Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 95%

 1012770032 Xl3.1-xlk78h17ex.3 - 42 ESTs
                                                                       .........-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xlk78h17ex.3                              CATCCATTCGATTCCGGCTCGGGGGGCGCAGGCGATTCCACTGGTTCCATCTCCCGGGGGAGCCGAGTCCGCGGAGACATTTGAGCAGGAAGTGAAGCCCGAGGCACCGGGAGGAGGAGGCGAGTCACAACAGGGCTCAGCGAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGCGGACGAGGAGGAGGAGGAGTATGTGGTGGAGAAGGTCTTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTCGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTGTTTGTTTGTTTTTTAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCAATGTAAAGTAATTCTTAGTGTTTTGTCAGTCTGTCGTTGTAATAAAACTTTTAGATTTAT
                                                  Xl3.1-CHK-1012687089                                    TTCGATTCCGGCTCGGGGGGCGCAGGCGATTCCACTGGTTCCATCTCCCGGGGGAGCCGAGTCCGCGGAGACATTTGAGCAGGAAGTGAAGCCCGAGGCACCGGGAGGAGGAGGCGAGTCACAACAGGGCTCAGCGAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGCGGACGAGGAGGAGGAGGAGTATGTGGTGGAGAAGGTCTTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTCGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTGTTTGTTTGTTTTTTAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCAATGTAAAGTAATTCTTAGTGTTTTGTCAGTCTGTCGTTGTAATAAAACTTTTAGATTTATAAAAAA
                                                      consensus depths                                   3     5     4     7     6    10     9    13     9    15     9    15     9    15     9    15     9    15    11    15    11    15    12    15    13    15    14    15    14    15    14    15    14    15    14    15    15    16    16    16    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    17    16    17    16    17    16    18    16    18    16    18    15    18    15    20    17    20    18    20    18    20    18    20    18    21    17    21    20    21    19    21    21    21    20    23    20    23    22    24    21    26    21    25    21    25    22    27    21    27    20    27    22    27    24    31    25    33    23    31    20    31    24    29    24    28    23    28    22    28    23    28    23    29    21    29    21    28    20    27    20    27    21    27    20    25    20    24    21    24    20    24    20    23    20    23    20    23    20    22    21    22    21    22    19    21    22    23    21    23    22    23    22    22    22    22    21    22    22    22    21    22    22    22    22    22    22    22    22    22    21    22    22    22    20    22    20    21    19    21    10    21    10    21    10    21    10    21    10    21    10    21    10    21    10    21    12    21    14    21     8    20     7    20     7    17     4    10     3     9     2     6     3     5
                                                                   SNP                                                                                                                                                                                                                                                                              ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----T---G---
                                               BLH ATG     165     561                              
                                               BLH MIN     123      98                              
                                               BLH MPR      84      98                              
                                               BLH OVR     165     429                              
                                               EST CLI     -29       5                              
                                               ORF LNG     165      12                              
  5   1   2       bld Eye1 5x3                        IMAGE:7019627.5p GCGGCAGCTCCTTTTGTTTGGAGGCGCCACATCCATTCGATTCCGGCTCGGGGGGCGCAGGCGATTCCACTGGTTCCATCTCCCGGGGGAGCCGAGTCCGCGGAGACATTTGAGCAGGAAGTGAAGCCCGAGGCACCGGGAGGAGGAGGCGAGTCACAACAGGGCTCAGCGAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGCGGACGAGGAGGAGGAGGAGTATGTGGTGGAGAAGGTCTTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTCGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCCGAGGAGGACGACCAGAAAGACGAGAAAAATTAAAGTGGCCCCCTCCCTTCACCAACCCATCACAGTTAGCGGGGGGAGACATATCCCGCCAGTTCACTCCCACCTGAATGAAGGAAAGGGGGGAAGAACCCCTGGCCAGGATTTCCGTCTGGC
