Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-PBX0061H07.5                          9 END     2           5       22                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6637483.5.5                    65 PI      76        296      819                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6866568.5.5                    31 PI      86         17      499                MGC69373 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 97%

 1012770091 Xl3.1-IMAGE:6316129.5 - 35 ESTs
                                                                       ....-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6316129.5                                                       CCTTGCTCTTGTGAGTAACTTGGCGTTCGCTCTCAGCAGCTTCCACACGTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACTTTTTTTTTTTTTAAATAATTTCTGAGCTTGATCATCTGAGAAAGAAGAGCAAGTATTAAGGGAAGAGGCAGGTTGGAAACATACATAGAAATAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATGCTGAAGCTGATGGAGATGGTGTAGATGAGGAGGAAGAAGATGAAGAGGGTGAAGAGGAGGAAGAAGATGAAGAGGAGGAAGGTGAAGAGGAAGAAGATGTAGATGATGAAGATGATGATGAAGATGAAGAGGAGCTAGCAGAAGAAGACGATGAAGAGGATGGCAGTGGTGAGGAAGAGGAAGAAGACTTTGGACATGATGGAGAAGTAGATGAAGAAGATGATGAGGATGATGAAGAAGAGGATGAAGAAGAAGAAGAATCTGGCAAAGGAGAGAAAAGAAAGAGAGACACAGA
                                                  Xl3.1-CHK-1012687559                                                             TCTTGTGAGTAACTTGGCGTTCGCTCTCAGCAGCTTCCACACGTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACTTTTTTTTTTTTTAAATAATTTCTGAGCTTGATCATCTGAGAAAGAAGAGCAAGTATTAAGGGAAGAGGCAGGTTGGAAACATACATAGAAATAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATGCTGAAGCTGATGGAGATGGTGTAGATGAGGAGGAAGAAGATGAAGAGGGTGAAGAGGAGGAAGAAGATGAAGAGGAGGAAGGTGAAGAGGAAGAAGATGTAGATGATGAAGATGATGATGAAGATGAAGAGGAGCTAGCAGAAGAAGACGATGAAGAGGATGGCAGTGGTGAGGAAGAGGAAGAAGACTTTGGACATGATGGAGAAGTAGATGAAGAAGATGATGAGGATGATGAAGAAGAGGATGAAGAAGAAGAAGAATCTGGCAAAGGAGAGAAAAGAAAGAGAGA
                                                      consensus depths                                                            3     5     4     6     7    11    10    13    13    17    14    20    14    22    16    23    16    23    18    23    18    24    18    24    18    25    18    25    17    24    10    16    12    17    11    16    13    18    12    18    14    17    16    18    17    18    16    18    17    18    17    18    17    18    17    19    19    19    19    19    20    20    20    20    22    22    22    22    22    22    22    22    23    23    23    23    23    23    23    23    22    23    23    23    22    23    22    22    22    23    20    23    22    23    20    23    20    23    20    23    21    23    21    23    20    22    20    22    20    22    20    22    20    22    20    22    17    20    17    19    17    19    17    19    16    19    17    19    15    19    14    18    12    17    12    17    10    16    10    15     9    14     7    13     6    11     7    11     6    10     5     8     6     8     6     8     5     8     5     8     4     8     4     8     3     7     4     6     3     6     2     6     3     6     2     5     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                           ---A-A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                   ----A-------
                                               BLH ATG     295     910                                                       
                                               BLH MIN     295     127                                                       
                                               BLH OVR     295     832                                                       
                                               EST CLI      13       6                                                       
                                               ORF LNG     295      39                                                       
  5   1   2       chi Egg3                            IMAGE:6868797.5p TCCCGGGCCCGGGGGCTTTTCTTTTTTCTCCCTCTCCCCTCCATGGTTTCTCCTCCTTGCTCTTGTGAGTAACTTGGCGTTCGCTCTCAGCAGCTTCCACACGTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACtttttttttttttAAATAATTTCTGAGCTTGATCATCTGAGAAAGAAGAGCAAGTATTAAGGGAAGAGGAAGGTTGGAAACATACACAGAAATAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAAACAACTTAAATGACTACGGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGAACAAAGAAGCCCCCGACTCTGATGCTGAACCTGATGGAAATGGTGTTANATGAGGAGGAAGAGAATGAAAGGGTGGAAAAGGAGGAAAAAAATTAANAAGAGGAAGGGG
