Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:8075225.5                       7 END     1           1       14                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-rxl282b19.3.5                        23 PI      89         86     1015                Unknown (protein for IMAGE:7806534) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 97%

 1012770132 Xl3.1-IMAGE:7296900.5 - 51 ESTs
                                                                       .........-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7296900.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGCCCTTTGTCAAATTCTTCCCCCACACCCACCCGCTGGCAGAGCAGTGACAAAATCCCAATGTGTCTGAGTTAATAGTAAAAAGTCTGCCTTCTCTGGCTCCAGCTGCTGTTTCGGAATCCTGCTCCCCGAGGGACTTCTTTGTGCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGCTGCAGAGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAAGATCGGATATTGGAATTGGAAGGGGAGAACTTTCAGAGAGAAGAGAAAGAACAGAAACTGCACCAGATCAACAAGGACCTGACAAAAAAGATATACTCTCTGGAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCAGAGAGAGTCCTGTTTCCTTAAGGCAGAGAGGAAGTGGCGTCTAGAAATGGAAAAGTTAAATGCACGAATAAAAGTGTTACAGGATGATAATGGCCAGTTGTCTCAGTCTGTCACAGCTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTCCTTGAAACGGCCGAGAGTCTGGAGACGGAGCGGGAGAGGAGCAGGATGTGGGAAGAGGCCCTGAATCAGCAAAGAGAAGCTTGGCAACGTGAAAGGCAGGAGGCAGCACAGCTGGTTGAAGATCTGCGATGTGAGCTTAGCAGGTTCCAGAGCACAGACTGCGAGCTGCAATGCTGTGATGATACGGGAAGTACCCACAGCCTCTGGGAAGAGTGTGAAATGGAGAAGCAGAGACTGGCAGATGAGAATCAAAGTCTACGGGAAATGAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCTCACACAGAACCCATGGAGAGGACTCTCATTCCAAGCCAAGTTCTCCTGTCCACACCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGACGCCTGCGCCAGTATCTAGATCGTGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTATGAGCCATTGATTGAGTGTTGGGAAGATTATAGTTGGGTAGTAAATACATGTTTTGTTTTTTTTAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTGTTTCACACAATCCTAAAGTCCCAATTTAATACATAGCCACTTTTTTTTTTTACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGAAGTCATTGATATTAAATATATATTGAATGTGC
                                                  Xl3.1-CHK-1012686642                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTTGTCAAATTCTTCCCCCACACCCACCCGCTGGCAGAGCAGTGACAAAATCCCAATGTGTCTGAGTTAATAGTAAAAAGTCTGCCTTCTCTGGCTCCAGCTGCTGTTTCGGAATCCTGCTCCCCGAGGGACTTCTTTGTGCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGCTGCAGAGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAAGATCGGATATTGGAATTGGAAGGGGAGAACTTTCAGAGAGAAGAGAAAGAACAGAAACTGCACCAGATCAACAAGGACCTGACAAAAAAGATATACTCTCTGGAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCAGAGAGAGTCCTGTTTCCTTAAGGCAGAGAGGAAGTGGCGTCTAGAAATGGAAAAGTTAAATGCACGAATAAAAGTGTTACAGGATGATAATGGCCAGTTGTCTCAGTCTGTCACAGCTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTCCTTGAAACGGCCGAGAGTCTGGAGACGGAGCGGGAGAGGAGCAGGATGTGGGAAGAGGCCCTGAATCAGCAAAGAGAAGCTTGGCAACGTGAAAGGCAGGAGGCAGCACAGCTGGTTGAAGATCTGCGATGTGAGCTTAGCAGGTTCCAGAGCACAGACTGCGAGCTGCAATGCTGTGATGATACGGGAAGTACCCACAGCCTCTGGGAAGAGTGTGAAATGGAGAAGCAGAGACTGGCAGATGAGAATCAAAGTCTACGGGAAATGAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCTCACACAGAACCCATGGAGAGGACTCTCATTCCAAGCCAAGTTCTCCTGTCCACACCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGACGCCTGCGCCAGTATCTAGATCGTGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTATGAGCCATTGATTGAGTGTTGGGAAGATTATAGTTGGGTAGTAAATACATGTTTTGTTTTTTTTAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTGTTTCACACAATCCTAAAGTCCCAATTTAATACATAGCCACTTTTTTTTTTTACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGAAGTCATTGATATTAAATATATATTGAAxNxGxCAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       2     2     2     3     3     5     4     5     6     7     7     8     7     8     7     8     7     8     7     9    10    12    13    14    14    14    15    15    16    16    16    16    16    16    17    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    17    18    18    18    18    18    18    18    18    18    18    18    17    18    17    18    16    18    17    18    16    18    17    18    17    18    17    18    17    18    16    17    15    16    15    16    15    16    14    16    15    16    13    16    13    15    15    17    15    17    15    17    15    17    16    18    16    18    16    18    14    16    14    16    14    16    13    16    14    16    14    16    13    16    14    16    14    16    14    16    10    14    10    14     9    13     9    13     9    13     9    13     9    14    11    15     8    15     9    15     9    15     8    14     8    14     8    14     8    12     8    12     8    12     9    13     9    13     9    13     9    15    10    15    11    17    12    16    12    17    13    19    11    19    13    19    13    19    15    19    14    18    13    18    13    18    12    18    15    20    13    20    17    21    14    20    16    23    16    22    15    21    15    22    14    21    14    21    16    23    16    24    17    25    17    25    15    25    17    26    15    25    16    25    16    25    24    27    19    27    21    27    21    27    20    26    20    26    20    26    17    26    19    26    19    25    20    25    20    26    20    25    19    24    19    24    19    23    16    22    12    21    18    21    15    21    16    21    17    21    17    20    17    20    17    19    17    19    17    19    16    19    16    19    15    18     7    11     5     8     5     8     3     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --C---------
