAAGCCTACATCATTTTTGCCAGATGCAGAACTTGGAATTTGC
  5   1   2       bld Int2 5g                         IMAGE:8821824.5p                          GGGTAGTTTAAGTAGCGGAGGTTTAACTATTAAAAATTCGTCCCGAGGACTTCAAACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCCTTAGCAACTTGGAAATAAAATACACAAAGATTTTCATAAACAATGAATGGCACAATTCTGTAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATGGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAGCCAGCTGAACAAACTCCACTGACTGCTATCTACATGGGGTCTTTAATAAAGGAGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCACAGCCGGAGCAGCTATATCTTATCATATGGATATAGACAAGTGCTTTCACTGGTTCAACAGAGGTTGGAAAGCTGTAAAGAGCAGCAGGAAAGAGCACTTAAAGAGTCACACTTGACTGGTGGAAAAGCCTACATCATTTTTGCGATGCCGACTGATTCGCAGTTGAGCATGCAACATGGCCTGTTCTATCATCAGGCCAGGTGTTGTGCTATG
  5   1   2      seed Te2N 5g                         IMAGE:7766820.5p                                          CAGTTTATTCCACCTGTCTAAAGGGTAAAGAGACTTCAAACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCATTAGCAACTTGGAAATAAAATACACAAAGATTTTTATAAACAATGAATGGCACAATTCTGTAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATGGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAGCCAGCTGAACAAACTCCACTGACTGCTATCTACATGGGGTCTTTAATAAAGGAGGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCCGGAGCAGCTATATCTTATCATATGGATATAGACAAAGTGGCTTTCACTGGT
  5   1   2       bld Kid  5g                         IMAGE:7008482.5p                                            CGGACGCGTGGGTGTCTAAAGGGTAAAGAGACTTCAAACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCCTTAGCAACTTGGAAATAAAATACACAAAGATTTTCATAAACAATGAATGGCACAATTCTGTAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATGGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAGCCAGCTGAACAAACTCCACTGACTGCTATCTACATGGGGTCTTTAATAAAGGAGGCAGGAATTCCTCCC
  5   1   2       bld Kid  5g                         IMAGE:4032770.5p                                                            TAAAGGGTAAAGAGACTTCAAACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCATTAGCAACTTGGAAATAAAATACACAAAGATTTTTATAAACAATGAATGGCACAATTCTGTAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATGGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTATTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAGCCAGCTGAACAAACTCCACTGACTGCTATCTACATGGGGTCTTTAATAAAGGAGGCAGGAATTCCTCCTGNGGTAGTGAATATTGTACCAGGATATGGACCAACAGCCGGAGCAGCTATATCTTATCATATGGATATAGACAAAGTGGCTTTCACTGGTTTCACAGAGGTTGGAAAGCTGGTAAAAGAAGCAGCAGGAAAGAGCAACCTTAAAAGAGTCACACTTTNAACTTGGTGGGAAAAAGCCC
  5   1   2       bld Kid  5g                IMAGE:4033392-IMAGp.IMAGp                                                              AAGGGTAAAGAGACTTCAAACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCATTAGCAACTTGGAAATAAAATACACAAAGATTTTCATAAACAATGAATGGCACAATTCTGTAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATGGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAGCCAGCTGAACAAACTCCACTGACTGCTATCTACATGGGGTCTTTAATAAAGGAGGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCCGGAGCAGCTATATCTTATCATATGGATATAGACAAAGTGGCTTTCACTGGTTCAACAGAGGTTGGAAAGCTGGTAAAAGAAGCAGCAGGAAAGAGCAACCTTAAAAGAGTCACACTTGAACTTGGTGGAAAAAGCCCTAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAGCATGCACACAATGGCCTGTT
  5   1   2       bld Kid  5g                         IMAGE:4033392.5p                                                                TTGCGAAAGAGACTTCAAACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCATTAGCAACTTGGAAATAAAATACACAAAGATTTTCATAAACAATGAATGGCACAATTCTGTAAGTGGAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATGGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAGCCAGCTGAACAAACTCCACTGACTGCTATCTACATGGGGTCTTTAATAAAGGAGGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCCGGAGCAGCTATATCTTATCATATGGATATAGACAAAGTGGGCTTTCACTGGTTCAACAGAGGTTGGAAAGCTGGGTAAAAGAAGCAGCAGGAAAAGAGCAACCTTTAAAGAAGTCACACTTT
