Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk131f13ex.3                        11 END     2           8       18                LOC100101293 protein [Xenopus laevis]
     2   0.0    0Xl3.1-IMAGE:8643430.5                       7 END     1           4       14                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:6640689.5                      17 PI      92          1      957                (no blast hit)

 This cluster: approximate FL confidence score = 89%

 1012769920 Xl3.1-XL460i13ex.5 - 24 ESTs
                                                                       ........-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL460i13ex.5                   CAATGGCGGCAGCGGGCGGCGTGTACGAGCTGCTTCCCCCACCGTGCGCCTTCTCCCCGCGCAGCCGGGACCTACTGGCTCTGTCCGGACCCGACGGGAGGATCCAAGTGTGGGACACACAAGGCGGGGGCTTGAGAAAGGAATATGTCCCCTCTGCCCATCTCAGCGCTACTTGTACCTGCCTGGCGTGGGCACAGGGCCGAGCCGACAAGGAAACTCATCAGAAAAAGAAAAGGAAATCAGAGGCGGCAGACAGGGACGGGCAGTACGACCTTCTCACCATCGGCACAGCCACTGGCACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGTTGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGCAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACAGTGCAGCCTCCCCGGGAGTCTCGATCTATCCAAGACACAGCAGGTCTTTATTTCCTGTCCAGCGCTGTGCACGACCGATTGGTCAGCGTATGGCAGGTTCGGTCTGCAAAGGACAAAAGTTCTGTCCTATCCTTCACTCTCACAGAACCACCCGTATTCATGGACCTGAGTACTACCGAGAGCAAAGAGGAGCCCCTGAAGCTGGCGGTTGTTTGCCGGGATGGGCAGTTGCACTTATTTGAACATGTGTTAAACGGAACTCACAAGAAGCCAATCGCGCCTACTTGTACAGTACAGATCGCAACGTCGGGCAGTGATGACTCCACCCCCAAGCCCATCCCTATTCTGGCAGCTGCTTTCTGTGCAGACAGACAGTCCCTGCTCATGTTCTATGGCAGCACCTTACAGCCTATCATTGAGAGAGTGGCGCTGAAAAGCGATGAACCCAACATTTGTCTTATCCGCGACATCCAAAAGACAGTGTCTCTCAGAAAGGACATGCCTGTAACAAAGGTGAAAACTCCAGTTGTAAATTCAG
                                                  Xl3.1-CHK-1012688863                         CGGCAGCGGGCGGCGTGTACGAGCTGCTTCCCCCACCGTGCGCCTTCTCCCCGCGCAGCCGGGACCTACTGGCTCTGTCCGGACCCGACGGGAGGATCCAAGTGTGGGACACACAAGGCGGGGGCTTGAGAAAGGAATATGTCCCCTCTGCCCATCTCAGCGCTACTTGTACCTGCCTGGCGTGGGCACAGGGCCGAGCCGACAAGGAAACTCATCAGAAAAAGAAAAGGAAATCAGAGGCGGCAGACAGGGACGGGCAGTACGACCTTCTCACCATCGGCACAGCCACTGGCACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGTTGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGCAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACAGTGCAGCCTCCCCGGGAGTCTCGATCTATCCAAGACACAGCAGGTCTTTATTTCCTGTCCAGCGCTGTGCACGACCGATTGGTCAGCGTATGGCAGGTTCGGTCTGCAAAGGACAAAAGTTCTGTCCTATCCTTCACTCTCACAGAACCACCCGTATTCATGGACCTGAGTACTACCGAGAGCAAAGAGGAGCCCCTGAAGCTGGCGGTTGTTTGCCGGGATGGGCAGTTGCACTTATTTGAACATGTGTTAAACGGAACTCACAAGAAGCCAATCGCGCCTACTTGTACAGTACAGATCGCAACGTCGGGCAGTGATGACTCCACCCCCAAGCCCATCCCTATTCTGGCAGCTGCTTTCTGTGCAGACAGACAGTCCCTGCTCATGTTCTATGGCAGCACCTTACAGCCTATCATTGAGAGAGTGGCGCTGAAAAGCGATGAACCCAACATTTGTCTTATCCGCGACATCCAAAAGACAGTGTCTCTCAGAAAGGACATGCCTGTAACAAAGGTGAAAACTCCAGTTGTAAATTCAGACTCGA