  5   1   2       bld Em10 5x3                        IMAGE:7982771.5p      GCCCTTTTGTTTGGAGGCGCCCATCCATTCGATTCCGGCTCGGGGGGCGCAGGCGATTCCACTGGTTCCATCTCCCGGGGGAGCCGAGTCCGCGGAGACATTTGAGCAGGAAGTGAAGCCCGAGGCACCGGGAGGAGGAGGAGGCGAGTCACAACAGGGCTCAGCGAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGCGGACGAGGAGGAGGAGGAGTATGTGGTGGAGAAGGTCTTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCAGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGGAGCCAACGNTAAGTGGCCCCAGGTGGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTNNCTACCTTCAGAGGAGGACGACNAGAAGACGAGAAAATTAAAGTGCCCCCTCC
  5   1   2       bld Thy  5g3  in                    IMAGE:8550644.5p        AAAGACAATTAAATGATTATCTCGCCACGAATTCGTCCCCTCGGGGGGCGCAAGCGATTCCACTGGTTCCATCTCCCGGGGGAGCCGAGTCCGCTGAGACATTTGAGCAGGAAGTGAAGCCCGAGGCACCGGGAGGAGGAGGCGAGTCACAACAGGGCTCAGCGAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGCGGACGAGGAGGAGGAGGAGTATGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTGGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGAGGAGCATGCAGATTCAGTCTGTCCTGGTATCCCGGGACGACGCACAGACAGGAGACTCTGCATCTACAGctctctctctctcCCATATGTACAGACTCTGTTTGTACTGATAGCATGTCTGTATGACTGAGATAGACGAAGAGAACCTGCGGCGAGGGGGCTTTCAATTCTGGACCTGCACAGAGCAAGTCAACAAAACTGTCGCAATCCGA
  5   1   2       bld Ga15 5g3  in                       XL420d21ex.5p                   TGGAGGCGCCACATCCATTCGATTCCGGCTCGGGGGGCGCAGGCGATTCCACTGGTTCCATCTCCCGGGGGAGCCGAGTCCGCGGAGACATTTGAGCAGGAAGTGAAGCCCGAGGCACCGGGAGGAGGAGGCGAGTCACAACAGGGCTCAGCGAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGCGGACGAGGAGGAGGAGGAGTATGTGGTGGAGAAGGTCTTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCANAGAGGATCATTGGTGCCACAGACTCCANCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCNGATGAANCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCANGTCGTGATTTCNTTCTATGANGANANGCTGACGTGGCATTCTTACCCTTCA
  5   1   2       bld Emb9 5x3                        IMAGE:7977353.5p                       GGCGCCACATCCATTCGATTCCGGCTCGGGGGGCGCAGGCGATTCCACTGGTTCCATCTCCCGGGGGAGCCGAGTCCGCGGAGACATTTGAGCAGGAAGTGAAGCCCGAGGCACCGGGAGGAGGAGGCGAGTCACAACAGGGCTCAGCGAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGCGGACGAGGAGGAGGAGGAGTATGTGGTGGAGAAGGTCTTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTCGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCCGCCAGTCACTCACACTTGAGTGAGGAAAGGGGGAGGAAGCATAGCTGGAATCCTCGTCCGGGTATCCTGGGGCATGTTATCCTACATACTC
  5   1   2       bld Ga18      in                       xlk78h17ex.5p                                   CATCCATTCGATTCCGGCTCGGGGGGCGCAGGNATTCCACTGGTTCCATCTCCCGGGGGAGCCGAGTCCGCGGAGNNATTTGAGCAGGAAGTGAAGCCCNANNNNCGGGANNGGAGGCGAGTCACAACAGGGCTCAGCNNNNNNTAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGNTGCGGACGAGGAGGAGGAGGAGTATGTGGTGGAGAAGGTCCTGGANCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAANNNAAGGNGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGNCCCGTGGNTTTNCCCGTGGACTGGAANCAGAGAGGNTCATTGGTGCCACAGACTCCAGCGGGGAGNTGATGTTCCTTATGAAATGGAAAANCTCGGATGAAGCCGANCTTGTCCCGGCCAAGGAAGNCAACGTAAAGNGCCCCCAGGTGGTGATTNNGTTCTATGAGGAGAGGNTGACGTGGCATTCNTNNNCNTCAGAGG
  5   1   2       bld Tbd7 5g                              XL078m07.5p                                      CGATTCCGGCTCGGGGGGCGCAGGCGATTCCACTGGTTCCATCTCCCGGGGGAGCCGAGTCCGCGGAGACATTTGAGCAGGAAGTGAAGCCCGAGGCACCGGGAGGAGGAGGCGAGTCACAACAGGGCTCAGCGAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGCGGACGAGGAGGAGGAGGAGTATGTGGTGGAGAAGGTCTTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGAC
  5   1   2       chi Ga15      in                       XL500p02ex.5p                                                  CTCCCCTCGTGCCTCACATTCACGCCCCCANGCCANCGATATTGGTTTGTCTTTACACTTCTATGGGATTTTACATTGAGCAAAAGTCCAGCGCTGGTGTCAGTGAACATGAATGCTCANCGAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCATAACAAGAAAAAGATGGAAGAGGTTGCGGACGAGGAGGAGGAGGAGTATGTGGTGGAGAAGGTCTTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTCGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCANAGGAGGACGACAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTANCGGGTGAGACATATCCGCCANTCACTCACACCTGANTGAGGAAG