  5   1   2       bld Kid  5g                         IMAGE:7008954.5p                                                                GGGTAAAGAGACTTCAAACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCATTAGCAACTTGGAAATAAAATACACAAAGATTTTCATAAACAATGAATGGCACAATTCTGTAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATGGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAGCCAGCTGAACAAACTCCACTGACTGCTATCTACATGGGGTCTTTAATAAAGGAGGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCCGGAGCAGCTATATCTTATCATATGGATATAGACAAAGTGGCTTTCACTGGTTCAACAGAGGTTGG
  5   1   2       bld Kid  5g                         IMAGE:4032932.5p                                                                 GGTAAAGAGACTTCAAACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCCTTAGCAACTTGGAAATAAAATACACAAAGATTTTTATAAACAATGAATGGCACAATTCTGTAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATGGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAGCCAGCTGAACAAACTCCACTGACTGCTATCTACATGGGGTCTTTAATAAAGGAGGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCCGGAGCAGCTATATCTTATCATATGGATATAGACAAAGTGGCTTTCACTGGTTCAACAGAGGTTGGGAAAGCTGGTAAAAAGAAGCAGCAGGGAAAGACCAACCTTAAAAGAAGTCACACT
  5   1   2       bld Int2 5g                         IMAGE:8529451.5p                                                                   GTAAGAGACTTCAAACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCCTTAGCAACTTGGAAATAAAATACACAAAGATTTTTATAAACAATGAATGGCACAATTCTGTAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATGGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAGCCAGCTGAACAAACTCCACTGACTGCTATCTACATGGGGTCTTTAATAAAGGAGGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCACAGCCGGAGCAGCTATATCTATCATATGATATAGACAAGTGCTTTCACTGGTC
  5   1   2       bld Te2N 5g                         IMAGE:7206737.5p                                                                     AAGAGACTTCAAACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCATTAGCAACTTGGAAATAAAATACACAAAGATTTTTATAAACAATGAATGGCACAATTCTGTAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATGGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAGCCAGCTGAACAAACTCCACTGACTGCTATCTACATGGGGTCTTTAATAAAGGAGGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCCGGAGCAGCTATATCTTATCATATGGATATAGACGAGGTGGCTTTCACTGGTTCCACAGAGGGTTGGAAGCTGGTAAAAGAAGCAGCAGGAAAGAGCAACCTTAAAAGAGTCACACCTGGAACTTGGTGGGAAAAAGCCCTAACATCATTTTTGCCGAAGCCAAACTTTGGGATTTGGGCAGTTTGAGCAGGGCACACA
  5   1   2       bld Kid  5g                         IMAGE:7011359.5p                                                                           ACTTCAACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCATTAGCAACTTGGAAATAAAATACACAAAGATTTTCATAAACAATGAATGGCACAATTCTGTAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATGGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAGCCAGCTGAACAAACTCCACTGACTGCTATCTACATGGGGTCTTTAATAAAGGAGGCAAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCCGGAGCAGCTATATCTTATCATATGGATATAGACAAAGTGGCTTTCACTGGTTTCACAGAGGTTTGAAAGCTGGTAAAGAAGCAGCAGGAAGAAGCACCTTAAAGAGTCCACTTGACTTGGTGAAAAGCCTACATCTTTTGCAATGCGACTTGATTTGCATTGACAGCCCCATGGCTTGTCTCATCAGGCATGTTCA