                                                      consensus depths                        8     9     9    10    11    11    11    11    11    11    10    11    11    11    11    11    11    11    11    11    11    11    12    13    14    14    14    14    14    14    13    14    14    14    14    14    14    14    14    14    14    14    13    15    14    15    15    16    14    16    15    16    15    16    15    16    15    16    14    16    16    17    16    17    18    18    18    18    18    18    18    18    18    18    18    18    19    19    19    19    19    19    18    19    18    19    18    19    17    18    15    16    16    17    16    17    16    17    16    17    16    17    16    17    16    17    15    16    15    16    13    15    13    14    13    14    12    14    11    13    10    12    10    12    11    13    11    13    10    12     8    12     9    11     9    11     8    10     8     9     9     9     8     8     6     7     7     7     5     7     5     6     5     6     5     6     4     6     5     7     5     7     4     6     4     6     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                                                   SNP                                                                               --G---------
                                                                   SNP                                                                                                                                                                                                                                                                   -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----G-------
                                               BLH ATG       2     468                   
  5   1   2       bld Em10 5g                         IMAGE:8319407.5p GGCTTGTGGCGGAACGAGCAATGGCGGCAGCGGGCGGCGTGTACGAGCTGCTTCCCCCACCGTGCGCCTTCTCCCCGCGCAGCCGGGACCTACTGGCTCTGTCCGGACCCGACGGGAGGATCCAAGTGTGGGACACACAAGGCGGGGGCTTGAGAAAGGAATATGTCCCCTCTGCCCATCTCAGCGCTACTTGTACCTGCCTGGCGTGGGCACAGGGCCGAGCCGACAAGGAAACTCATCAGAAAAAGAAAAGGAAATCAGAGGCGGCAGACAGGGACGGGCAGTACGACCTTCTCACCATCGGCACAGCCACTGGCACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGTTGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGCAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAA
  5   1   2       bld DMZ  5g                              xl247o22.5p       GGCGGAACGAGCAATGGCGGCAGCGGGCGGCGATGTACGAGCTGCTTCCCCCACCGTGCGCCTTCTCCCCGCGCAGCCGGGACCTACTGGCTCTGTCCGGACCCGACGGGAGGATCCAAGTGTGGNACACACAAGGCGGGGGCTTGAGAAAGGAATATGTCCCCTCTGCCCATCTCAGCGCTACTTGTACCTGCCTGGCGTGGGCACAGGGCCGAGCCGACAAGGAAACTCATCATAAAAAGAAAAGGAAATCCGAGGCGGCAGACAGGGACGGGCAGTATGACCTTCTCACCATCGGCACAGCCACTGGCACCATTTTACTGTACAGNATTGTTAAGGGAGAGCTANAGAGCAAGCTGGTTGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCANAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGCAAATGGAAAGGAGACNACAGCAGCGTCNGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGG
  5   1   2       bld DMZ  5g                              xl286g06.5p         GCGGAACGAGCAATGGCGGCAGCGGGCGGCGTGTACGAGCTGCTTCCCCCACCGTGCGCCTTCTCCCCGCGCAGCCGGGACCTACTGGCTCTGTCCGGACCCGACGGGAGGATCCAAGTGTGGGACACACAAGGCGGGGGCTTGAGAAAGGAATATGTCCCCTCTGCCCATCTCAGCGCTACTTGTACCTGCCTGGCGTGGGCACAGGGCCGAGCCGACAAGGAAACTCATCAGAAAAAGAAAAGGAAATCCGAGGCGGCAGACAGGGACGGGCAGTACGACCTTCTCACCATCGGCACAGCCACTGGCACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGTTGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGCAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACAGTGCAGC
  5   1   2       bld Ga15 5g                            XL463a17ex.5p             AACGAGCAATGGCGGCAGCGGGCGGCGTGTACGAGCTGCTTCCCCCACCGTGCGCCTTCTCCCCGCGCAGCCGGGACCTACTGGCTCTGTCCGGACCCGACGGGAGGATCCAAGTGTGGGACACACAAGGCGGGGGCTTGAGAAAGGAATATGTCCCCTCTGCCCATCTCAGCGCTACTTGTACCTGCCTGGCGTGGGCACAGGGCCGAGCCGACAAGGAAACTCATCAGaaaaaaaaaa
  5   1   2       bld Em10 5g                         IMAGE:7980180.5p              ACGAGCAATGGCGGCAGCGGGCGGCGTGTACGAGCTGCTTCCCCCACCGTGCGCCTTCTCCCCGCGCGGCCGGGACCTACTGGCTCTGTCCGGACCCGACGGGAGGATCCAAGTGTGGGACACACAAGGCGGGGGCTTGAGAAAGGAATATGTCCCCTCTGCCCATCTCAGCGCTACTTGTACCTGCCTGGCGTGGGCACAGGGCCGAGCCGACAAGGAAACTCATCAGAAAAAGAAAAGGAAATCAGAGGCGGCAGACAGGGACGGGCAGTACGACCTTCTCACCATCGGCACAGCCACTGGCACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGTTGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGCAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACCGTGCAGCCTCCCCGGGAGTCTCGATCTATCCAAGACACAGCAAGTCTTTATTTCCTGTCAGCGCTGTGCACGACGATTGGTCACGTATGCAGGTCGGTCGCAAAGACAAAGTCNGTCTATCCTCCTCTCCAAACACCCTTTCATGACTGAGTAACCAAACAAGAGACCCTAACTGCGTGTTTCGGAGG
  5   1   2       bld Em10 5g                         IMAGE:8320566.5p               CGAGCAATGGCGGCAGCGGGCGGCGTGTACGAGCTGCTTCCCCCACCGTGCGCCTTCTCCCCGCGCGGCCGGGACCTACTGGCTCTGTCCGGACCCGACGGGAGGATCCAAGTGTGGGACACACAAGGCGGGGGCTTGAGAAAGGAATATGTCCCCTCTGCCCATCTCAGCGCTACTTGTACCTGCCTGGCGTGGGCACAGGGCCGAGCCGACAAGGAAACTCATCAGAAAAAGAAAAGGAAATCAGAGGCGGCAGACAGGGACGGGCAGTACGACCTTCTCACCATCGGCACAGCCACTGGCACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGTTGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGCAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACCGTGCAGCCTCCCCGGGAGTCTCGATCTATCCAGACACAGCAGTCTTTATTTCTGTCAGCGCTGTGCACGACGATGGTCACGTATGGCAGTCGGCTGCAAAGACAAAGTCTGTCTATCTTCCTCCCAAACCACGTATCATGACTGATACACGAAGCAGAGACGCTGACTGCGTGTGCGGATGCGTGCATATGATGGTA
  5   1   2       bld DMZ  5g                              xl310e01.5p                GAGCAATGGCGGCAGCGGGCGGCGTGTACGAGCTGCTTCCCCCACCGTGCGCCTTCTCCCCGCGCAGCCGGGACCTACTGGCTCTGTCCGGACCCGACGGGAGGATCCAAGTGTGGGACACACAAGGCGGGGGCTTGAGAAAGGAATATGTCCCCTCTGCCCATCTCAGCGCTACTTGTACCTGCCTGGCGTGGGCACAGGGCCGAGCCGACAAGGAAACTCATCAGAAAAAGAAAAGGAAATCAGAGGCGGCAGACAGGGACGGGCAGTACGACCTTCTCACCATCGGCACAGCCACTGGCACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGATGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGCAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACAGTGCAGCCTCCCCGGGAGTCTCGGTCTATCC
  5   1   2       bld DMZ  5g                              xl302o12.5p                GAGCAATGGCGGCAGCGGGCGGCGTGTACGAGCTGCTTCCCCCACCGTGCGCCTTCTCCCCGCGCAGCCGGGACCTACTGGCTCTGTCCGGACCCGACGGGAGGATCCAAGTGTGGGACACACAAGGCGGGGGCTTGAGAAAGGAATATGTCCCCTCTGCCCATCTCAGCGCTACTTGTACCTGCCTGGCGTGGGCACAGGGCCGAGCCGACAAGGAAACTCATCAGAAAAAGAAAAGGAAATCAGAGGCGGCAGACAGGGACGGGCAGTACGACCTTCTCACCATCGGCACAGCCACTGGCACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGATGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGCAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACAGTGCAGCCTCCCCGGGAGTCTCGGTCTATCCAAGACACAGCAGGTCTTTATTTCCTGTCCAGCGCTGTGCACG