                                               BLH MIN      97      93                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH OVR     160     397                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               ORF LNG     160      67                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sp ---- 2e-014     XP_001194381.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ag ---- 9e-019     XP_311501.4 AGAP010445-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 6e-020     NP_001034011.1 nuclear fallout CG33991-PA, isoform A [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PREDICTED - Gg ---- 7e-038     XP_425379.2 PREDICTED: similar to KIAA1821 protein [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN --- Mm ---- 2e-038     NP_780752.1 Rab11-FIP4-like [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Bt ---- 5e-039     XP_585093.3 PREDICTED: similar to rab11-family interacting protein 4 [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                 PREDICTED - Cf ---- 6e-040     XP_548279.2 PREDICTED: similar to RAB11 family interacting protein 4 (class II) [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PROTEIN --- Hs ---- 5e-040     NP_116321.2 rab11-family interacting protein 4 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Dr ---- 7e-041     XP_685891.3 PREDICTED: similar to RAB11 family interacting protein 4 (class II), partial [Danio rerio] ----------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Xl ==== 0          NP_001090052.1 hypothetical protein LOC735126 [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 0          AAI58362.1 Unknown (protein for IMAGE:7806534) [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7296900.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGA------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------TGA---------------TAG---------------ATG------------TAA------TGA------TAG---TAATAA------------ATG---------------------------------------------------TGATGA------TGA---------------ATG------------------------------TAA------------------------------------------------------------TAG---------------------------------------------------------------------------------------ATG------TAA---ATG---------------------------------------TGA---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073687.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACGCGTCCGATCAAGCTTACCCTCTGCCCTTTGTCAAATTCTTCCCCCACACCCACCCGCTGGCAGAGCAGTGACAAAATCCCAATGTGTCTGAGTTAATAGTAAAAAGTCTGCCTTCTCTGGCTCCAGCTGCTGTTTCGGAATCCTGCTCCCCGAGGGACTTCTTTGTGCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGCTGCAGAGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAAGATCGGATATTGGAATTGGAAGGGGAGAACTTTCAGAGAGAAGAGAAAGAACAGAAACTGCACCAGATCAACAAG
  5   1   2       bld Egg3 5g                IMAGE:3378168-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTTCCCCGGGGTCTGCCCTTTGTCAAATTCTTCCCCCACACCCACCCGCTGGCAGAGCAGTGACAAAATCCCAATGTGTCTGAGTTAATAGTAAAAAGTCTGCCTTCTCTGGCTCCAGCTGCTGTTTCGGAATCCTGCTCCCCGAGGGACTTCTTTGTGCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCATTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGCTGCAGAGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAAGATCGGATATTGGAATTGGAAGGGGAGAACTTTCAGAGAGAAGAGAAAGAACAGAAACTGCACCAGATCAACAAGGACCTGACAAAAAAGATATACTCTCTGGAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCAGAGAGAGTCCTGTTTCCTTAAGGCAGAGAGGAAGTGGCGTCTAGAAATGGAAAAGTTAAATGCACGAATAAAAGTGTTACAGGATGATAATGGCCAGTTGTCTCAGTCTGTCACAGCTCTCAATGCCCAGAACAGAGTCCTGGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTCCTTGAAACGGGCCGAGAGTCTGGGAGACGGAGCGGGGAGAGGAGCAGGATGTGGGGAAGAGGCCCTGACTCAGCAAAGAGAAAGCTTGGGCAACGTGAAAGGCAGGAGGCGG
  5   1   2       bld Ga18 5g3  in                       xlk62e03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTGTCAAATTCTTCCCCCACACCCACCCGCTGGCNGAGNNTGACAAAATCCCAATGTGTCTGAGTTAATAGTAAAAAGTCTGCCTTCTCTGGCTCCAGCTGCTGTTTCGGAATCCTGCTCCCCGAGGACTTCTTTGTGCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGNTGCAGAGTACATGACAGCTGTNNCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAAGATCGGATATTGGAATTGGAAGGGGAGAANTTTCAGAGAGAAGAGAAAGAACANAAACTGCACCAGATCAACAAGGACCTGACAAAAAAGATATACTCTCTGGAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCAGAGAGAGTCCTGTTTCCTTAAGGCAGAGAGGAAGNGGNGTCTAGAAATGGAAAAGTTAAATGCACGAATAAAAGNNTTNCAGGANGATAATGGCCAGTTGTCTCAGTCTGTCACAGCTCTCAATGCCNA
  5   1   2       bld Egg3 5g3  in                    IMAGE:3378168.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCCCCCACACCCACCCGCTGGCAGAGCAGTGACAAAATCCCAATGTGTCTGAGTTAATAGTAAAAAGTCTGCCTTCTCTGGCTCCAGCTGCTGTTTCGGAATCCTGCTCCCCGAGGGACTTCTTTGTGCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCATTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGCTGCAGAGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAG
  5   1   2       bld Ooc2 5g                         IMAGE:3747302.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAATTCCCCCACCCGCTGGCAGAGCAGTGACAAAATCCCAATGTGTCTGAGTTAATAGTAAAAAGTCTGCCTTCTCTGGCTCCAGCTGCTGTTTCGGAATCCTGCTCCCCGAGGGACTTCTTTGTGCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGTATAAGGAGCAGCAGCTGCAGAGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATC
  5   1   2       chi Ov1  5x                         IMAGE:6316655.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGACGCGGGGGTGACAAAATCCCAATGTGTCTGAGTTAATAGTAAAAAGTCTGCCTTCTCTGGCTCCAGCTGCTGGTTCGGGATCCTGGTCCCCGAGGGACTTCTTTGTGCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGGTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGGGAGGTTGATGGGGGGTAAGGAGGAGCAGCTGCAGAGTACATGACAGCTGTGGCTGTGACCTTTCCAGCATGGACCCGGGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGGTTTTTGGGAGATCGGATATTGGAATTGGAAGGGGAGAACTTTCAGAGAGAAGAGAAAGAACAGAAACTGCACCAGATCAACCAGGACCTGACAAAAAAGAAATACTCTCCTGGAAGAGCAGATCCAGGGAACCAGAAGCCTGCCACCTGGGAGGAAGAGAAAAGGGAAAATTCTTTCTCCAGAGAGAGTCATGGTTTCCTTTAAGGGACCAGAGGAAGTGGGAGTACTAAACAATGGGAAAAATTAAAATGGCCCCACATAACAAGGGTCACAGGGATGCATAATGGCCCCGCCCGCTCCCCAAAACTGACGACCACTCCCCAATCGCCCCACACCCagaagctcctggaaaaaaagaaaggacaaagaccttggaggaaagtcgaaagacaaaagaaAACACGAACCAAAAGCCCTGGGGCGAGGGGAAGCCAAACCGACCCGCGTCCGGCAGGCGGGATAACCAT
  5   1   2       bld Ooc2 5g3  in                    IMAGE:3746943.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGAGCAGTGACAAAATCCCAATGTGTCTGAGTTAATAGTAAAAAGTCTGCCTTCTCTGGCTCCAGCTGCTGTTTCGGAATCCTGCTCCCCGAGGGACTTCTTTGTGCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGGGGTGGGTNCATGCAGCATAAGGAGCAGCAGCTGCAGAGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTG
  3  -1   2       bld Bla2      in                    IMAGE:7296900.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAATGTGTCTGAGTTAATAGTAAAAAGTCTGCCTTCTCTGGCTCCAGCTGCTGTTTCGGAATCCTGCTCCCCGAGGGACTTCTTTGTGCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGNAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGCTGCAGGGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAAGATCGGATATTGGAATTGGAAGGGGAGAACTTTCAGAGAGAAGAGAAAGAACAGAAACTGCACCAGATCACAAGGACCTGACAAAAAGAATACTCTCTGGAGAGCAGTCCAGGACAGAGCTGCACTGGAGGAGAGAAAGGGAATTTTCTCAAGAGATCTGTTCCTAGGCGAAGGAGTGCGTCTAAATGAAAGTATGCCGATANATGTCGGTATATGCAGTGTCTCTCGCCACTTCATGCAGACATCTGAAAATCAACTGTATATCTGACGCAATTGACGACGAGCNGTGGAACTATCAGATGCTAGAGNC
  5   1   2       bld Ga18 5g                           xlk149l09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTGGCTCCAGNTGCTGTTTCGGAATCCTGCTCCCCGAGGACTTCTTTGTGCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGCTGCAGGGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAGGATCGGATATTGGAATTGGAAGGGGAGAACTTTCAGAGAGAAGAGAAAGAACAGAAACTGCGCCAGATCAACAAGGACCTGACAAAAAAGATATACTCTCTGGAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCAGAGAGAGTCCTGTTTCCTTAAGGCAGAGAGGAAGTGGCGTCTAGAAATGGAAAAGTTAAATGCACGAATAAAAGTGTTACAGGATGATAATGGCCAGTTGTCTCAGTCTGTCACAGCTCTCAATGCNCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGNCCTTGAAACGGCCGAGAGTCTGGAGACGGAGCGGGAGAGGAGCAGGNNGTGGGAAGAGGNCCTGAATCAGCAAAGAGAAGCTNNNNACGTGAAAGGCAGGAGNNAGCACANCTNNNTGAAGATCTNCGATGTGAGCTTAGNAGGGTCCNGAGCACAGACTGCGAGCTGNAATGNTGTGANGATNCGGGAAGNACCNNAAGNNTCTGGGNNGNNTGTGAAA
  5   1   2       bld Neu7 5x3  out                        XL038h04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCGGAATCCTGCTCCCCGAGGGACTTCTTTGTGCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGCTGCAGAGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAAGATCGGATATTGGAATTGGAAGGGGAGAACTTTCAGAGAGAAGAGAAAGAACAGAAACTGCACCAGATCAACAAGGACCTGACAAAAAAGATATACTCTCTGGAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCA
  5   1   2       bld Neu7 5g3  in                         XL033k18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     NCGGAATCCTGCTCCCCGNGGGACTTCTTTGTGCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGCTGCAGAGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAAGATCGGATATTGGAATTGGAAGGGGAGAACGTTCAGAGAGAAGAGAAAGAACAGAAACTGCACCAGATCAACAAGGACCTGACAAAAAAGATATACTCTCTGGAAGAGCAGATC
  5   1   2       bld Tbd7 5g3  in                         XL060n11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGGAATCCTGCTCCCCGAGGGACTTCTTTGTGCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGCTGCAGAGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAAGATCGGATATTGGAATTGGAAGGGGAGAACTTTCAGAGAGAAGAGAAAGAACAGAAACTGCACCAGATCAACAAGGACCTGACAAAAAAGATATACTCTCTGGAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCAG
  5   1   2       bld Ga12 5g3  in                         XL196a21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCCGAGGGACTTCTTTGTGCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGCTGCAGAGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAAGATCGGATATTGGAATTGGAAGGGGAGAACTTTCAGAGAGAAGAGAAAGAACAGAAACTGCACCAGATCAACAAGGACCTGACAAAAAAGATATACTCTCTGGAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCAGAGAGAGTCCTGTTTCCTTAAGGCAGAGAGGAAGTGGCGTCTAGAAATGGAAAAGTTAAATGCACGAATAAAAGTGTTACAGGATGATAATGGCCAGTTGTCTCAGTCTGTCACAGCTCTCA