  5   1   2       chi Egg3 5x3                        IMAGE:6326004.5p                                                    GATTCCCCGGGCGATTCCCTGGTTCCATCTCCCGGGGGAGCCGAGTCCGCGGAGACATTTGAGCAGGAAGTGAAGCCCGAGGCACCGGGAGGAGGAGGCGAGTCACAACAGGGCTCAGCGAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGCGGACGAGGAGGAGGAGGAGTATGTGGTGGAGAAGGTCTTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGTCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTCGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACCCTGNATGAGGGGAAAAGGGGGGAGGAACCCATGGCAGGGATTCAGTCCTGTCCCTGGGTATTCCCGGGGGGAACGGACGCCACAGAACCGGGAGGGAAACTCTGGCATCCCTACCAGGCTCCCTCCCCTCTTTCCCTCCTTTC
  5   1   2       bld DMZ  5g3  in                         xl239l13.5p                                                    GGGGCGCAGGCGATTCCACTGGTTCCATCTCCCGGGGGAGCCGAGTCCGCGGAGACATTTGAGCAGGAAGTGAAGCCCGAGGCACCGGGAGGAGGAGGCGAGTCACAACAGGGCTCAGCGAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGCGGACGAGGAGGAGGAGGAGTATGTGGTGGAGAAGGTCTTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTGGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGA
  5   1   2       bld Lmb1 5x3                        IMAGE:8535435.5p                                                          GGCGATTCCCTGGTTCCATCTCCCGGGGGAGCCGAGTCCGCGGAGACATTTGAGCAGGAAGTGAAGCCCGAGGCACCGGGAGGAGGAGGAGGCGAGTCACAACAGGGCTCAGCGAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGCGGACGAGGAGGAGGAGGAGTATGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAATGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTGGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACNAGAAAGATGAGAAAAATAAAGTGCCCCTNCCTTTCACACCATCGGCAGTTAGCGGTGAGACTATCCGCAGTCACTCCACTGATGAGGAGGGGAGAGCATGCAGATCATCGTCTGTATCGGGACGACCACGAAGAGACTTGCTCTAAGC
  5   1   2       bld DMZ  5g3  in                         xl287e05.5p                                                            GGCGATTCCACTGGTTCCATCTCCCGGGGGAGCCGAGTCCGCTGAGACATTTGAGCAGGAAGTGAAGCCCGAGGCACCGGGAGGAGGAGGCGAGTCACAACAGGGCTCAGCGAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGCGGACGAGGAGGAGGAGGAGTATGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCANAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCANAGGGCGGGAAACGCANGGCGGATTCNGACACGGAGGTCGGGGAGGAGAACAAACCCNAGAAAAANAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCANAGAGGATCATTGGTGCCACAGACTCCANCGGGGAGCTGATGTTCCTTATGAAATGNAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCANTGAAGCCAACGTAAAGTGCCCCCAGGTGGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTA
  5   1   2       bld Em10 5x3                        IMAGE:8322344.5p                                                             GGCGATTCCCTGGTTCCATCTCCCGGGGGAGCCGAGTCCGCGGAGACATTTGAGCAGGAAGTGAAGCCCGAGGCACCGGGAGGAGGAGGCGAGTCACAACAGGGCTCAGCGAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGCGGACGAGGAGGAGGAGGAGTATGTGGTGGAGAAGGTCTTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTCGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACNAGAAAGACGAGAAAAATTA
  5   1   2       bld DMZ  5g3  in                         xl279l11.5p                                                                   CACTGGTTCCATCTCCCGGGGGAGCCGAGTCCGCGGAGACATTTGAGCAGGAAGTGAAGCCCGAGGCACCGGGAGGAGGAGGCGAGTCACAACAGGGCTCAGCGAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGCGGACGAGGAGGAGGAGGAGTATGTGGGTGGAGAAGGTCTTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTCGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACNAGAAAGACGAGA
  3  -1   2       bld Bla2      in                    IMAGE:7296927.3p                                                                    CATTCACGCCCCCAGCCAGCGATATTGGTTTGTCTTTACACTTCTATGGGATTTTACATTGAGCAAAAGTCCAGCGCTGGTGTCAGTGAACAGAATGCTCAGCGAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGCGGACGAGGAGGAGGAGGAGTATGTGGTGGAGAAGGTCTTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAGGAAGCAACGTAAGTGCCCCAGGTGGTGATTCGTTCATAGGAGAGCTGACTGCATTCTACCTTCAAGGAGACACAGAAGATGAAAATAGGTGCCCTCCTCACACATCAAGTACGGTAACTTCGCGTCTCCCTGATGAGAGGAGACTGAGATACTTCGTTCGGAGACCAAGAGATGACAATCCTTACTCAAGTAACATGAG
  5   1   2       bld Ga15      in                       XL517c14ex.5p                                                                                                                                                                                                                                                 TCCGGGAGGAGGAGTATGTGGTGGAGAAGGTCTTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTGCTCAAATGGAAAGGCTTCTCTAACGAGGACAACACCTGGGAGCCAGAGGAGAACTTGGACTGTCCCGATCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTCGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCANGATTCNNTCTGTCCTGGTATCCCGGGGACNGACNCACANACAGGANGAACTCTGCATCCTACNANCTCCTCCTCTTCCTCATTCCCCATANTGTTACANACTCTGTATTGTTACT