  3  -1   2       bld Ga11                            IMAGE:3475188.3p                               AGCTCAGAATAAACGCTCAACTTTGGCAGATCTGAATTCCCCGGGGGCGTTCGCTCTCAGCAGCTTCCACACGTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACTTTTTTTTTTTTTAAATAATTTCTGAGCTTGATCATCTGAGAAAGAAGAGCAAGTATTAAGGGAAGAGGCAGGTTGGAAACATACATAGAAATAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGA
  5   1   2       bld Ga12                                 XL198h17.5p                                            ACGAGGCTCCTCCTTGCTCTTGTGAGTAACTTGGCGTTCGCTCTCAGCAGCTTCCACACGTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACttttttttttttNAAANAATTTC
  5   1   2       bld Ga18 5g                            xlk63b18ex.5p                                                GTTTCTCCTCCTTGCTCTTGTGAGTAACTTGGCGTNNNNNTCAGCAGCTTCCACACGTTTTCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACtttttttttttttAAATAATTTCTGAGCTTGATCATCTGAGAAAGAAGAGCAAGTATTAAGGGAAGAAGAAGGTTGGAAACATACATAGAAAAAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACANCAGAATCTCTGGAGGTNTAGATGTACTNGCAGAAAAACTATCCNATCTCACACATCNNATCTCAGTNGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTNGANCTATTCAACTGTGAAGNAACANNCTTAAATGACTACAGAGAAAGCGTTTTCAAGCT
  5   1   2       bld Ga12                                 XL205d20.5p                                                  CTCCTCCTTGCTCTTGTGAGTAACTTGGCGTTCGCTCTCAGCAGCTTCCACACGTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACttttttttttttNAAANA
  5   1   2       bld Ga15      in                       XL422e13ex.5p                                                              CTTGTGAGTAACTTGGCGTTCGCTCTCAGCAGCTTCCACACGTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACtttttttttttttAAANANTTTCNGA
  5   1   2       bld Te2  5g                         IMAGE:7211602.5p                                                                    TCCCCGGGAATNNTCCCGGGATGCAGCTTCCACACGTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACtttttttttttttAAATAATTTCTGAGCTTGATCATCTGAGAAAGAAGAGCAAGTATTAAGGGAAGAGGCAGGTTGGAAACATACATAGAAATAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATGCTGAGCTGatggagatggtgtagatgaggaggagaagatgaagagggtgaggagaggagaAATGTAANNAGAGAAGTGGAAAAGAAGAGATGTTTATGATGAAATGATTATgaggagaaaagactacaaaaagaaatgaaaagagggcggggggtggggaaaggaaaaattttgtcttttgtgggttttttaaaattttgagggtgtgttt
  5   1   2       bld Ga15                               XL481c24ex.5p                                                                    AGTAACTTGGCGTTCGCTCTCAGCAGCTTCCACACGTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACttttttttttttNAAATAATTTCNG
  5   1   2       bld Ooc1 5g                           xlnoc002i24.5p                                                                     TAACTTGGCGTTCGCTCTCAGCAGCTTCCACACGTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACtttttttttttttAAATAATTTCTGAGCTTGATCATCTGAGAAAGAAGAGCAAGTATTAAGGGAAAGAGGCAGGTTGGAAACATACATAGAAATAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACTATCTAATCTCAGTGGGAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTTGAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTTAATGACTACAGAGAAAGCGTTTTC
  5   1   2       bld Ga15                               XL463f07ex.5p                                                                     GTAACTTGGCGTTCGCTCTCAGCAGCTTCCACACGTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACtttttttttttttttAAANAATTT
  5   1   2       bld Ga12                                 XL153l10.5p                                                                              GGCGTTCGCTCTCGCAGCTTCCCACGTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACtttttttttttttAAAT
  5   1   2       bld Ga12                                 XL179d20.5p                                                                                    GCACGAGGAGCTTCCACACGTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACtttttttttttt
  5   1   2       bld Tail                            IMAGE:8546341.5p                                                                                      CTCAGCAGCTTCCACACGTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACtttttttttttttAAATCATTTCTGAGCTTGATCATCTGAGAAAGAAGAGCAAGTATTAAGGGAAGAGGAAGGTTGGAAACATACATAGAAATAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAGCTCCTCCCTCACTGACTTACTGGATGGTATGACAGAGAGACAAGAGGCCCAGATCTGAGCTGAGCTGATGAATGTGTAAtgagaagagaaaganaggtgagagagaganaganagagaggtanaganaATTNTGATAATATGTAATAAGACTCAANAACATAAGT
  5   1   2       bld Neu7                                 XL049p21.5p                                                                                            GGCAGCTTCCCACGTTTTCTATATCCGAGAGGGTGTTCAGATTGTCTCCTTCCTTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACttttttttttttAAATAATT
  5   1   2       bld Emb1 5g                         IMAGE:6635082.5p                                                                                             AGCTTCCACACGTTTTCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACttttttttttttAAATAATTTCTGAGCTTGATCATCTGAGAAAGAAGAGCAAGTATTAAGGGAAGAAGAAGGTTGGAAACATACATAGAAAAAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTTCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATGCTGAAGCTGATGGAGATGGTGTANATGAGGGAGGAGAAGATGAagagggttgagaaggagggaanaagatgaagaggaggaaaggtgaaaagggaagaagatgganatgatggaagatgatgatgaaagatgaaA
  5   1   2       bld Ov1  5g                         IMAGE:6316129.5p                                                                                                   ACACGTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACtttttttttttttAAATAATTTCTGAGCTTGATCATCTGAGAAAGAAGAGCAAGTATTAAGGGAAGAGGCAGGTTGGAAACATACATAGAAATAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATGCTGAAGCTGATGGAGATGGTGTANATGAGGAGGAAAAAATgaagaggtggaagaggaggaagaagatgaanaggaggaaagtgggaaaaggaagaagatgtannatggatgaagatgatgatggaaaatggaagAGG
  5   1   2       bld DMZ                                  xl251g07.5p                                                                                                    CACGTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACtttttttttttttAAAAAATTTCNGANCTNGATCATCTGANAAANAA
  5   1   2       bld Ga18 5g                           xlk123h11ex.5p                                                                                                        GTTTGCTATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACtttttttttttttAAATAATTTCTGAGCTTGATCATCTGAGAAAGAAGAGCAAGTATTAAGGGAAGAGGCAGGTTGGAAACATACATAGAAATAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAANTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGNNNAAGAGGCCCCAGANTCTGATGCTGAAGC
  5   1   2       bld DMZ                                  xl296b05.5p                                                                                                             TATATCCAGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACttttttttttttAAATAATTTCNGAGCTNGATCATCTGANAAANAANAGCANGTNTTAAGGGAANAGGCNGGTNGGAAACATACNTA
  5   1   2       bld Ga12                                 XL151n05.5p                                                                                                              GTATATCCGNGAGGGTGTTCAGATTGTCTCCTTCCTTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACtttttttttttttAAATAATTT
  5   1   2       bld Emb4 5g                         IMAGE:5514977.5p                                                                                                                     AGAGAGGGTGTTCACATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACttttttttttttAAATAATTTCTGAGCTTGATCATCTGAGAAAGAAGAGCAAGTATTAAGGGAAGAAGAAGGTTGGAAACATACATAGAAAAAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTNCACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATGCTGAAGCTGATGGAGATGGTGTAGATGAGGAGGAAGAAGATGAGAGGGG
  5   1   2       bld Ooc1 5g                           xlnoc003f13.5p                                                                                                                       AGAGAGGGTGTTCAGATTGTCTCCTTCCATTAAAGACCCCTCGGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACtttttttttttAAATAATTTCTGAGCTTGATCATCTGAGAAAGAAGAGCAAGTATTAAGGGAAGAAGAAGGTTGGAAACATACATAGAAAAAGATCGGCTGGGGAACAAAACATAACAGATTCAGCCTGCTGGACATTGAAGAAAGAATCTACCTGGCGCTCATGACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCANATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTATCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAGATAACATCAAAGACATTAGCACATTGGAACCTCTGAAAAATTTG