  5   1   2      seed Ga15 5g                            XL460i13ex.5p                   CAATGGCGGCAGCGGGCGGCGTGTACGAGCTGCTTCCCCCACCGTGCGCCTTCTCCCCGCGCAGCCGGGACCTACTGGCTCTGTCCGGACCCGACGGGAGGATCCAAGTGTGGGACACACAAGGCGGGGGCTTGAGAAAGGAATATGTCCCCTCTGCCCATCTCAGCGCTACTTGTACCTGCCTGGCGTGGGCACAGGGCCGAGCCGACAAGGAAACTCATCAGAAAAAGAAAAGGAAATCCGAGGCGGCAGACAGGGACGGGCAGTACGACCTTCTCACCATCGGCACAGCCACTGGCACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGTTGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGCAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACAGTGCAGCCTCCCCGGGAGTCTCGGTCTATCCAAGACACAGCAGGTCTTTATTTCCTGTCCAGCGCTGTGCACGACCGATTGGTCAGCGTATGGCAGGTTCGGTCTGCAAAGGACAAAAGTTCTGTCCTATCCTTCACTCTCACAGAACCACCCGTATTCAT
  5   1   2       bld Emb9                            IMAGE:7975487.5p                            CAGCGGGCGGCGTGTACGAGCTGCTTCCCCCACCGTGCGCCTTCTCCCCGCGCGGCCGGGACCTACTGGCTCTGTCCGGACCCGACGGGAGGATCCAAGTGTGGGACACACAAGGCGGGGGCTTGAGAAAGGAATATGTCCCCTCTGCCCATCTCAGCGCTACTTGTACCTGCCTGGCGTGGGCACAGGGCCGAGCCGACAAGGAAACTCATCAGAAAAAGAAAAGGAAATCAGAGGCGGCAGACAGGGACGGGCAGTACGACCTTCTCACCATCGGCACAGCCACTGGCACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGTTGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGCAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACCGTGCAGCCTCCCCGGGAGTCTCGATCTATCCAAGACACAGCAGGTCTTTATTTCCTGTCCAGCGCTGTGCACGACCGAATGGTCAGCGTATGG
  5   1   2       bld Ga18      out                     xlk131f13ex.5p                                GGGCGGCGTGTACGAGCTGCTTCCCCCACCGTGCGCCTTCTCTCCGCGCGGNCGGGACCTACTGGCTCTGTCCGGACCCGACGGGAGGATCCAAGTGTGGGACACACAAGGCGGGGNCTTGAGAAAGGAATATGTCCCCTCTGCCCATCTCAGCGCTACTTGTACCTGCCTGGNGTGGNCACAGGGCCGAGCCGACAAGGAAACTCATCAGAAAAAGAAAAGGAAATCCGAGGCGGCAGANAAGGACGGGCAGTACGACCTTCTCACCATCGGCACANNCACTGGNACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGTTGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGTAAATGGAAAGGAGACAACAGCAGCGTCNNNNTTTGTGCATCAGNCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGANNCATCAAACTCTGGGATCTGGAGNNCAAAGAAGNCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACCGTGCAGCCTCCCCGGGNGNCTCGATCTATNCNANGACACAGCAGG
  5   1   2       bld Tbd3                   IMAGE:3548499-IMAGp.IMAGp                                                                                                                                            TGGGATTCCCCGGGGAAAGGAATATGTCCCCTCTGCCCATCTCAGCGCTACTTGTACCTGCCTGGCGTGGGCACAGGGCCGAGCCGACAAGGAAACTCATCAGAAAAAGAAAAGGAAATCCGAGGCGGCAGACAAGGACGGGCAGTACGACCTTCTCACCATCGGCACAGCCACTGGCACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGTTGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGTAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACCGTGCAGCCTCCCCGGGAGTCTCGATCTATCCAAGACACAGCAGGTCTTTATTTCCTGTCCAGCGCTGTGCACGACCGATTGGTCAGCGTATGGCAGGTTCGGTCTGCAAAGGACAAAAGTTCTGTCCTATCCTTCACTCTCACAGAACCACCCGTATTCATGGACCTGAGTACTACCGAGAGCAAAGAGGAGCCCCTGAAGCTGGCGGTTGTTTGCCGGGATGGGCAGTTGCACTTATTTGAACATGTGTTAAACGGAACTCACAAGAAGCCAATCGCGCCTACTTGTACAGTACAGATCGCAACGTCGGGCAGTGATGACTCCACCCCCCAAGCCCATCCCTATTCTGGCAGCTGCTTTCTGTGCAGA