  5   1   2       bld Neu7                                 XL037e01.5p                                                                                                                                                                                                                                                                                                                                                                              CTGTCCCGNTCTCATCGCCGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGACAAGTCAGAGGGCGGGAAACGCAAGGCGGATTCGGACACGGTAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGTAAGCCCCGTGGTTTTGCCCGTGGCACTGGCAACCAGCAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTCGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCC
  3   1   2       bld Ga18      in                       xlk78h17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                             CNGNAGTCNNAAAAATCCGCGTNCNANTCGNNNNAGTCAGAGGNCGGGAANNNNANGNNGGNTTCGGACNCGNANGTCGGGGAGNNGAANANCCCAAGAAAAAGAAGGNCGAAGNAGAGAANNCCNGTGNTTTTGCCCGTGGACTGGNACCAGAGAGGATCANTGGTGCCACAGACNCNAGCGGGGAGCTGATNTNCCTTATGAAATGGAAANCCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTGGTGNTTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGATGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGAAAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGANCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCNNCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCAGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCAAACAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTGTTTGTTTGTTTTTTTAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCAATGTAAAGTAATTCTTAGTGTTTTGTCANTCNGTC
  5   1   2       bld Neu7      in                         XL015e16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGGGAAACGCAAGGCGGATTCGGACACGGAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTCGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCAGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCC
  5   1   2       bld Neu7      in                         XL018k04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACGCAAGGCGGATTCGGACACGGNAGGTCGGGGAGGAGAACAAACCCAAGAAAAAGAAGGACGAAGCAGAGAAGCCCCGTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTCGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGG
  5   1   2       bld Ga15      in                       XL417o20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACGAAGCAGAGAAGCCCCGCTGGTTTTGCCCGTGGACTGGAACCAGAGAGGATCATTGGTGCCACAGACTCCAGCGGGGAGCTGATGTTCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTCGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGANTAGCATGTCCTGTAGTGACTGATGATGANACGGAANAGACCACTGCGGGGCANAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCANATCCTGAACTCNCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCNTTGCTGATTGGGGGGGTCTCCCNGNANGCANGAATCTAATGCANGTGCTNATCCCNTT
  3   1   2       bld Thy  5g3  in                    IMAGE:8550644.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGNAGATCATGTGCACGACTCAGCGGGAGTGATGTCCTTTGAAATGAAACTCGATGAAGCCGACCTGTCCCGCCAAGGAAGCCAACGTAAATGCCCCCAGTGGTGATTTCGTTCTATGAGGAGAGGCTGACGTGCATTCTTACCTTCNAGAGGAGGACGACAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAACAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGGTTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCAAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTGTTTGTTTGTTTTTTAAAGAAAAAGCCATGTGTTTTAGGTCTGTGCAACGTTCGTCTCACTGTAAAGTACTTCACAGTGAGACAAACTTGCACAACCTAACACACTCTAAAAAT
  3   1   2       bld Ga15      in                       XL517c14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGACTCCAGCGGGGAGNTGATGTTCCCTTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTCGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCATTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCCAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTGTTTGTTTGTTTTTTTAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCAATGTAAAGTAATTC
  3   1   2       bld Spl                             IMAGE:8463077.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATGAAAAATAAAAAAATAAAGAAATAAATAGAAAAGAGAAATAACGATAAAAAGACAAAATAGATATTTGAGGACAAGAAACACTAGGAGATACAAAAAAAAATAAGTAAAACAAGAGGAAAGTGAATAGAATTAGAGAAATACATGAGTATAACAAAATGACCGGAATATAGAGAAAGGTTATACAAATTAATAAATAAATTAAGTGAATGATATATAGGAAAGCAAAATGTAGTGATATCAAAAAAAGTTAATTGATAGATTGAATACAGCAGAAAGCAGCACCAGTCATAATAAAATAGAAATCAAACCAAAGCACATATGATCGTCCTTACCAATACTGTTAACAGAGTGGGTATTGATAAAGAGTAGCATGTCCAGTAGTGAATGATGATGTGACGGAAGAGACCATTGCGGGGCAGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGATGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTGTTTGTTTGTTTTTTAAAGAAAAAGACATGTGTTTTAGGTCTGTCTCAATGTAAAGTAATTCTTAGTGTTTGTCAGTCGTCGTGTAAAAACTA
  3   1   2      seed DMZ  5g3  in                         xl279l11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTATGAAATGGAAAACCTCGGATGAAGCCGACCTTGTCCCGGCCAAGGAAGCCAACGTAAAGTGCCCCCAGGTCGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCAGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGTCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTGTTTGTTTGTTTTTTAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCAATGTAAAGT
  5  -1   2       bld Bla2      in                    IMAGE:7296927.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCACGATCAGCGGAGTGTGTCNTAGAATGAAACTCGATGAGCGACTGTNCNGCAGANNGCAACGTAAGTGCCCCAGTGTGATTCGTCTTGAGAGAGCTGACGTGCATTCTACCCTTCAGAGAGGACGACAGAAAGATGAGAAAAATAAAGTGCCCCCTCCCTTCACCAACCATCGAAAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCAAACAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAgttttttgtttgtttgtttttttAAAGAAAAACGCATGTGTTTTAGGTCTGTCTCAATGTAAAGTAATTCTTAGTGTTTTGTCAGTCTGTCGTTGTAATAAAACTTTTAGATTTATaaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCATCGCCTATGAATGCC
  3   1   2       bld DMZ                                 rxl320n21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAAGGAAGCCAACGTAAAGTGCCCCCAGGTGGTGATTTCGTTNTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGATGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCAAACAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTTGTTTGTTTGTTTTTTTAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCAA
  3   1   2       bld DMZ  5g3  in                         xl239l13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGGAAGCCAACGTAAAGTGCCCCCAGGTGGTGATTTCGTTCTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGATGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGAAAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTGTTTGTTTGTTTTTTAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCAATGTAAAGTAATTCT
  3   1   2       bld Ga15      in                       XL500p02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCATTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCCAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTGTTTGTTTGTTTTTTTAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCAATGTAAAAGTAATTCTTAG
  3   1   2       bld DMZ  5g3  in                         xl287e05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTATGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGATGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCAGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCCAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTGTTTGTTTGTTTTTTTAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCAATGTAAAGTA
  3   1   2       bld Ga15 5g3  in                       XL420d21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGGAGGAGGCTGACGTGGGCATTNTTACCCTTCAGAGGGAGGANGACAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCATTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCCAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTGTTTGTTTGTTTTTTTAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCAATGTAAAGTAATTCTTA
  3   1   2       bld DMZ                                 rxl237h24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAGGAGAGGCTGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAANGATGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCAAACAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTTGTTTGTTTGTTTTTTTAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCA
  3   1   2       bld Ga15      in                       XL417o20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CNGACGTGGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCAGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTGTTTGTTTGTTTTTTAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCAATGTAAAGTAATTCTTAGTGTTTGTC
  3   1   2       bld Ga12      in                         XL215f14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGCATTNTTACCCTTCAGAGGAGGACGACAAGAAAGATGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCAGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCCAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTGTTTGTTTGTTTTTTTAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCAATGTAAAGTAATTCTTAGTGTTTTGTCAGTCTGTCGTG
  5   1   2       bld Ga12      in                         XL215f14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCATTCTTACCCTTCAGAGGAGGACGACAAGAAAGATGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCAGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCCAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGAtttgtagttttttgtttgtttgtttttttAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCAATGT
  3   1   2       bld Neu7      in                         XL015e16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TNCAGAGGAGGACGACAAAGAAAGACGAGAAAAATTAAAGTGCCCCCTCCCTTCACCAACCATCGACAGTTAGCGGGTGAGACATATCCGCCAGTCACTCACACCTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCAGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTGTTTGTTTGTTTTTTAAAGAAAAAGCATGTGTTTTAGGTGCTGTCTCAATGTAAAGTACATTACTTAGTGNTTTGTCAGTGCTGTCGANTGTAATANA
  3   1   2       bld Neu7      in                         XL018k04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTGAGACATATCCGCCAGTCACTCACACTTGAGTGAGGAAGGGGGAGGAGCCATGCAGGATTCAGTCTGTCCTGGTATCCCGGGGACGGACGCACAGACAGGAGGAACTCTGCATCCTACAAGCTCCTCCTCTTCCTCCTTCCCAATAGTGTTACAGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCAGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTGTTTGTTTGTTTTTTAAAGAACAAAGCATGTGTTTTAGGTCTGTGCTCAATGTAAAGTCATTCTTAGTGNTTTGTCAGTGCTGTCGTTGTAATAA
  5   1   2       bld Ga15      in                       XL454n10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGACTCTGTATTGTTACTGAGTAGCATGTCCTGTAGTGACTGATGATGAGACGGAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCAGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCAAACAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGAtttgtagttttttgtttgtttgtttttttAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCAATGTAAAGTAATTCTTAGTGTTTTGTCAGTCTGTCGTTGTAATAAAACTTTTAGATTTATaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL438j12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGAtttgtagttttttgtttgtttgttttttAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCAATGTAAAGTAATTCTTAGTGTTTTGTCAGTCTGTCGTTGTAATAAAACTTTTAGATTTATaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL438j12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGAGACCACTGCGGGGCGGAGGGGGGCTTTCAAATCACTTGGGACCCTGCAACGAGGCAAAGTCTAACCAATAGCTGCAGATCCTGAACTCGCCCTTTGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCGGGAGGCAGGAATCTAATGCAGGTGCTGATCCCATTTTCTAACACATCCCCCAAACCAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGTGACTACATACAGGATCATTGTATAAACTGTCAGATTTGTAGTTTTTTGTTTGTTTGTTTTTTAAAGAAAAAGCATGTGTTTTAGGTCTGTCTCAATGTAAAGTAATTCTTAG
  3   1   2       bld Ga15      in                       XL454n10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTNGGCCCCTGTACAAGAACGGTTTTTGGGAATCTCGTTGCTGATTGGGGGGGTCTCCCAGGAGGCAGGAATCTAATGCAGGGTGCTGATCCCATTTTCTAACACATCCCCCAAACAGAATTCCTACACGCTGAGGCCCACGAGGTCTCTGCCATCACGCTGNGACTACATACAGGATCATNGTATAAACTGTCAGATTNGTAGTTTTTTGTTTGTTTGTTTTTTTAAAGAAAA
  3   1   0       add Brn1                            IMAGE:4740139.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGTGCTGATCCCATTTTTTTTTTTTTTTAACACTTTACCCCCAAATGAGAATTTCTTCAAGCTGAGGCCCCCGGGGACTCCGCCATCACGCTGTGACTACAGAATCATTGTATAAACTGTCAGATTTGTAGTTTTTCCTTTTTTTAAGAGAAAAAAGCATGTGTTTTAGGTTTGTGCAAACTTTGTCTCAATGTAAAGTAATTATTAGCGTTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGATTTATAATTCATCGTCGCCGTTTCCTACGCCCACAACTATCCACTATCTGGTTCCTAGGCACCTATTTACCCTAGCAACCAGCCGGCGACTACAATGATAGCCTGGCATATGAACAGTAGAGGATACAAATAATTGATACAATGTAACAAGCACTAATTAATAATAAACAGGGAACTCTGAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)