  5   1   2       bld Ga18      in                      xlk139j20ex.5p                                                                                                                                    GATTGTCTCCTTCCATTAAAGACCCCTCGGCTGCTCCTTTGCAAGCACAGAGCGCACTCTTCAACCTCCCTCCCCCTCCCCTACAAACttttttttttttAAATAATTTCTGAGCTTGATCATCTGAGAAAGAAGAGCAAGTATTAAGGGAAGAAGAAGGTTGGAAACATACATAGAAAAAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGNTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGNCAAAGAGGCCCCAGANTCTGATGCTGAANCTGATGGAGNNGGNNTAGATNAGGAGGAAGAAGANGAAGAGGNTGAAGANGANGA
  3   1   2       bld Ga18      in                      xlk139j20ex.3p                                                                                                                                                                            AGCACAGANNNNNCTCTTNAACCTCCNNNCCCCCTNCCCTNNAANCNTTTTTTTTTTNNNNATNNTTTCTGAGCTNGATCATCTGAGAAAGANGAGCNAAGTNTTANGGGAAGAAGAAGNTNGNAAACATACATAGAAAAAGATCGGCTGGGGAACAAAAAATAACAATNNCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGNNCAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTNCCGGGCGCATGAAGGCAAAATAGAGGNTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAANCTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATNCTGAAGCTGATGGAGATGGTGTAGATGAGGAGGAAGAAGATGAAGAGGGTGAAGAGGAGGAAGAAGATGAAGAGGAGGAAGGTGAAGAGGAAGAAGATGTAGATGATGAAGATGATGATGAAGATGAAGAGGAGCTAGCAGAAGAAGACGATGAAGAGGATGGCAGTGGTGAGGAAGAGGAAGAAGACTTTGGACATGATGGAGAAGTAGATGAAGAAGATGATGAGGATGATGAAGAAGAGGATGAAGAAGAAGAAGAATCTGGCAAAGGAGAGAAAAGAAAGAGAGACACAGACGANNAA
  5   1   2       bld Oo1  5g                         IMAGE:6641229.5p                                                                                                                                                                                                   GCCGCCCtttttttttttttttttttGTCTTAGNCAAAACAATTCCTCGAGCTTGATCATCTGAGAAAGAAGAGCAAGTATTAAGGGAAGAGGCAGGTTGGAAACATACATAGAAATAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACCAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATGCTGAAGCTGATGGAGATGGTGTANATGAGGAGgaagaagatgaagagggtgaagaggaggaagaagatgaagaggaggaaggtgaaaaggaagaacatgtanatgatgaagatgatgatgaagatgaaaaggagctagcagaagaagacgatgaaaagGATGGCAGTGGTGAGGGAAAAGAAGAACAACTTTGGAcatgatggagaagtagatgaaaaaaatgatgaggaatgatgaaccaagaggatgaagaaagAAGAAGAAATCCTGCGCAAGGGCGGAGGAAAAGGAAAGACAAGACACCCT
  5   1   2       bld Skin 5g                         IMAGE:8640506.5p                                                                                                                                                                                                                                                     CAATTTAAATTGGCAGATCTACTTACGATTAAGATTCGTCCCGGCAGGTTGGAACATACATAGAAATAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTTCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATGCTGAAGCTGATGGAGATGGTGTAGAtgaggaggaagaagatgaagagggtgaagaggaggaagaagatgaagaggaggaagtgaagaggagagatgtagatgatgaagatgatgatgagatgagaggagctagcagagagacgatgagagatggcagtgttgagaagagaagaagactttggacttgatggaaagttgatgagagatgatgaggatgatgagagaggatTG
  5   1   2       bld Ga12 5g3  out                        XL195c14.5p                                                                                                                                                                                                                                                                             CAAGTATTAAGGGAAGAGGCAGGTTGGAAACATACATAGAAATAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGATAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTAGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATGCTGAAGCtgatggagatggtgtagatgaggaggaagaagatgaagagggtgaagaggaggaagaagatgaagaggaggaaggtgaagaggaaga
  5   1   2       bld Ga12 5g                              XL196c14.5p                                                                                                                                                                                                                                                                             CAAGTATTAAGGGAAGAGGCAGGTTGGAAACATACATANAAATAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGATAACAGAATCTCTGGAGGTCTAGATGTACTANCANAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTAGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATGCTGAAGCTGATGGAGATGGTGTAG
