Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 26 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012770006 Xl3.1-IMAGE:6868974.5 - 26 ESTs
                                                                       ..-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6868974.5                                           TGCTGTAAGGCGCTGTGCGGTAAAGACAGACCTACGCAGTACGCAAATACCAATTGCAGGGGCGGAAGTGAAAGAACTTTGCATCTGATTGTCGGCTTCTTTGACAGGAAGCCTGGGAAGAAAGAAGCGCCGGCTGAGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGGCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCGGGAATGGGACGTAAAGAAAAGCAGGACATTAAGGAGCTTCTTATTTATTTTACAATGGCTTGACTAATGAAGAGTCTTAACTGGCTATGACTGATGTATGGTGTAATAGAGATTTGTAAGGCTACAGAATTGAAAGGGGTTGAAGGAGTAACCATGGGACAGTTCTGGTACAGACAATGGCAGGAGATGCTGTCCCATCACCGAGACAATAAATTATCACCATTTATTTATGTAGCACCAACAATTTGTTTCTTTTTTAATTTTCTAGAAGGAACCTGCATTAAACTCAGTTTGTCAAATTTTTGTAGCATAGAAACACTTTAATCATCTTATATGAGTTGTATATTGTGGGACAGCGAAGGCAAAAATCAACCCTGGCTCTCTTAATATGCCTAATACTTTTATTCCTATAAAGCCTTATTTTGGGTGAGACTCCACTGCACTTCCTGGTTTGTATGTTGGATGTGTAAATAACAATAACATAGGATTTGATTATATAACATAGTACATGGGGTGCCAGGTGTTCACCCGGTTTTGTTGTAGTACAGTATAAAGCACTAACCATGCATTGCTCACAGCTATGATGTATTAAAGATGGGTATCCTAAAGCCAAAATGTTATTTTAAAAATAAAAATTCTATCATTTATT
                                                  Xl3.1-CHK-1012688667                                                 AAGGCGCTGTGCGGTAAAGACAGACCTACGCAGTACGCAAATACCAATTGCAGGGGCGGAAGTGAAAGAACTTTGCATCTGATTGTCGGCTTCTTTGACAGGAAGCCTGGGAAGAAAGAAGCGCCGGCTGAGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGGCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCGGGAATGGGACGTAAAGAAAAGCAGGACATTAAGGAGCTTCTTATTTATTTTACAATGGCTTGACTAATGAAGAGTCTTAACTGGCTATGACTGATGTATGGTGTAATAGAGATTTGTAAGGCTACAGAATTGAAAGGGGTTGAAGGAGTAACCATGGGACAGTTCTGGTACAGACAATGGCAGGAGATGCTGTCCCATCACCGAGACAATAAATTATCACCATTTATTTATGTAGCACCAACAATTTGTTTCTTTTTTAATTTTCTAGAAGGAACCTGCATTAAACTCAGTTTGTCAAATTTTTGTAGCATAGAAACACTTTAATCATCTTATATGAGTTGTATATTGTGGGACAGCGAAGGCAAAAATCAACCCTGGCTCTCTTAATATGCCTAATACTTTTATTCCTATAAAGCCTTATTTTGGGTGAGACTCCACTGCACTTCCTGGTTTGTATGTTGGATGTGTAAATAACAATAACATAGGATTTGATTATATAACATAGTACATGGGGTGCCAGGTGTTCACCCGGTTTTGTTGTAGTACAGTATAAAGCACTAACCATGCATTGCTCACAGCTATGATGTATTAAAGATGGGTATCCTAAAGCCAAAATGTTATTTTAAAAATAAAAATTCTATCATTTATTAAAAAA
                                                      consensus depths                                                3     4     2     4     3     4     3     4     5     5     5     6     9     9    11    11    11    11    11    11    13    14    14    14    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    16    16    17    17    17    17    17    17    18    18    18    18    18    18    18    18    18    18    18    18    18    17    17    16    17    17    17    17    17    17    17    17    17    16    16    16    16    16    16    17    17    18    18    18    18    19    19    19    19    18    18    16    16    16    16    16    16    16    17    16    17    15    16    15    16    15    16    14    16    12    16    14    16    14    16    13    16    15    17    16    18    15    18    13    18    12    16    11    15    11    14    11    14    10    13     9    13     9    12     9    12     9    11     9    10     9    10     9    10     8    10     8     9     7     9     7     9     7     9     7     9     7     8     7     8     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     4     4     4     4     4     4     3     3     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------A---