  5   1   2       bld Em10                            IMAGE:8321752.5p                                                                                                                                                     GCTTGAGAAAGAATATGTCCCCTCTGCCCATCTCAGCGCTACTTGTACCTGCCTGGCGTGGGCACAGGGCCGAGCCGACAAGGAAACTCATCAGAAAAAGAAAAGGAAATCAGAGGCGGCAGACAGGGACGGGCAGTACGACCTTCTCACCATCGGCACAGCCACTGGCACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGTTGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGCAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACCGTGCAGCCTCCCCGGGAGTCTCGATCTATCCAAGACACAGCAGGTCTTTATTTCCTGTCCAGCGCTGTGCACGACCGATTGGTCAGCGTATGGCAGGTTCGGTCTGCAAAGGACAAAAGTTCTGTCCTATCCTTCACTCTCACAGAACCACCCGTATTCATGGACCTGAGTACAACCGAGAGCAAAGAGGAGCCGCTGAAGCTGGCGGTTGTTTGC
  5   1   2       bld Tbd3                            IMAGE:3548511.5p                                                                                                                                                           AAAGGAATATGTCCCCTCTGCCCATCTCAGCGCTACTTGTACCTGCCTGGCGTGGGCACAGGGCCGAGCCGACAAGGAAACTCATCAGAAAAAGAAAAGGAAATCCGAGGCGGCAGACAAGGACGGGCAGTACGACCTTCTCACCATCGGCACAGCCACTGGCACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGTTGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGTAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACCGTGCAGCCTCCCCGGGAGTCTCGATCTATCCAAGACACAGCAGGTCTTTATTTCCTGTCCAGCGCTGTGCACGACCGATTGGTCAGCGTATGGCAGGTTCGGTCTGCANAGGACAAAAGTTCTGTCCTATCCTTCACTCTCACAGAACCACCCGTATTCATGGACCTGAGTACTACCGAGAGCAAAGAGGAGCCCCTGAAGCTTGCGGTTGTTTGCCGGGATGGGCAG
  5   1   2       bld Te2N                            IMAGE:7766049.5p                                                                                                                                                                                                                                                  AGAAAAGAAAAGGAAATCAGAGGCGGCAGACAGGGACGGGCAGTACGACCTTCTCACCATCGGCACAGCCACTGGCACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGTTGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGCAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACAGTGCAGCCTCCCCGGGAGTCTCGGTCTATCCAAGACACAGCAGGTCTTTATTTCCTGTCCAGCGCTGTGCACGACCGATTGGTCAGCGTATGGCAGGTTCGGTCTGCAAAGGACAAAAGTTCTGTCCTATCCTTCACTCTCACAGAACCACACGTATTCATGGACCTGAGTACTACCGAGAGCAAAGAGGAGCCCCTGAAGCTGGCGGTTGTTTGCCGGGATGAGCAGTTGCACTTATTTGAACATGTNGTAAACGAACTCANCAGAAGCCATCGCGCCTACCTGGACAGTACAGATCGCAACGTCGGGCAGTGATGACTCCACCCCCAAGCCATCCCTATCTGG