  5   1   2      seed Em10 5g3  in                    IMAGE:7983265.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGAGGGACTTCTTTGTGCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGCTGCAGAGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAAGATCGGATATTGGAATTGGAAGGGGAGAACTTTCAGAGAGAAGAGAAAGAACAGAAACTGCACCAGATCAACAAGGACCTGACAAAAAAGATATACTCTCTGGAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCAGAGAGAGTCCTGTTTCCTTAAGGCAGAGAGGAAGTGGCGTCTAGAAATGGAAAAGTTAAATGCACGAATAAAAGTGTTACAGGATGATAATGGCCAGTTGTCTCAGTCTGTCACAGCTCTC
  5   1   2       bld Em10 5g                         IMAGE:7983633.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGGACACCATCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGCTGCAGAGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAAGATCGGATATTGGAATTGGAAGGGGAGAACTTTCAGAGAGAAGAGAAAGAACAGAAACTGCACCAGATCAACAAGGACCTGACAAAAAAGATATACTCTCTGGAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCAGAGAGAGTCCTGTTTCCTTAAGGCAGAGAGGAAGTGGCGTCTAGAAATGGAAAAGTTAAATGCACGAATAAAAGTGTTACAGGATGATAATGGCCAGTTGTCTCAGTCTGTCACAGCTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTCCTTGAAACGGCCGAGAGTTCTGANACCGAGCGGGAGAGAGCAGGAT
  5   1   2       bld Ov1  5g                         IMAGE:6317429.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCATGGGACCCATAGAAACACAACAGTCTTCTTCTTTGTCAAGAAAGGATGAGAAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGCTGCAGAGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAAGATCGGATATTGGAATTGGAAGGGGAGAACTTTCAGAGAGAAGAGAAAGAACAGAAACTGCACCAGATCAACAAGGACCTGACAAAAAAGATATACTCTCTGGAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCAGAGAGAGTCCTGTTTCCTTAAGGCAGAGAGGAAGTGGCGTCTAGACATGGAAAAGTTAAATGCACGAATAAAAGTGTTACAGGATGATAATGGCCAGTTGTCTCAGTCTGTCACAGCTCTCAATGCCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTCCCTTGGACACGGCCGACAGTCCTGGAGACCGACCCGGCAGAGGAACCACGATGGGCGGTAGAAGGCCCTGGACTCATCCAAAACAGAAAGCTTTGCGCAACCCTGGAAACGGCAGCGAGGGCCAGCACAGCCTGGTTTCGAGGATCCTGGCGAAGTGGGACCCTTAGTCAGGGTTCCACAAACCACCGGACTGGCCGAGCTGTGNAAGTGCCTGGGGCATGGAACACCCGCGCAAGCACCCCCCGACGGCCCTTTGCGGGAACAAAACCTGTGCAAAATCGTGCCCAACACCACCAAGAACCCTCGCCCC
  5   1   2       bld Neu7                                 XL039h04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAGGATGAGAAAAATGAACCNCTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCANGCANAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGCTGCNGAGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAAGATCGGATATTGGAATTGGANGGGGAGAACTTTCAGAGAGAAGAGAAAGAACAGANACTGCACCAGATCAACAAGGACCTGACAAAAANGATATACTCTNTGGAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAA
  5   1   2       bld Ga15                               XL406o03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAATGAACCACTTAAACCTGCTTTTCCAGACTGCTTGTTTACTGAAGATCCTGTATCTGACCTGACCCCACTAGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGGCTGAGCCATTTGAGCTCCTCACTATCCCTGAAGACCAGTTTGAAGATTATGGGGAGGTGGTGAGTTCATGCAGCATAAGGAGCAGCAGCTGCAGAGTACATGACAGCTGTGCCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCTTCAAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAAGATCGGATATTGGAATTGGAAGGGGAGAACTTTCAGAGAGAAGAGAAAGAACAGAAACTGCACCAGATCAACAAGGACCTGACAAAAAAGATATACTCTCTGGAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCAGAGAGAGTCCTGTTTCCTTAAGGCAGAGAGGAAGTGGCGTCTAGAAATGGAAAAGTTAAATGCACGAATAAAAGTGTTACAGGATGATAATGGCCAGTTGTCTCAGTCTGTCACAGCTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTCCTTGAAACGGCCGAGAGTCTGGAGACGGAGCGGGAGAGGAGCANGATGTGGGAANAGGCCCTGAATCANCAAAGAGAAGCTTG
  5   1   2       bld Em10      in                    IMAGE:7982168.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTCAACAGTGAATCTGTAGAAAAGCTGAGCTTTTTGGAAGATCGGATATTGGAATTGGAAGGGGAGAACTTTCAGAGAGAAGAGAAAGAACAGAAACTGCACCAGATCAACAAGGACCTGACAAAAAAGATATACTCTCTGGAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCAGAGAGAGTCCTGTTTCCTTAAGGCAGAGAGGAAGTGGCGTCTAGAAATGGAAAAGTTAAATGCACGAATAAAAGTGTTACAGGATGATAATGGCCAGTTGTCTCAGTCTGTCACAGCTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTCCTTGAAACGGCCGAGAGTCTGGAGACGGAGCGGGAGAGGAGCAGGATGTGGGAAGAGGCCCTGACTCAGCAAAGAGAAGCTTGGCAACGTGAAAGGCAGGAGGCGGCACAGCTGGTTGAAGATCTGCGATGTGAGCTTAGCAGGTTCCAGAGCACAGACTGCGAGCTGCAATGCTGTGATGATACGGGAAGTACCCACAGCCTCTGGGAAGAGTGTGAAATGGAGAAGCAGAGACTGGCAGATGAGAATCAAAGTCTACGGGAAATGAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCTCACACAGAACCCATGGAGAGGACTCTCATTCCAAGCCAAGTTCTCCTGTCCACACCATTGCCGAAAAGATTGTGGTGTGTCAAAACAGCCGAT
  5   1   2       bld Ga15      in                       XL432k15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAGGACCTGACAAAAAAGATATACTCTCTGGAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCAGAGAGAGTCCTGTTTCCTTAAGGCAGAGAGGAAGTGGCGTCTAGAAATGGAAAAGTTAAATGCACGAATAAAAGTGTTACAGGATGATAATGGCCAGTTGTCTCAGTCTGTCACAGCTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTCCTTGAAACGGCCGAGAGTCTGGAGACGGAGCGGGAGAGGAGCAGGATGTGGGAAGAGGCCCTGAATCAGCAAAGAGAAGCTTGGCAACGTGAAAGGCAGGAGGCAGCACAGCTGGTTGAAGATCTGCGATGTGAGCTTAGCAGGTTCCAGAGCACAGACTGCGAGCTGCAATGCTGTGATGATACGGGAAGTACCCACAGCCTCTGGGAAGAGTGTGAAATGGAGAAGCAGAGACTGGCAGATGAGAATCAAAGTCTACGGGAAATGAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCTCACACAGAACCCATGGAGAGGACTCTCATTCCAAGCCAAGTTCTCCTGTCCACACCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCANAAAGAGATCAATCGACGCCTGCGCCAGTATCTANATCGTGTAATCCTTACTGTTTTANA