  5   1   2      seed Tbd7 5g                              XL100e13.5p                                                                                                                                                                                                                                                                                                             GAGGCAGAAATAGATCGGCTGGGGAACAAAAAATAACAATTCCAGCAAGATGGACATGAAAAAAAGAATTCACCTGGAGCTCAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATGCTGAAGCTGATGGAGATGGTGTagatgaggaggaagaagatgaagagggtgaagaggaggaagaagatgaagaggaggaagGTGAAG
  3   1   2       bld DMZ                                 rxl292b19.3p                                                                                                                                                                                                                                                                                                                                                                                           GCTCAGGANCAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATGCTGAAGCTGATGGAGATGGTGTAGATGAGGAGGAAGAAGATGAAGAGGGTGAAGAGGAGGAAGAAGATGAAGAGGAGGAAGGTGAAGAGGAAGAAGATGTAGATGATGAAGATGATGATGAAGATGAAGAGGAGCTAGCAGAAGAAGACGATGAAGAGGATGGCAGTGGTGAGGAAGAGGAAGAAGACTTTGGACATGATGGAGAAGTAGNTGAAGANGATGATGAGGATGATGAAGAAGACGGATNAAGAAGAAGAATCTGGCAAAGGCGAGNAANNAAAGA
  3   1   2       bld Ga15      in                       XL422e13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                    GTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATGCTGAAGCTGATGGAGATGGTGTAGATGAGGAGGAAGAAGATGAAGAGGGTGnAGAGGAGGAAGAAGATGAAGAGGAGGAAGGTGAAGAGGAAGAAGATGTAGATGATGAAGATGATGATGAAGATGAAGAGGNNCTAGCAGAAGAAGACGATGAAGAGGATGGCAGTGGTGAGGAAGAGGAAGAAGACTTTGGACATGATGGAGAAGTAGATGnAGAAGATGATGAGGATGATGAAGAAGAGGATGAAGAAGAAGAAGAATCTGGCAAAGGAG
  3   1   2       bld DMZ                                 rxl236a23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATGCTGAAGCTGATGGAGATGGTGTAGATGAGGAGGAAGAAGATGAAGAGGGTGAAGAGGAGGAAGAAGATGAAGAGGAGGAAGGTGAAGAGGAAGAAGATGTAGATGATGAAGATGATGATGAAGATGAAGAGGAGCTAGCAGAAGAAGACGATGAAGAGGATGGCACTGNTGAGGAAGAGGAAGAAGACCTTTGGACATGATGGAGAAGTAGNTGAAGANGATGATGAGGATGATGAAGAAGACGGATNAAGAAGAAGAATCTGGCAAAGGAGAGNAAAGNAAGNG
  3   1   2       bld Ga12                                 XL201m09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTTCTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTNTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATNTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGANTACAGAGAAAGCGTNTTCAAGCTCNTCCCTC
  5   1   2       bld Egg1      out                   IMAGE:3300955.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCACGAGGTCAGCTTAATAAATGTCTTATTGATGTCCGTCTCAAATCTTCCAAAACTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTAGATGTACTAGCAGAAAAACTATCCAATCTCACACATCTAAATCTCAGTGGAAATAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATGCTGAAGCtgatggagatggtgtagatgaggaggaagaagatgaagagggtgaagaggaggaagaagatgA
  5   1   2       chi Ga15                               XL477j04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAAAATGAGACAGATGGCCTTTCAGTAAAACGTCCTGCAGAAGAGGAGGAGGAAACTGAAACTAAAAAATCAAAGACATTAGCACATTGGAACCTCTGAAAAAATTTGAGACTTTGAAGAGCCTGGACCTATTCAACTGTGAAGTAACAAACTTAAATGACTACAGAGAAAGCGTTTTCAAGCTCCTCCCTCAACTGACTTACCTGGATGGGTATGACAGAGAGGACAAAGAGGCCCCAGACTCTGATGCTGAAGctgatggagatggtgtagatgaggaggaagaagatgaagagggtgaagaggaggaagaagatgaagaggaggaaggtgaagaggaagaagatgtagatgatgaagatgatgatgaagatgaagaggagctagcagaagaagacgatgaagaggatgGCAGTGGTGAGGAAGAGGAAGANGACTTTGGACNTGatggagaagtagatgaagaagatgatgaggatgatgaagaagaggatgaNNAANAAGAANAATCTGGCANAGGAGAGAANAGAAAGAGAGACACAGACNATGAAGGTGACGAANANGATGACTAAGGACAAAAACAANANAATAANGAAAATGAAATGATAAAGGACCTTAATGGATTATATGGNATTGATTGAACTGGCCCCACCCATGGATTATTGATAAGCAGGTTTCNAAGTCATAGTGATTTATAACAAGCCCCTTGTCCTTGAACTCCCACGAGCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)