  5   1   2       chi Emb4      out                   IMAGE:4957597.5p                                                                                                                                                                                                                                                                     CGGTTCCTTGTTCACCTCTCGTGGTGCCACCTCACGCAGTTCACCCTGCTGTCATGCCCTCCATCCAGCTTGCTCTGTAGCTCTCCCTTAACAATGCTGTACAGTAAAATGGTGCCAGTGGCTGTGCCGATGGTGAGAAGGTCGTACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGCAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACAGTGCAGCCTCCCCGGGAGTCTCGATCTATCCAAGACACAGCAGGTCTTTATTTCCTGTCCAGCGCTGTGCACGACCGATTGGTCAGCGTATGGCAGGTTCGGTCTGCAAAGGACAAAAGTTCTGTCCTATCCTTCACT
  5   1   2       bld Neu7                                 XL014l09.5p                                                                                                                                                                                                                                                                                              ACGACCTTCTCACCATCGGCACAGNCACTGGCACCATTTTACTGTACAGCATTGTTAAGGGAGAGCTACAGAGCAAGCTGGNTGGAGGGCATGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGTAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTT
  5   1   2       bld Emb1                            IMAGE:6631979.5p                                                                                                                                                                                                                                                                                                                                                                                         TGACAGCAGGGTGAACTGCGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGCAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACAGTGCAGCCTCCCCGGGAGTCTCGGTCTATCCAAGACACAGCAGGTCTTTATTTCCTGTCCAGCGCTGTGCACGACCGATTGGTCAGCGTATGGCAGGTTCGGTCTGCAAAGGACAAAAGTTCTGTCCTATCCTTCACTCTCACAGAACCACCCGTATTCATGGACCTGAGTACTACCGAGAGCAAAGAGGAGCCCCTGAAGCTGGCGGTTGTTTGCCGGGATGGGCAGTTGCACTTATTTGAACATGTGTTAAACGGAACTCACAAGAAGCCAATCGCGCCTACTTGTACAGTACAGATCGCAACGTCGGGCAGTGATGACTCCACCCCCAAGCCCATCCCTATTCTGGCAGCTGCTTTCTGTGCAGACAGACAGTCCCTGCTCATGTTCTATGGCAGCACCTTACAGCCTATCCATTGAGAGAGTGGCGCTGAANAAGCGATGAAACCCAACATTTTGTCTTTATCCGCGACAATCCAAAGACAGTGGTCTCTCAGAAAAGGACATTGCNCTGTAACAAAAGGTGAAAACTCCAATTTGTAAATTCCAGACTTCCAAGGGTTCTAACAACCAGGAAATCCCCAGGTT
  5   1   2       bld Gas9                                 BG409598.5p                                                                                                                                                                                                                                                                                                                                                                                                           CGTGAGGTGGCACCACGAGAACGGTTCCTTGTACAGTTGCTCAGAAGACAAACACATCATTGAATGGAACACACAGACCTGTAAAGTCAAGTGCAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACAGTGCAGCCTCCCCGGGAGTCTCGATCTATCCAAGACACAGCAGGTCTTTATTTCCTGTCCAGCGCTGTGCACGACCGATTGGTCAGCGTATGGCAGGTTCGGTCTGCAAAGGACAAAAGTTCTGTCCTATCCTTCACTCTCACAGAACCACCCATATTCATGGACCTGAGTACAACCGAGAGCAAAGAGGAGCCGCTGAAGCTGGCGGTTGTTTGCCGGGATGGGCAGTTGCACTTATTTGAACATGTGTTAAACGGAACTCACAAGAAGCCAATCGCGCCTACTTGTACAGTACAGATCGCAACCGTCGGGCAGTGATGACTCCACCCCCAAGCCCATCCCTATTCTGGCAGCTGCTTTCTGTGCAGACAAGACAAGTCCCTGCTCATGTTCTATGGCAGCACCTTACAGCCTATCATTGAGAGA