  5   1   2       bld Kid  5g                         IMAGE:4031362.5p                                                                                AACATGTCCGTGAAAACCCTTCCTCAAGGTTTGCCAGCTCCCATTAGCAACTTGGAAATAAAATACACAAAGATTTTCATAAACAATGAATGGCACAATTCTGTAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAAAGAAGCTTTCCAGATAGGGTCTGCATGGCGAAGGCTGGATGCTTCTGAAAGAGGCAGGATGCTTAATAGGTTGGCTGACCTTGTGGAACGTGATAGGTTGATTCTAAGCACCATGGAATCTATTGACGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAGCCAGCTGAACAAACTCCACTGACTGCTATCTACATGNGGTCTTTAATAAAGGAGGCAGGAATTCCTCCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCCGGAGCAGCTATATCTTATCATATGGATATAGACAAAGTGGCTTTCACTGGTTCAACAGAGGTTGGAAAGCTGGTAAAAGAAGCAGCANGGAAGAAGCACCNTTAAAAGAGTCACACTTTGAACTTGGNTGGAAAAGCCCCTAACATCATTTTTTGCAGATGCCAGACTGGGAATTGGGCAGTTGAAGCATGCACACAATGGGCCTGGGTCTATCAATCAAGGGCCANTGGTTGNCATAAGCA
  5   1   2       bld Int2                            IMAGE:8527479.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAGTCCAAGGCCGTACAATACCAATGGATGGGGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCGTTGTTGATGTTTTCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAGCCAGCTGAACAAACTCCACTGACTGCTATCTACATGGGGTCTTTAATAAAGGAGGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCCGGAGCAGCTATATCTTATCATATGGATATAGACAAAGTGGCTTTCACTGGTTCAACAGAGGTTGGAAAGCTGGTAAAAGAAGCAGCAGGAAAGAGCAACCTTAAAAGAGTCACACTTGAACTTGGTGGAAAAAGCCCTAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAGCATGCACACAATGGCCTGTTCTATCATCAGGGCCAGTGTTGCATAGCAGGATCCAGGATCTTTGTTGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTACTTGGAGATCCTCTTACTCCTGGTGTATGCCAAGGACCACAGATTGACAAAGAACAATACCACAAAATCCTTGAATTGATTGAGAGTGGAAAGAAA
  5   1   2       bld Kid                             IMAGE:4033267.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATATAGACAAAGTGGCTTTCACTGGTTCAACAGAGGTTGGAAAGCTGGTAAAAGAAGCAGCAGGAAAGAGCAACCTTAAAAGAGTCACACTTGAACTTGGTGGAAAAAGCCCTAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAGCATGCACACAATGGCCTGTTCTATCATCAGGGCCAGTGTTGCATAGCAGGATCCAGGATCTTTGTTGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTACTTGGAGATCCTCTTACTCCTGGTGTATGCCAAGGACCACAGATTGACAAAGAACAATACAACAAAATCCTTGAATTGATTGAGAGTGGaaaaaaaaaaGG
  5   1   2       bld Kid                             IMAGE:4033364.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGCTGGTAAAAGAAGCAGCAGGAAAGAGCAACCTTAAAAGAGTCACACTTGAACTTGGTGGAAAAAGCCCTAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAGCATGCACACAATGGCCTGTTCTATCATCAGGGCCAGTGTTGCATAGCAGGATCCAGGATCTTTGTTGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTACTTGGAGATCCTCTTACTCCTGGTGTATGCCAAGGACCACAGATTGACAAAGAACAATACAACAAAATCCTTGAATTGATTGAGAGTGGAAAGAAAGAAGGCGCAAAGTTGGAATGTGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATTAGCCCCACAGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAAACAATTGACGAAGTTATTAAGAGGGCAAACAATACCAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGATATGGACAAAGCAATATTAATGTCTACAGCTCTTCANGCTGGAACTGTTTGGATAAATTGCTACAGTGCCATGTCTCCACAAAGCCCTTTCGGCGGGGTTAAGATGTCCGGGAAATGGCCCGTGAAAATGGGCCGAATATGGGCCTGGCATGGAATACACCTGGAAGGTCAAGGACCGGGGTAATCCATGGAAACCATTTTCCACCACGAAAAGAAATTTCCCTCTAAAAGGATTGTTTCAAACGGCTCCACCCCAATATTAATCCCCCTGGGAAAATGGCGCCCCTTGGNAAAGGGA