  5   1   2       bld Ga15      in                       XL434j20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAGGACCTGACAAAAAAGATATACTCTCTGGAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCAGAGAGAGTCCTGTTTCCTTAAGGCAGAGAGGAAGTGGCGTCTAGAAATGGAAAAGTTAAATGCACGAATAAAAGTGTTACAGGATGATAATGGCCAGTTGTCTCAGTCTGTCACAGCTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTCCTTGAAACGGCCGAGAGTCTGGAGACGGAGCGGGAGAGGAGCAGGATGTGGGAAGAGGCCCTGAATCAGCAAAGAGAAGCTTGGCAACGTGAAAGGCAGGAGGCAGCACAGCTGGTTGAAGATCTGCGATGTGAGCTTAGCAGGTTCCAGAGCACAGACTGCGAGCTGCAATGCTGTGATGATACGGGAAGTACCCACAGCCTCTGGGAAGAGTGTGAAATGGAGAAGCAGAGACTGGCAGATGAGAATCAAAGTCTACGGGAAATGAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCTCACACAGAACCCATGGAGAGGACTCTCATTCCAAGCCAAGTTCTCCTGTCCACACCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGACGCCTGCGCCAGTATCTAGATCGTGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTATGAGCCATTGATTGAGTGTTGG
  5   1   2       chi Oo1                             IMAGE:5079934.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGAGCAGATCCAGGAACAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCAGAGAGAGTCCTGTTTCCTTAAGGCAGAGAGGAAGTGGCGTCTAGAAATGGAAAAGTTAAATGCACGAATAAAAGTGTTACAGGATGATAATGGCCAGTTGTCTCAGTCTGTCACAGCTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTCCTTGAAACGGCCGAGAGTCTGGAGACGGAGCGGGAGAGGAGCAGGATGTGGGAAGAGGCCCTGAATCAGCAAAGAGAAGCTTGGCAACGTGAAAGGCAGGAGGCGGCACAGCTGGTTGAAGATCTGCGATGTGAGCTTAGCAGGTTCCAGAGCACAGACTGCGAGCTGCAATGCTGTGATGATACGGGAAGTACCCACAGCCTCTGGGAAGAGTGTGAAATGGAGAAGCAGAGACTGGCAGATGAGAATCAAAGTCTACGGGAAATGAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCTCACACAGAACCCATGGAGAGGACTCTCATTCCAAGCCAAGTTCTCCTGTCCACACCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCCTATAATTAATCGAGAACGACATTCAATCGACGTCCTGGCGCCCGAACTCTAAAATCGTGGAAATCCCTTACCAAGTTTTANAAAAAGGACCCCCGGCTCTTTCCTTGAAATTCCAGGCCATCTCTCTATGGAGCCCATTGAATTGGAATGGTTTGGGAAGAAATTATTAGTTGGGGGTAAGAAAAAACGTTGNNNNTTTGGttttttttttAAAATTCCCCTGGAGGGAAACAAATAGGGCCCAATAATGTGTCTTTAACCCATTTATTGAGCCTGGGGGGCCCTCCATCCCTTTTAAAATTGGGCCACCACATAATACCCCACCTGGGGGGG
  5   1   2       bld Neu7      in                         XL017h14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAAGCTGCAACTGGAGGAAGAGAAAAGGGAAATTCTTTCTCAGAGAGAGTCCTGTTTCCTTAAGGCAGAGAGGAAGTGGCGTCTAGAAATGGAAAAGTTAAATGCACGAATAAAAGTGTTACAGGATGATAATGGCCAGTTGTCTCAGTCTGTCACAGCTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTCCTTGAAACGGCCGAGAGTCTGGAGACGGAGCGGGAGAGGAGCAGGATGTGGGAAGAGGCCCTGACTCAGCAAAGAGAAGCTTGGCAACGTGAAAGGCAGGAGGCAGCACAGCTGGTTGAAGATCTGCGATGTGAGCTTAGCAGGTTCCAGAGCACAGACTGCGAGCTGCAATGCTGTGATGATACGGGAAGTACCCACAGCCTCTGGGAAGAGTGTGAAATGGAGAAGCAGAGACTGGCAGATGTAAGTCTGGGAAATGCTGTTTAACTAAGAAAAGCCACACAAAAAACATTAGGAGAATCAAAGTCTACGGGAAATGAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCTCACACAGAACCCATGGAGAGGACTCTCAT
  3  -1   2       bld Bla2                            IMAGE:7296781.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAAGGGAAATTCTTTCTCAGAGAGAGTCCTGTTTCCTTAAGGCAGAGAGGAAGTGGCGTCTAGAAATGGAAAAGTTAAATGCACGAATAAAAGTGTTACAGGATGATAATGGCCAGTTGTCTCAGTCTGTCACAGCTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTCCTTGAAACGGCCGAGAGTCTGGAGACGGAGCGGGAGAGGAGCAGGATGTGGGAAGAGGCCCTGACTCAGCAAAGAGAAGCTTGGCAACGTGAAAGGCAGGAGGCAGCACAGCTGGTTGAAGATCTGCGATGTGAGCTTAGCAGGTTCCAGAGCACAGACTGCGAGCTGCAATGCTGTGATGATACGGGAAGTACCCACAGCCTCTGGGAAGAGTGTGAAATGGAGAAGCAGAGACTGGCAGATGAGAATCAAAGTCTACGGGAAATGAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCTCACACAGACCCATGGAGAGGACTCTCATTCCNAGCCAGTTCTCCTGTCACACATTGCCGAAGAGATGATGTGTGTACAAACAGCAATTTCACCTTATGACAGAAGAATCAATCACCCGCCCGTATCAATCGGTATCCTACGTTAGAAAGACCGTCTCTGATCAGCTCCATACATGATGTGTGGAATATATGGAGAATCTGTTGTTTTATCTGAGACAGCAAGTACATACGCTCTT
  3   1   2       bld Em10 5g3  in                    IMAGE:7983265.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAACCCCAGAACAAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTCCTTGAAACGCCGAAGAGTCTGAGACGGAGCGGGAGAGAAGCAGGATGTGGGAAGAGGCCCTGAATCAGCAAAGAGAAGCTTGCAAACGTGAAAGGCAGGAGGCAGCACAGCTGGTTGAAGATCTGCGATGTGAGCTTAGCAGGTTCCAGAGCACAGACTGCGAGCTGCAATGCTGTGATGATACGGGAAGTACCCACAGCCTCTGGGAAGAGTGTGAAATGGAGAAGCAGAGACTGGCAGATGAGAATCAAAGTCTACGGGAAATGAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCTCACACAGAACCCATGGAGAGGACTCTCATTCCAAGCCAAGTTCTCCTGTCCACACCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGACGCCTGCGCCAGTATCTAGATCGTGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTATGAGCCATTGATTGAGTGTTGGGAAGATTATAGTTGGGTAGTAAATACATGTTTTGTTTTTTTTTTAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAACTACTCATAAGGCTGCACATATAGCCATGCCCGT
  3   1   2       bld Ga12 5g3  in                         XL196a21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGAGAGTCTGGAGACGGAGCGGGAGAGGAGCAGGATGTGGGAAGAGGCCCTGACTCAGCAAAGAGAAGCTTGGCAACGTGAAAGGCAGGAGGCAGCACAGCTGGTTGAAGATCTGCGATGTGAGCTTAGCAGGTTCCAGAGCACAGACTGCGAGCTGCAATGCTGTGATGATACGGGAAGTACCCACAGCCTCTGGGAAGAGTGTGAAATGGAGAAGCAGAGACTGGCAGATGAGAATCAAAGTCTACGGGAAATGAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCTCACACAGAACCCATGGAGAGGACTCTCATTCCAAGCCAAGTTCTCCTGTCCACACCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGACGCCTGCGCCAGTATCTAGATCGTGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTATGAGCCATTGATTGAGTGTTGGGAAGATTATAGTTGGGTAGTAAATACATGTTTTGTTTTTTTTTAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATG
  3   1   2       bld Ga18      in                      xlk116g17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCNNNCNTCNGNCGGNNNANNNNNAGGATGTGGNAGANGCCCTGAATCAGCAAAGAGAAGCTTGGCAACGTNNNAGNCAGGANGNNAGNACANCTGNTTNNNGATCTGCGATGTGAGCTTAGCAGGTNNCAGAGNACAGACTNNGAGCTGNAATGCTGTGATGATACGGGAAGNACCCACAGCCTCTGGGAAGAGTGTGAAATGGAGAAGCAGAGACTGGCAGATGAGAATCAAAGTCTACGGGAAATGAATGAAGATCTGCAGGNNNNCNGCTTGTACAAAATGGGTCCCTCTGCTTCTCACACAGAACCCATGGAGAGGACTCTCATTCCAAGCCAAGTTCTCCTGTCCACACCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGNNNNNNCGCCAGTATCTAGATCGTGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTATGAGCCATTGATTGAGTGTTGGGAAGATTATAGTTGGGTAGTAAATACATGTTTTGTTTTTTTTAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTNTTTCACACAATCCTAAAGTCCCAATTTAATACATANCCNCTTTTTTTTTTTACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGAATATNCTACTCAGGGAA
  5   1   2       add Ga18      in                      xlk116g17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGAGGAGNAGGATGTGGGAAGAGNNCTGAATCAGCAAAGAGAAGCTTNNNACGTGAAAGGCAGGAGGNGCACAGNTNGTTGAAGATCTGCGATGTGAGCTTAGCAGGTTCCAGAGCACAGACTGCGAGCTGCAATGCTGTGATGATACGGGAAGTACCCACAGCCTCTGGGAAGAGTGTGAAATGGAGAAGCAGAGACTGGCAGATGAGAATCAAAGTCTACGGGAAATGAATGAAGATCTGCAGNANNNNTGNTTGTACAAAATGGGTCCCTCTGCTTCTCACACAGAACCCATGGAGAGGACTCTCATTCCAAGCCAAGTTCTCCTGTCCACACCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGACGCCTGCGCCAGTATCTAGATCGTGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTATNAGCCATTGATTGAGTGTTGGGAAGATTATAGTTGGGTAGTAANTACATGttttgttttttttAAANTCACTGAGGGACATAGGNCTAATAATGTATTACCAATATGAGCTGGNCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAANCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTNATGTCTGCCAGTAAAAAANTGTATTTNTTTTTTAATTATTGGNNNCTTTTTGTAAGNCANTGTTTC
  3   1   2       bld Neu7 5g3  in                         XL033k18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGAGCACAGACTGCGAGCTGCAATGCTGTGATGATACGGGAAGTACCCACAGCCTCTGGGAAGAGTGTGAAATGGAGAAGCAGAGACTGGCAGATGAGAATCAAAGTCTACGGGAAATGAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCTCACACAGAACCCATGGAGAGGACTCTCATTCCAAGCCAAGTTCTCCTGTCCACACCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGACGCCTGCGCCAGTATCTAGATCGTGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTATGAGCCATTGATTGAGTGTTGGGAAGATTATAGTTGGGTAGTAAATACATGTTTTGTTTTTTTTAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGC
  3   1   2       bld Ga15      in                       XL434j20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TNCGGGAAGTNCCCACAGCCTNTGGGAAGAGTGNGAAATGGAGAAGCAGNGACTGGCAGATGAGAATCAAAGTNTNCGGGAAATGAATGAAGATNTGCAGGATGCTNTGCTTGTACAAAATGGGTCCCTNTGCTTNTCNCNCAGAACCCATGGNGNGGNCTNTCATTCCAAGCCAAGTTCTCCTGTCCNCNCCATTGCCGAAGAGATTGATGNGNGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGNGATCAATCGACGCCTGCGCCAGTATNTAGATCGNGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTNTTNTTGAAATCAAGCCATCTNTATGAGCCNTTGATTGAGTGTTGGGAAGATTATAGTTGGGTAGTAAATACATGTTTTGTTTTTTTTAAATTCNCTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCNCTACTCNCNCTGNGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGNGTCTTTTTGTAAGTCNCTGTTTCNCNCAATCCTAAAGTCCCAATTTAATACATAGCCNCTTTTTTTTTTTACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGAATATG
  5  -1   2       bld Bla2      in                    IMAGE:7296900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATACGGGAAGTACCCCAACCTTTTGGAGGAGTGGAAAAGGAGAAGCAGAGAATGGCAGATGAGAATCAAAGTTTACGGGAAATGAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCTCACACAGAACCCATGGAGAGGACTCTCATTCCAAGCCAAGTTCTCCTGTCCACACCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGACGCCTGCGCCAGTATCTAGATCGTGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTATGAGCCATTGATTGAGTGTTGGGAAGATTATAGTTGGGTAGTAAATACATGttttgtttttttttAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTTAAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTGTTTCACACAATCCTAAAGTCCCAATTTAATACATAGCCACtttttttttttACTTTCGCCCAAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGAAGTCATTGATATTAAATATATATTGAACGTGC
  3   1   2       bld Ga18 5g3  in                       xlk62e03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCNCAGCNNCTGGGANNAGTGTGAAATGNAGAAGCAGAGACTGGCAGATGAGAATCAAAGTCTNCGGGAAATGAATGAAGATCTGCAGGNNNNCTGCTTGTACAAAATGGGTCCCTCTNCTTCTCACACAGAACCCATGGAGAGGACTCTCATTCCAAGCCAAGTTCTCCTGTCCACACCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGNNNNNNCGCCAGTATCTAGATCGTGTAATCCTTACTGTTTTAGAAAAAGNCCCCGCTCTTCTTGAAATCAAGCCATCTCTATGAGCCATTGATTGAGTGTTGGGAAGATTATAGTTGGGNAGTAAATACATGTTTTGTTTTTTTTTAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTNTTTCACACAATCCTAAAGTCCCAATTTAATACATANCNNNNNTTTTTTTTTACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGAATATNC
  3   1   2       bld Ga15      in                       XL432k15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCCTNTGGGAAGAGTGTGAAATGGAGAAGCAGAGACTGGCAGATGAGAATCAAAGTNTACGGGAAATGAATGAAGATNTGCAGGATGCTNTGCTTGTACAAAATGGGTCCCTNTGCTTCTCNCNCAGAACCCATGGNGAGGNCTNTCATTCCAAGCCAAGTTNTCCTGTCCNCNCCATTGCCGAAGAGATTGATGTGNGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGACGCCTGCGCCAGTATNTAGATCGNGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTNTTCTTGAAATCAAGCCATCTNTATGAGCCNTTGATTGAGNGTTGGGAAGATTATAGTTGGGTAGTAAATACATGTTTTGTTTTTTTTAAATTCNCTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCNCTACTCNCCCTGNGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGNGTCTTTTTGTAAGTCNCTGTTTCNCNCAATCCTAAAGTCCCAATTTAATACATAGCCNCTTTTTTTTTTTACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGAATATG
  3   1   2       bld Em10      in                    IMAGE:7982168.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGGAGAAGCAGAGACTGGCAGATGAGAATCAAAGTCTACGGGAAATGAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCTCACACAGAACCCATGGAGAGGACTCTCATTCCAAGCCAAGTTCTCCTGTCCACACCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGACGCCTGCGCCAGTATCTAGATCGTGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTATGAGCCATTGATTGAGTGTTGGGAAGATTATAGCTGGGTAGTAAATACATGTTTTGTTTTTTTTAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTGTTTCACACAATCCTAAAGTCCCAATTTAATACATAGCCACTTTTTTTTTTTACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGCAATATGCTACTCTCGCCACACCTCGGGACTCAAATTTCT
  3   1   2       bld Ga15      in                       XL441i09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGGCAGATGNGAATCAAAGTTTACGGGAAATGAATGAAGATNTGCAGGATGCTNTGCTTGTACAAAATGGGTCCCTTTGCTTNTCNCNCAGAACCCATGGNGNGGNCTNTCATTCCAAGCCAAGTTNTCCTGTCCNCNCCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCNATCGACGCCTGCGCCAGTATNTAGATCGNGTAATCCTTACTGTTTTAGAAAAAGNCCCCGCTNTTNTTGAAATCAAGCCATNTNTATGAGCCNTTGATTGAGTGTTGGGAAGATTATAGTTGGGTAGTAAATACATGTTTTGTTTTTTTTTAAATTCNCTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCNCTACTCNCCCTGNGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGNGTCTTTTTGTAAGTCNCTGTTTCNCNCAATCCTAAAGTCCCAATTTAATACATAGCCNCTTTTTTTTTTTACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGAAGTCA
  5   1   2       bld Ga15      in                       XL441i09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGCAGATGAGAATCAAAGTCTACGGGAAATGAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCTCACACAGAACCCATGGAGAGGACTCTCATTCCAAGCCAAGTTCTCCTGTCCACACCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGACGCCTGCGCCAGTATCTAGATCGTGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTATGAGCCATTGATTGAGTGTTGGGAAGATTATAGTTGGGTAGTAAATACATGttttgtttttttttAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTGTTTCACACAATCCTAAAGTCCCAATTTAATACATAGCCACtttttttttttACTTTCNCCCAAAAATGTACACTCTGCATAAAGG
  3   1   0       chi Em10                            IMAGE:7981873.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCATGGAGAGGACTCTCCATCCCAGCCAAGTTTTTCTGTCCACACATTGCCGAAGAGATTGGATGTGTGTACAAAACAGCAGATTTCAGCCCGTAAGGAGCAGTAAGAGATCAATCGACGCCTGCGCCAGTATCTAGATAGTGTAATCCTTACTGTGTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTATGAGCCATTGATTGAGTGTGGGGAAGATTATAGTTGGGTAGTAAATACATGTTTTGTTTTTTTTAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAAAATGAGGTGGTCTCATCCCTTCAAACCAGTCCATACATCATTTAGTAAACATGGCTACAGTTTTGCACACAATGATCCATATTTGATTTTATTCGGTTTACAATAATATGCACTAATTAAACAAGACAGTGGGTCGCACACCCCGGGATCAGAAAGGGAATCAGTCGGTAGACAAGTTGCTCCCCCCCCTTTCCATTCTGTTGTTTTCTCATCCACCTTGGTGTGGAAGCCTCAGTATCACTATTAATTCGAATATAACTGGTCCAATAATTGGTGTTAAAAAGCTGCTTTTCATAAATGTATCAGTATAAAAGGAAATTTTTTTTTTTTTAAAAG
  3   1   2       bld Ov1  5g3  in                    IMAGE:5073687.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCAAGCCAAGTTTCTCCTGTCCACACCCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGACGCCTGCGCCAGTATCTAGATCGTGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTATGAGCCATTGATTGAGTGTTGGGAAGATTATAGTTGGGTAGTAAATACATGTTTTGTTTTTTTTAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTGTTTCACACAATCCTAAAGTCCCAATTTAATACATAGCCACTTTTTTTTTTTACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGAAGTCATTGATATTAAATATATATTGAATGTGC
  3   1   2       bld DMZ                                 rxl221g22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTCCAAGCCAAGTTNTCCTGTCCACACCATTGCCGAAGAGATTGATGTGTGTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGACGCCTGCGCCAGTATNTAGATCGTGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTNTTCTTGAAATCAAGCCATCTNTNTGAGCCNTTGATTGAGTGTTGGGAAGATTATAGCTGGGTAGTAAATACATGTTTTGTTTTTTTTAAATTCNCTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCNCTACTCNCNCTGNGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCNGTAAAAAAATTGTATTTATTTTTTAATTATTGGNGTCTTTTTGTAAGTCNCTGTTTCNCNCAATCCTAAAGTCCCAATTTAATACATAGCCNCTTTTTTTTTTTACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCCTGTAAGTGATGCCAAGGATATTC
  3   1   2       bld Tbd7 5g3  in                         XL060n11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTACAAAACAGCANATTTCAGCCCTTAATNAGCANAAANAGATCAATCGACGCCTGCGCCAGTATTTANATCGNGTAATCCTTACTGTTTTAAAAAAANACCCCGCTNTTNTTGAAATCAAGCCATNTNTATNAGCCATTGATTNAGTGTTGGGAANATTANAGTTGGGTAGTAAAAACATGTTTTGTTTTTTTTTTAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTA
  3   1   2       bld Egg3 5g3  in                    IMAGE:3378168.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGTCCAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGACGCCTGCGCCAGTATCTAGATCGTGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTATGAGCCATTGATTGAGTGTTGGGAAGATTATAGTTGGGTAGTAAATACATGTTTTGTTTTTTTTAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTGTTTCACACAATCCTAAAGTCCCAATTTAATACATAGCCACTTTTTTTTTTTACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGAAG
  3   1   2       bld Neu7      in                         XL017h14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTACAAAACAGCAGATTTCAGCCCTTAATGAGCAGAAAGAGATCAATCGACGCCTGCGCCAGTATTTAGATCGTGTAATCCTTACTGTTTTANAAAAAGACCCCGCTNTTNTTGAAATCAAGCCATCTNTATGAGCCATTGAATGAGTGTTGGGAAGATTANAGTTGGGTAGTAAANACATGTTTTGTTTTTTTTTAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTGTTTCACACAATCCTAAAGTCCCAATTTAANACATAGCCACTTTTTTTTTTTACATTCGCCCGAAAATGTACAC
  5   1   2       bld Ga15      in                       XL507p05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAGATCGTGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTATGAGCCATTGATTGAGTGTTGGGAAGATTATAGTTGGGTAGTAAATACATGttttgtttttttttAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGNGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTGTTTCACACAATCCTAAAGTCCCAATTTAATACATAGCCACtttttttttttACTTTCNCCCGAAAANGTNCNCNCNGCATAAAGGGGAGGANAGGCTTTGNCNCTGNAAAAAACTTTAAANGTATGNGNCTGTAAGGGATGCCAAGGATATTCNGNGAATATGCTACNCAGGGAAGNCATTGATATTAAATATATATTGAANGGGCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL507p05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGATCGNGTAATCCTTACTGTTTTAGAAAAAGACCCCGCTNTTCTTGAAATCAAGCCATCTCTATGAGCCNTTGATTGAGTGTTGGGAAGATTATAGTTGGGTAGTAAATACATGTTTTGTTTTTTTTTAAATTCNCTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCNCTACTCNCCCTGNGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGNGTCTTTTTGTAAGTCNCTGTTTCNCNCAATCCTAAAGTCCCAATTTAATACATAGCCNCTTTTTTTTTTTACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCCAAGGATATTCTGTGAATATGCT
  3   1   2       bld Ga15      in                       XL444k14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATCCTTACTGTTTTAGAAAAAGACCCCGCTNTTCTTGAAATCAAGCCATCTNTATGAGCCNTTGATTGAGNGTTGGGAAGATTATAGTTGGGTAGTAAATACATGTTTTGTTTTTTTTTAAATTCNCTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCNCTACTCNCNCTGNGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGNGTCTTTTTGTAAGTCNCTGTTTCNCNCAATCCTAAAGTCCCAATTTAATACATAGCCNCTTTTTTTTTTTACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGAATATG
  5   1   2       bld Ga15      in                       XL444k14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATCCTTACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTATGAGCCATTGATTGAGTGTTGGGAAGATTATAGTTGGGTAGTAAATACATGttttgtttttttttAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTGTTTCACACAATCCTAAAGTCCCAATTTAATACATAGCCACtttttttttttACTTTCNCCCGAAAANGTACNCNCTGCATANAGGGGAGGANAGGCTTTGNCNCTGTAAAANACTTTAAANGTATGNGNCTGTAAGNGATGCCAAGGATATTCTGNGAATATGCTACNCAGGGAAGNCATTGATATTAAATATATATTGAANGGGCaaaaaaaaaa
  3   1   2       bld Ooc2 5g3  in                    IMAGE:3746943.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAGCCATTGATTGAGTGTTGGGAAGATTAATAGTTGGGTAGTAAATACATGTTTTGTTTTTTTTTAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATGTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTGTTTCACACAATCCTAAAGTTCCCAATTTAATACATAGCCACTTTTTTTTTTACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGAATATGCTACCCAGGGAAGTCATTGATATTAAATATAGATTGAATGTTAAAAAAAAA
  5   1   2       bld Neu2                            IMAGE:2942858.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGTTGGGAAGATTATAGTTGGGTAGTAAATACATGttttgtttttttttAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTGTTTCACACAATCCTAAAGTCCCAATTTAATACATAGCCACtttttttttttACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGAATA
  3   1   2       bld Egg1                               PBX0003F06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAAATACATGTTTTGTTTTTTTTTAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTGTTTCACACAATCCTAAAGTCCCAATTTAATACATAGCCACTTTTTTTTTTTACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGAAGTCATTGATATTAAATATATATTGAATGTGCAAAAAAAAAAAAAAAAAAGATTC
  5  -1   2       bld Emb1                            IMAGE:6865704.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCtttttttttttttttAAATTCACTGAGGGACATAGGCCTAATAATGTATTACCAATATGAGCTGGTCTCATCCTTTAATTGCTCACTACTCACACTGTGTAAACCTGTGCTGATGAATTATTTGAAAAGGCTGCAATTTAATGTCTGCCAGTAAAAAAATTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTGTTTCACACAATCCTAAAGTCCCAATTTAATACATAGCCACtttttttttttACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGAAGTCATTGATATTAAATATATATTAATa
  5   1   2       bld Neu2                            IMAGE:2942409.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGCTGCAATTTAATGTCTGCCAGTaaaaaaaaTTGTATTTATTTTTTAATTATTGGTGTCTTTTTGTAAGTCACTGTTTCACACAATCCTAAAGTCCCAATTTAATACATAGCCACtttttttttttACTTTCGCCCGAAAATGTACACTCTGCATAGAGGTGAGGAGAGGCTTTGTCTCTGTAGAAGACTTTAAATGTATGTGTCTGTAAGTGATGCCAAGGATATTCTGTGAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)