Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 06 Jul 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk131f13ex.3                        11 END     2           8       18                LOC100101293 protein [Xenopus laevis]
     2   0.0    0Xl3.1-IMAGE:8643430.5                       7 END     1           4       14                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:6640689.5                      17 PI      92          1      957                (no blast hit)

 This cluster: approximate FL confidence score = 89%

 1012769920 Xl3.1-XL460i13ex.5 - 24 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                        8     9     9    10    11    11    11    11    11    11    10    11    11    11    11    11    11    11    11    11    11    11    12    13    14    14    14    14    14    14    13    14    14    14    14    14    14    14    14    14    14    14    13    15    14    15    15    16    14    16    15    16    15    16    15    16    15    16    14    16    16    17    16    17    18    18    18    18    18    18    18    18    18    18    18    18    19    19    19    19    19    19    18    19    18    19    18    19    17    18    15    16    16    17    16    17    16    17    16    17    16    17    16    17    16    17    15    16    15    16    13    15    13    14    13    14    12    14    11    13    10    12    10    12    11    13    11    13    10    12     8    12     9    11     9    11     8    10     8     9     9     9     8     8     6     7     7     7     5     7     5     6     5     6     5     6     4     6     5     7     5     7     4     6     4     6     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                                                   SNP                                                                               --G---------
                                                                   SNP                                                                                                                                                                                                                                                                   -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----G-------
                                               BLH ATG       2     468                   
  5   1   2       bld Neu7                                 XL014l09.5p                                                                                                                                                                                                                                                                                              ACGACCTTCTCACCATCGGCACAGNCACTGGCACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGNTGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGTAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTT
  5   1   2       bld Tbd7                                 XL107a16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATNAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACAGTGCAGCCTCCCCGGGAGTCTCGATCTATCCAAGACACAGCAGGTCTTTATTTCCTGTCCAGCGCTGTGCACGACCGATTGGTCAGCGTATGGCAGGTTCGGTCTGCAAAGGACAAAAGTTCTGTCCTATCCTTCACTCTCACAGAACCACCCATATTCATGGACCTGAGTACAACCGAGAGCAAAGAGGAGCCGCTGAAGCTGGCGGTTGTTTGCCGGGATGGGCAGTTGCACTTATTTGAACATGTGTTAAACGGAACTCACAAGAAGCCAATCGCGCCTACTTGTACAGTACAGATCGCAACGTCGGGCAGTGATGACTCCACCCCCAAGCCCATCCCTATTCTGGCAGCTGCTTTCTGTGCAGACAGACAGTCCCTGCTCATGTTCTATGGCAGCACCTTACAGCCTATCATTGAGAGAGTGGCGCTGAAAAGCGATGAACCCAACATTTGTCTTATCCGCGACATCCAAAAGACAGTGTCTCTCAGAAAGGACATGCCTGTAACAAAGGTGAAAACTCCAGTTGTAAATTCAGACTCGAA
  5   1   2       add Ga15                               XL467f19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCGGTCTGCAAAGGACAAAAGTTCTGTCCTATCCTTCNCTCTCACANAACCACCCGTATTCATGGACCTGAGTACAACCGANAGCAAANANGANCCGCTGAANCTGGCGGTTGTTTGCCGGGATGGGCANTTNCACTTATTTGAACATGTGTTANACNGAACTCAC
  5   1   2       bld DMZ                                  xl231p23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCAGTGATGACTCCACCCCCAAGCCCATCCCTATTCTGGCAGCTGCTTTCTGTGCAGACAGACAGTCCCTGCTCATGTTCTATGGCAGCACCTTACAGCCTATCATTGAGAGAGTGGCGCTGAAAAGCGATGAACCCAACATTTGTCTTATCCGCGACATCCAAAAGACAGTGTCTCTCAGAAAGGACATGCCTGTAACAAAGGTGAAAACTCCAGTTGTAAATTCAGACTCGAAGGTTCTAACACCAGGAATCCCAGGTCACAGCTCGGCAATTTCAGCTGCCTTGGCACATACCAAAAAGCAGGAGAGCAAGAGGAAGCCAGGAGACAATGAGGCCAGCATAGAGGATCGTCTTGGCGCTATGGATATAGACCCCACCAACGTGCCGAGTAAAGGAGCCTTGCCGCAGACTGACAACTTTGCCGTATTGCTGGTGCAAGGCCTGGAAAGCAACGATCTAAACATTCTGAATAAAGTCTTTCAGACCAAAAACGAGTCCTTAATAAGGAAGACTGTGGCCAGGATTCCCGTTTATGCTGTCATCCCCCTGGTGCACGAGCTAACAAGGAGATTACAAGGACATCCTTTGAGTACCATACTGATGGTGAGATGGCTAAAGGCTGTGTTGGTCCTCCATGCTTCCTACCTTTCCACTTTGCCGGACTTGGTCCCACAGCTGGGGATGTTGTACC
  5   1   0       add DMZ       out                        xl311e07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACCAACGTGCCGAGTAAAGGAGCCTTGCCGCAGACTGACAACTTTGCCGTATTGCTGGTGCAAGGCCTGGAAAGCAACGATCTAAACNTTCTGAATAAAGTCTTTCAGACCAAAAACGAGTCCTTAATAAGGAAGACTGTGGCCAGGATTCCCGTTTATGCTGTCATCCCCCTGGTGCACGAGCTAACAAGGA

In case of problems mail me! (