                                               BLH ATG     142     975                                           
                                               BLH MIN     142     128                                           
                                               BLH OVR     142    1192                                           
                                               ORF LNG     142      30                                           
  5   1   2       bld Egg3 5x3                        IMAGE:6322973.5p CCCCGGGCGCTTAGTTCGCTTTCATTGGTCTGCTTGTTGGTTTGCTGTAAGGCGCTGTGCGGTAAAGACAGACCTACGCAGTACGCAAATACCAATTGCAGGGGCGGAAGTGAAAGAACTTTGCATCTGATTGTCGGCTTCTTTGACAGGAAGCCTGGGAAGAAAGAAGCGCCGGCTGAGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGTCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCGGGAATGGGACGTAAAGAAAAGCAGGACATTAAGGAGCTTCTTATTTATTTTACAATGGCTTGACTAATGAAGAGTCCTTAACTGGCTATGACTGATGGTATGGGGGTAATAGAAGATTTGGTAAGGGCTACAGGAAATTGAAAAAGGGGGTTTGAAAGGGAGTTAACCCATGGGGGAA
  5   1   2       bld Egg3 5x3                        IMAGE:6868245.5p                               GATTCCCGGGTTTGCTGTAAGGCGCTGTGCGGTAAAGACAGACCTACGCAGTACGCAAATACCAATTGCAGGGGCGGAAGTGAAAGAACTTTGCATCTGATTGTCGGCTTCTTTGACAGGAAGCCTGGGAAGAAAGAAGCGCCGGCTGAGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGTCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCGGGAATGGGACGTAAAGAAAAGCAGGACATTAAGGAGCTTCTTATTTATTTTACAATGGCTTGACTAATGAAGAGTCTTAACTGGCTATGACTGGAGTATGGTGTAAATAGAAATTTGTAAGGCTACAGAATTGAAAAGGGGGTGGAAGGAGTAAAC
  5   1   2       bld Tbd7 5g3  in                         XL070d22.5p                                       GTTTGCTGTAAGGCGCTGTGCGGTAAAGNACAGACCTACGCAGTACGCAAATACCAATTGCAGGGGCGGAAGTGAAAGAACTTTGCATCTGATTGTCGGCTTCTTTGACAGGAAGCCTGGGAAGAAAGAAGCGCCGGCTGAGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGGCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTTGGTGTATCCA
  5   1   2       bld Egg3 5x3                        IMAGE:6322724.5p                                          CCGGGGTAAGGCGCTGTGTCCGTAAAGACAGACCTACGCAGTACGCTTTACCAATTGCAGGGGCGGAAGTGAAAGAACTTTGCATCTGATTGTCGGCTTCTTTGACAGGAAGCCTGGGAAGAAAGAAGCGCCGGCTGAGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGGCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCGGGGAATGGGACGTAAAGAAAAGCAGGACATTAAGGAGCTTCTTATTTATTTTACAATGGCTTGACTAATGAAGAGTCTTAACTGGCTATGACTGATGTATGGTGTAATAGAGATTTGTAAAGGCTACAGAAATTGAAAGGGGGGTTGAAGGAGTTAACCATGGGGACAGTTTCTGGGTACAGAACAATGGGCAAGGA
  5   1   2       bld Egg1 5g3  in                    IMAGE:3300382.5p                                                                                   GCACGAGGACCAATTGCAGGGGCGGAAGTGAAAGAACTTTGCATCTGATTGTCGGCTTCTTTGACAGGAAGCCTGGGAAGAAAGAAGCGCCGGCTGAGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGGCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCANACCGTGCACGTTTGCAAGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAACGATTGGCTGGGGC
  5   1   2       bld Egg3 5x3                        IMAGE:6868974.5p                                                                                                       GATTCCCGGGGAAAGAATTTGCATCTGATTGTCGGCTTCTTTGACAGGAAGCCTGGGAAGAAAGAAGCGCCGGCTGAGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGGCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCGGGAATGGGACGTAAAGAAAAGCAGGACATTAAGGAGCTTCTTATTTATTTTACAATGGCTTGACTAATGAAGAGTCTTAACTGGCTATGACTGATGTATGGTGTAATAGAGATTTGTAAGGCTACAGAATTGAAAGGGGGTGAAGGAGTAACCCTTGGGACCAGTTCTGGCACCGAACAATGGCAAGGCAGAATGCTGTCCCCTCCCCNCGGAAACACCAGATTATCCCCCCCTTTATTTCATGGAAGNACCCAACACAATGGGCGTTCCTTTTTTTAAGTTTTCCAAAAAAGGGGAAACCCGCCCTTTAGAACCTCCCGCCT
  5   1   2       bld Ga12 5g3  in                         XL169k10.5p                                                                                                         CGAGGGTGAAAGAACTTTGCATCTGATTGTCGGCTTCTTTGACAGGAAGCCTGGGAAGAAAGAAGCGCCGGCTGAGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGGCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACT
  5   1   2       bld Brn3 5x3                        IMAGE:8537088.5p                                                                                                                  AAGAACTTTGCATCTGATTGTCGGCTTCTTTGACAGGAAGCCTGGGAAGAAAGAAGCGCCGGCTGAGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGGCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCAGGAATGGGAACGTAAGAAAAGCAGGACATTAAGGAGCTTTCTTATTATTTTACAATGGCTTGACTTATGAAAAGTCTTAACTGGCTATAAATGATGTATGG
  5   1   2       bld Te2N 5x3                        IMAGE:7204681.5p                                                                                                                   AGAACTTTGCATCTGATTGTCGGCTTCTTTGACAGGAAGCCTGGGAAGAAAGAAGCGCCGGCTGAGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGGCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCGGGAATGGGACGTAAAGAAAAGCAGGACATTAAGGAGCTTCTTATTTATTTTACAATGGCTTGACTAATGAAGAGTCTTAACTGGCTATGACTGATGTATGGTGTAATAGAGATTTGNTAAGCTACAGAATTGAAAGGGGTTGAAGGAGTACCATGGGACAGTTCTTGTACAGACCATGGCAGGAGATGCTGTCCCATCACCAAGACAATAAATTAT
  5   1   2       bld FaBN 5g3  in                    IMAGE:8074878.5p                                                                                                                    GAACTTTGCATCTGATTGTCGGCTTCTTTGACAGGAAGCCTGGGAAGAAAGAATCGCCGGCTGAGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGGCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAGAATTTCCAGGAATGGGACGTAAAGAAAGCAGGACATTAAGGAGCTTCTATTTTTTTACATGGCTGACTATGAAGAGTCTACTGCTATACTGAGTAGGTGTATAGAATTGTAGGCTCAGATTGAAG
  5   1   2       bld Egg1 5g                            PBX0166F11.5p                                                                                                                               CTGATTGTCGGCTTCTTTGACAGGAAGCCTGGGAAGAAAGAAGCGCCGGCTGAGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGGCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTG
  5   1   2       bld Ga12 5g                              XL213a13.5p                                                                                                                                                               CGAGGAAGAAGCGCCGGCTGAGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGGCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATT
  5   1   2      seed Tbd2 5x3               IMAGE:3199557-IMAGp.IMAGp                                                                                                                                                                  GAAAGAAGCGCCGGCTGAGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGGCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCGGGAATGGGACGTAAAGAAAAGCAGGACATTAAGGAGCTTCTTATTTATTTTACAATGGCTTGACTAATGAAGAGTCTTAACTGGCTATGACTGATGTATGGTGTAATAGAGATTTGTAAGGCTACA
  5   1   2       bld Tbd2 5g                         IMAGE:3199557.5p                                                                                                                                                                   AAAGAAGCGCCGGCTGAGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGGCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAAAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCG
  5   1   2       bld Tbd7 5g3  in                         XL063d15.5p                                                                                                                                                                                   AGCATCATGGGGTTGCTGACTATCCTAAAGAAAATGAANCAGAAGGAACGGGAGGTTCGGCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTNANCATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAA
  5   1   2       bld Egg5                   IMAGE:3431082-IMAGp.IMAGp                                                                                                                                                                                                       TATCCTAAAGAAAATGAAGCAGAAGGAACGGGAGGTTCGGCTGCTCATGCTAGGTTTAGATAATGCCGGTAAAACAACCATACTGAAGAAGTTTAATGGCGAGGATATCAACACCATTTCACCAACGCTTGGATTCAACATCAAAACGCTGGAGCACAGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCGGGAATGGGACGTAAAGAAAAGCAGGACATTAAGGAGCTTCTTATTTATTTTACAATGGCTTGACTAATGAAGAGTCTTAACTGGCTATGACTGATGTA
  5   1   2       bld Egg1                               PBX0128C04.5p                                                                                                                                                                                                                                                                                                                                                      GAATTCTGCACGAGGGAGGATTTAAGCTGAACATGTGGGATGTGGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTTGATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTTGCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCAGGAATGGGACGTAAAGAAAAGCAGGACATTAAGGAGCTTCTTATTTATTTTACAATGGCTTGACTAATGAAGAGTCTTAACTGGCTGTGACTGATGTATGGTGTAATAGAGATTTGTAAGGCTACAGAATTGAAAGGGGTTGAAGGAGTAACCATGGGACA