  5   1   2       bld Neu4      out                   IMAGE:4085602.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACAGACCTGTAAAGTCAAGTGTAAATGGAAAGGAGACAACAGCAGCGTCAGCAGTTTGTGCATCAGCCCTGATGGGAAGATGTTGCTGTCGGCGGGAAGAACCATCAAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACCGTGCAGCCTCCCCGGGAGTCTCGGTCTATCCAAGACACAGCAGGTCTTTATTTCCTGTCCAGCGCTGTGCACGACCGATTGGTCAGCGTATGGCAGGTTCGGTCTGCAAAGGACAAAAGTTCTGTCCTATCCTTCACTCTCACAGAACCACCCGTATTCATGGACCTGAGTACTACCGAGAGCAAAGAGGAGCCCCTGAAGCTGGCGGTTGTTTGCCGGGATGGGCAGTTGCACTTATTTGAACATGTGTTAAACGGAACTCACAAGAAGCCAATCGCGCCTACTTGTACAGTACAGATCGCAACGTCGGGCAGTGATGACTCCACCCCCAAGCCCATCCCTATTCTGGCAGCTGCTTTCTGTGCAGAC
  5   1   2       bld Tbd7                                 XL107a16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATNAACTCTGGGATCTGGAGACCAAAGAAGTCTACAGGCAATTTACAGGGCACTCGACCGCAGTCACGTCGCTCATATTCCTGACAGTGCAGCCTCCCCGGGAGTCTCGATCTATCCAAGACACAGCAGGTCTTTATTTCCTGTCCAGCGCTGTGCACGACCGATTGGTCAGCGTATGGCAGGTTCGGTCTGCAAAGGACAAAAGTTCTGTCCTATCCTTCACTCTCACAGAACCACCCATATTCATGGACCTGAGTACAACCGAGAGCAAAGAGGAGCCGCTGAAGCTGGCGGTTGTTTGCCGGGATGGGCAGTTGCACTTATTTGAACATGTGTTAAACGGAACTCACAAGAAGCCAATCGCGCCTACTTGTACAGTACAGATCGCAACGTCGGGCAGTGATGACTCCACCCCCAAGCCCATCCCTATTCTGGCAGCTGCTTTCTGTGCAGACAGACAGTCCCTGCTCATGTTCTATGGCAGCACCTTACAGCCTATCATTGAGAGAGTGGCGCTGAAAAGCGATGAACCCAACATTTGTCTTATCCGCGACATCCAAAAGACAGTGTCTCTCAGAAAGGACATGCCTGTAACAAAGGTGAAAACTCCAGTTGTAAATTCAGACTCGAA
  5   1   2       add Ga15                               XL467f19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCGGTCTGCAAAGGACAAAAGTTCTGTCCTATCCTTCNCTCTCACANAACCACCCGTATTCATGGACCTGAGTACAACCGANAGCAAANANGANCCGCTGAANCTGGCGGTTGTTTGCCGGGATGGGCANTTNCACTTATTTGAACATGTGTTANACNGAACTCAC
  5   1   2       bld DMZ                                  xl231p23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCAGTGATGACTCCACCCCCAAGCCCATCCCTATTCTGGCAGCTGCTTTCTGTGCAGACAGACAGTCCCTGCTCATGTTCTATGGCAGCACCTTACAGCCTATCATTGAGAGAGTGGCGCTGAAAAGCGATGAACCCAACATTTGTCTTATCCGCGACATCCAAAAGACAGTGTCTCTCAGAAAGGACATGCCTGTAACAAAGGTGAAAACTCCAGTTGTAAATTCAGACTCGAAGGTTCTAACACCAGGAATCCCAGGTCACAGCTCGGCAATTTCAGCTGCCTTGGCACATACCAAAAAGCAGGAGAGCAAGAGGAAGCCAGGAGACAATGAGGCCAGCATAGAGGATCGTCTTGGCGCTATGGATATAGACCCCACCAACGTGCCGAGTAAAGGAGCCTTGCCGCAGACTGACAACTTTGCCGTATTGCTGGTGCAAGGCCTGGAAAGCAACGATCTAAACATTCTGAATAAAGTCTTTCAGACCAAAAACGAGTCCTTAATAAGGAAGACTGTGGCCAGGATTCCCGTTTATGCTGTCATCCCCCTGGTGCACGAGCTAACAAGGAGATTACAAGGACATCCTTTGAGTACCATACTGATGGTGAGATGGCTAAAGGCTGTGTTGGTCCTCCATGCTTCCTACCTTTCCACTTTGCCGGACTTGGTCCCACAGCTGGGGATGTTGTACC
  5   1   0       add DMZ       out                        xl311e07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACCAACGTGCCGAGTAAAGGAGCCTTGCCGCAGACTGACAACTTTGCCGTATTGCTGGTGCAAGGCCTGGAAAGCAACGATCTAAACNTTCTGAATAAAGTCTTTCAGACCAAAAACGAGTCCTTAATAAGGAAGACTGTGGCCAGGATTCCCGTTTATGCTGTCATCCCCCTGGTGCACGAGCTAACAAGGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)