  5  -1   2       bld Kid                             IMAGE:7009001.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGCCTGTTCTATCATCAGGGCCAGTGTGNCATAGCAGGATCCAGGATCTTTGTGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTACTTGGAGATCCTCTTACTCCTGGTGTATGCCAAGGACCACAGATTGACAAAGAACAATACAACAAAATCCTTGAATTGATTGAGAGTGGAAAGAAAGAAGGCGCAAAGTTGGAATGTGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATTAGCCCCACAGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAAACAATTGACGAAGTTATTAAGAGGGCAAACAATACCAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGATATGGACAAAGCAATATTAATGTCTACAGCTCTTCAGGCTGGAACTGTTTGGATAAATTGCTACAGTGCCATGTCTCCACAAAGCCCTTTCGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGCGAATATGGCCTGCATGAATACACTGAAGTCAAGACGGTTATCATGAACATTTCACAGAAGAATTCCTAAAGATGTCACGTCACCAATATCCTGAATGCCTGGAGGATCGTGGAAACACTGCCATATTTGTGTGCATAAATCTCATGATAACAACAGCTGCAAATATTTGTGGTGCTGG
  5   1   2       bld Int2                            IMAGE:8825149.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGGCCCTGGATCCATAGGAATACTCCTCATACAATTCGTCCCCTTTGTTGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTACTTGGAGATCCTCTTACTCCTGGTGTATGCCAAGGACCACAGATTGACAAAGAACAATACAACAAAATCCTTGAATTGATTGAGAGTGGAAAGAAAGAAGGCGCAAAGTTGGAATGTGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATTAGCCCCACAGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAAACAATTGACGAAGTTATTAAGAGGGCAAACAATACCAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGATATGGACAAAGCAATATTAATGTCTACAGCTCTTCAGGCTGGAACTGTTTGGATAAATTGCTACAGTGCCATGTCTCCACAAAGCCCTTTCGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGCGAATATGGCCTGCATGAATACACTGAAGTCAAGACGGTTATCATGAACATTTCACAGAAGAATTCCTAAAGATGTCACGTCACCAATATCCTGAATGCCTGGAGGATCGTGGAAACACTGCCATATTTGTGTGCATAAATCTCATGATAACACAGCTGCAAATATTTGTGGTGCTGGTaaaaaaaaaaaTTCTTTATTATAGTGAAGTTGACCACGGTATCAGTTGTCAATAGGTCTGGAAAACATAGACTTTTGTTCTACTGATCCTGCATGCATTAATACATATCACGTGTAGAGAATCATATAATACCCGCCGTGTTTATTGCTGCCCTCCTGTCACACGGTCCCGGGTATGGATAGTGT
  5   1   2       bld Tad1                            IMAGE:6936836.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGCGTAAGAGTGTTAAAAGGGCCAAAAAACGTGTACTTGGAGATCCTCTTACTCCTGGTGTATGCCAAGGACCACAGATTGACAAAGAACAATACAACATAATCCTTGAATTGATTGACAGTGGAAAGAAAGAAAGCGCATAGTTGGAATGTGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATTAACCCCACAGTCTTTTCACATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAAACAATTGACGAAGTTATTAAGAGGGCAAACAATACCAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGATATGGACAAAGCAATATTAATGTCTACAGCTCTTCAGGCTGGAACTGTTTGGATAAATTGCTACAGTGCCATGTCTCCACAAAGCCCTTTCGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGCGAATATGGCCTGCATGAATACACTGAAGTCAAGACGGTTATCATGAACATTTCACAGAAGAATTCCTAAAGATGTCACGTCACCAATATCCTGAATGCCTGGAGGATCGTGGAAAACACTGTCATATTTGTGTGCATAAATCTCATGGATACAACAGCTGCCAATATTTTGTGGTGCTGGTaaaaaaaaaaaaaaTCTTTTATTAATAGTGAAATTTGAACCACCGGTATCCAATTGGCA
  5   1   2       add Tad1                            IMAGE:6938482.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCCCACAGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTTAAAACAATTGACGAAGTTATTAAGAGGGCAAACAATACCAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGATATGGACAAAGCAATATTAATGTCTACAGCTCTTCAAGCTGGAACTGTTTGGATAAATTGCTACAGTGCCATGTCTCCACAAAGCCCTTTCGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGCGAATATGGCCTGCATGAATACACTGAAGTCAAGACGGTTATCATGAACATTTCACAGAAGAATTCCTAAAGATGTCACGTCACCAATATCCTGAATGCCTGGAGGATCGTGGAAACACTGTCATATTTGTGTGCATAAATCTCATGATAACAACAGCTGCAAATATTTGTGGTGCTGGTaaaaaaaaaaaaaaTCTTTATTATAGCGAAGTTGACCACCGTATCAATTGTCAATAAGTCTGGGAAACAATAAACTTTTGTTCTACTGATCCTGCAGTGCATTAATACATTATCACCGGTTGGTAGAGAAATCATTATATACCCCGCCGTGGTTATGGCTGCCCCTCCTGGTCACAAGCCCCTTGGGGTTAGGAATGGTCCCCGGGGGCCAGAAATATCCGTTTCCAATGGAATTTTGTAAATCCAAAGCCCCTCCATTTTTTAACCCCCCCATTTTCAAAACCTAAGTGGGTTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)