  3   1   2       bld FaBN 5g3  in                    IMAGE:8074878.3p                                                                                                                                                                                                                                                                                                                                                                                      AATGTGGGATGTGGTGGTCAGAAGTCCTTGCGTTCATACTGGAGAAATTACTTTGAGAGCACCGATGGTTGAATCTGGGTGGTGGACAGCGCAGACCGTGCACGTTGNCAGGATTGTGCTCAAGAACTATCTGGGCTGCTACTGGAAGAGCGATTGGCTGGGGCGACATTACTTGTATTCGCCAACAAACAAGATTTGCCTGGAGCCTTATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCAGGAATGGGACGTAAAGAAAAGCAGGACATTAAGGAGCTTCTTATTTATTTTACAATGGCTTGACTAATGAAGAGTCTTAACTGGCTATGACTGATGTATGGTGTAATAGAGATTTGTAAGGCTACAGAATTGAAAGGGGTTGAAGGAGTAACCATGGGACAGTTCTGGTACAGACAATGGCAGGAGATGCTGTCCCATCACCGAGACAATAAATTATCACCATTTATTTATGTAGCAACAACTTATTTGTTTCTTTTTTAATTTTTGAGGTCGCACCCGAATTAAAGGCTAGTTAGTAAAATATGTGTTGGGCAGAAACAGTGAGCTCATGGTTGATTGAGGCCTACGCTGTCCCACGAGAAGCAACTCATACACGATGACTATAGTGATCGACGCACAAAAANTACAAACTTGTACCTGTTTTTTTT
  5   1   2       bld Eye1                            IMAGE:4756971.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGATTTGCCTGGAGCCTTATCTAAAGATTTTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCAGGAATGGGACGTAAAGAAAAGCAGGACATTAAGGAGCTTCTTATTTATTTTACAATGGCTTGACTAATGAAGAGTCTTAACTGGCTATGACTGATGTATGGCGTAATAGAGATTTGTAACGCTACAGAATTGAAAGGGGTTGAAGGAGTAACCATGGGACAGTTCTGGTACAGACAATGGCAGGAGATGCTGTCCCATCACCGAGACAATAAATTATCACCATTTATTTATGTAGCAACAACAAATTTGTTCTTTTTTAATTT
  3   1   2       bld Ga12 5g3  in                         XL169k10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCTAAAGATGCTATCAAAGAGGCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCGGGAATGGGACGTAAAGAAAAGCAGGACATTAAGGAGCTTCTTATTTATTTTACAATGGCTTGACTAATGAAGAGTCTTAACTGGCTATGACTGATGTATGGTGTAATAGAGATTTGTAAGGCTACAGAATTGAAAGGGGTTGAAGGAGTAACCATGGGACAGTTCTGGTACAGACAATGGCAGGAGATGCTGTCCCATCACCGAGACAATAAATTATCACCATTTATTTATGTAGCACCAACAATTTGTTTCTTTTTTAATTTTCTAGAAGGAACCTGCATTAAACTCAGTTTGTCAAATTTTTGTAGCATAGAAACACTTTAATCATCTTATATGAGTTGTATATTGTGGGACAGCGAAGGCAAAAATCAACCCTGGCTCTCTTAATATGCCTAATACTTTTATTCCTATAAAGCCTTATTTTGGGTGAGACTCCACTGCACTTCCTGGTTTGTATGTTGGATGTGTAAATAACAATAACATAGGATTTGATTATATAACATAGTACATGGGGTGCCAGGTGTTCACCCGGTTTTGTTGTAGTACAGTATAAAGCACTAACCATGCATTGCTCACAGCTAT
  5   1   2       bld Egg1      in                    IMAGE:4678140.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGATGGAGTTGGACAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCAGGAATGGGACGTAAAGAAAAGCAGGACATTAAGGATCTTCTTATTTATTTTACAATGGCTTGACTAATGAAGAGTCTTAACTGGCTATGACTGATGTATGGTGTAATAGAGATTTGTAAGGCTACAGAATTGAAAGGGGTTGAAGGAGTAACCATGGGACAGTTCTGGTACAGACAATGGCAGGAGATGCTGTCCCATCACCGAGACAATAAATTATCACCATTTATTTATGTAGCACCAACAATTTGTTTCTTTTTTAATTTTCTAGAAGGAACCTGCATTAAACTCAGTTTGTCAAATTTTTGTAGCATAGAAACACTTTAATCATCTTATATGAGTTG
  3   1   2       bld Tbd7 5g3  in                         XL070d22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTGACTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCGGGAATGGGACGTAAAAGAAAAGCAGGACATTAAGGAGCTTCTTATTTATTTTACAATGGCTTGACTAATGAAGAGTCTTAACTGGCTATGACTGATGTATGGTGTAATAGAGATTTGTAAGGCTACAGAATTGAAAGGGGTTGAAGGAGTAACCATGGGACAGTTCTGGTACAGACAATGGCAGGAGATGCTGTCCCATCACCGAGACAATAAATTATCACCATTTATTTATGTAGCACCAACAATTTGTTTCTTTTTTAATTTTCTAGAAGGAACCTGCATTAAACTCAGTTTGTCAAATTTTTGTAGCATAGAAACACTTTAATCATCTTATATGAGTTGTATATTGTGGGACAGCGAAGGCAAAAATCAACCCTGGCTCTCTTAATATGCCTAATACTTTTATTCCTATAAAGCCTTATTTTGGGTGAGACTCCACTGCACTTCCTGGTTTGTATGTTGGATGTGTAAATAACAATAACATAGGATTTGATTATATAACATAGTACATGGGGTGCCAGGTGTTCACCCGGTTTTGTTGTAGTACAGTATAAAGCACTAACCATGCATTGCTCACAGCTATGATGTATTAAAGATGGGTATCCTAAAGCCAAAATGTTATTTTAAAAATAAAAATTCNATCA
  3   1   2       bld Tbd7 5g3  in                         XL063d15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGTATTGATTGGTTGTTGGATGATATTTCCAGCCGCATCTTTACAGCTGATTAAAGAATTTCCGGGAATGGGACGTAAAGAAAAGCAGGACATTAAGGAGCTTCTTATTTATTTTACAATGGCTTGACTAATGAAGAGTCTTAACTGGCTATGACTGATGTATGGTGTAATAGAGATTTGTAAGGCTACAGAATTGAAAGGGGTTGAAGGAGTAACCATGGGACAGTTCTGGTACAGACAATGGCAGGAGATGCTGTCCCATCACCGAGACAATAAATTATCACCATTTATTTATGTAGCACCAACAATTTGTTTCTTTTTTAATTTTCTAGAAGGAACCTGCATTAAACTCAGTTTGTCAAATTTTTGTAGCATAGAAACACTTTAATCATCTTATATGAGTTGTATATTGTGGGACAGCGAAGGCAAAAATCAACCCTGGCTCTCTTAATATGCCTAATACTTTTATTCCTATAAAGCCTTATTTTGGGTGAGACTCCACTGCACTTCCTGGTTTGTATGTTGGATGTGTAAATAACAATAACATAGGATTTGATTATATAACATAGTACATGGGGTGCCAGGTGTTCACCCGGTTTTGTTGTAGTACAGTATAAAGCACTAACCATGCATTGCTCACAGCTATNATGTATTAAAGATGGGTATCCTAAAGCCAAAATGTTATTTTAAAAATAA
  3   1   2       bld Egg1      in                    IMAGE:4678140.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTACAATGGCTTGACTAATGAAGAGTCTTAACTGGCTATGACTGATGTATGGTGTAATAGAGATTTGTAAGGCTACAGAATTGAAAGGGGTTGAAGGAGTAACCATGGGACAGTTCTGGTACAGACAATGGCAGGAGATGCTGTCCCATCACCGAGACAATAAATTATCACCATTTATTTATGTAGCACCAACAATTTGTTTCTTTTTTAATTTTCTAGAAGGAACCTGCATTAAACTCAGTTTGTCAAATTTTTGTAGCATAGAAACACTTTAATCATCTTATATGAGTTGTATATTGTGGGACAGCGAAGGCAAAAATCAACCCTGGCTCTCTTAATATGCCTAATACTTTTATTCCTATAAAGCCTTATTTTGGGTGAGACTCCACTGCACTTCCTGGTTTGTATGTTGGATGTGTAAATAACAATAACCTAGGATTTGATTATATAACATAGTACATGGGGTGCCAGGTGTTCACCCGGTTTTGTTGTAGTACAGTATAAAGCACTAACCATGCATTGCTCACAGCTATGATGTATTAAAGATGGGTATCCTAAAGCCAAAATGTTATTTTAAAAATAAAAATTCTATCATTTATTAAGAAA
  3   1   2       bld Egg1 5g3  in                    IMAGE:3300382.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGACTAATGAAGAGTCTTAACTGGCTATGACTGATGTATGGTGTAATAGAGATTTGTAAGGCTACAGAATTGAAAGGGGTTGAAGGAGTAACCATGGGACAGTTCTGGTACAGACAATGGCAGGAGATGCTGTCCCATCACCGAGACAATAAATTATCACCATTTATTTATGTAGCAACAACAATTTGTTTCTTTTTTAATTTTCTAGAAGGAACCTGCATTAAACTCAGTTTGTCAAATTTTTGTAGCATAGAAACACTTTAATCATCTTGTATGAGTTGTATATTGTGGGACAGCGAAGGCAAAAATCAACCCTGGCTCTCTTAATATGCCTAATACTTTTATTCCTATAAAGCCTTATTTTGGGTGAGACTCCACTGCACTTCCTGGTTTGTATGTTGGATGTGTAAATAACAATAACATAGGATTTGATTATATAACATAGTACATGGGGTGCCAGGTGTTTACCCGGTTTTGTTGTAGTACAATATAAAGCACTAACCATGCATTGCTCACAGCTATGATGTATTAAAGATGGGTATCCTAAAGCCAAAATGTTATTTTAAAAATAAAAATTCTATCATTTATTAAAAAAAA
  5   1   2       bld Egg1                               PBX0131A09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGACAGTTCTGGTACAGACAATGGCAGGAGATGCTGTCCCATCACCGAGACAATAAATTATCACCATTTATTTATGTAGCACCAACAATTTGTTTCTTTTTTAATTTTCTAGAAGGAACCTGCATTAAACTCAGTTTGTCAAATTTTTGTAGCATAGAAACACTTTAATCATCTTATATGAGTTGTATATTGTGGGACAGCGAAGGCAAAAATCAACCCTGGCTCTCTTAATATGCCTAATACTTTTATTCCTATAAAGCCTTATTTTGGGTGAGACTCCACTGCACTTCCTGGTTTGTATGTTGGATGTGTAAATAACAATAACCTAGGATTTGATTATATAACATAGTACATGGGGTGCCAGGTGTTCACCCGGTTTTGTTGTAGTACAGTATAAAGCACTAACCATGCATTGCTCACAGCTATGATGTATTAAAGATGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)