Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 93%

 1012770143 Xl3.1-IMAGE:6869502.5 - 34 ESTs
                                                                       .-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6869502.5                                                              TAGTGATGTCTGTCGGTACAGAGTGAGGAATTCAGTGCTCTGCACCAATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCAGCAGCAAGATTTAATAATTCACAATTTATGGGACCTCCTGTCACAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCCGGATTTGCACCCGACAAATCATCCGTTAAATGGAACAAACCAGCATTTTAAAGAGTGTAATCCAAAGCACAGTACTGGCTTGCCTCCCTCAGTCAGCCACGTCCCTGCAGCAATACTGCCTCCTGGTGTCATAGATACCGACTTCATAGATGAGGAAGTCCTTATGTCCTTGGTGATCGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAAAATGAGTTTGATTTTATGACAGACTTTGTTTGCAAACAGCCCAACAGAGTAAGCTGTTAGGTGTGTATATTAAGAAGATAAGAGACTTAGAACATTCCTTTATGGACACAGAACCTTTCTTCCAGAATCTGTTACAATCGTACAGGTTTTTTTCCCCCATCACATTTTCATAACTAAGCCAATAGTTTATTGGTTTGTTTCTTGTTTAGCTCACTCACATTTTTAAGATTTCTTATTTTCCATGTTACTGCAACAACACCATATGATAGATACAGTCTTTGATTGAATGGGCCTTTAGAGGCAGATTTTCTGCACTAACTCTGCCATATTGCTTCATTTAATCTATGCATTGCTGTGAACCATTTCCCCCCCATGTGTATGCTAAACTGGAAGTTTAACAAACATGGGCTAAGCCTTGCTGGATCAGGAAAAGTCCTACTGCTTATTTAATTTGCCCAATTTCCTCCTCCTTTCTCTTCTAGCATGATGAGATTGGAGTAATGTTGGTGAGACACTTTTTTTTTTTTTTTCATCCCTGAAAATGTTTTGACACTTTACCTAGTTGATTTAGTTCATGGGGAAAAATACTACTGTGTTAAAAGCTTTTTAGGAAAAAATTTGACAGTTTTTTGTACAAACATTTTTTGAGAAAATACTTGTTAATTTATTTTAATTTGCCAATGTCA
                                                  Xl3.1-CHK-1012687698                                                                    TGTCTGTCGGTACAGAGTGAGGAATTCAGTGCTCTGCACCAATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCAGCAGCAAGATTTAATAATTCACAATTTATGGGACCTCCTGTCACAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCCGGATTTGCACCCGACAAATCATCCGTTAAATGGAACAAACCAGCATTTTAAAGAGTGTAATCCAAAGCACAGTACTGGCTTGCCTCCCTCAGTCAGCCACGTCCCTGCAGCAATACTGCCTCCTGGTGTCATAGATACCGACTTCATAGATGAGGAAGTCCTTATGTCCTTGGTGATCGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAAAATGAGTTTGATTTTATGACAGACTTTGTTTGCAAACAGCCCAACAGAGTAAGCTGTTAGGTGTGTATATTAAGAAGATAAGAGACTTAGAACATTCCTTTATGGACACAGAACCTTTCTTCCAGAATCTGTTACAATCGTACAGGTTTTTTTCCCCCATCACATTTTCATAACTAAGCCAATAGTTTATTGGTTTGTTTCTTGTTTAGCTCACTCACATTTTTAAGATTTCTTATTTTCCATGTTACTGCAACAACACCATATGATAGATACAGTCTTTGATTGAATGGGCCTTTAGAGGCAGATTTTCTGCACTAACTCTGCCATATTGCTTCATTTAATCTATGCATTGCTGTGAACCATTTCCCCCCCATGTGTATGCTAAACTGGAAGTTTAACAAACATGGGCTAAGCCTTGCTGGATCAGGAAAAGTCCTACTGCTTATTTAATTTGCCCAATTTCCTCCTCCTTTCTCTTCTAGCATGATGAGATTGGAGTAATGTTGGTGAGACACTTTTTTTTTTTTTTACATCCCTGAAAATGTTTTGACACTTxxCxxAGTTGATTTAGTTCATGGGAAAAAATACTACTGTGTTAAAAGCTTTTTAGGAAAAAxTTxxAxxxTTTTTxxTACAAAxxxTTTTTGAGAAAATACTTGTTAATTTATTTTAATTTGCCAATGTCAATAAAG
                                                      consensus depths                                                                   6    10    11    13    12    14    13    14    14    15    14    16    14    16    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    17    18    17    18    18    19    18    19    17    19    17    19    18    19    18    19    18    19    17    19    17    19    17    18    17    18    17    18    17    18    16    17    16    17    16    17    16    17    15    17    16    17    15    17    16    17    15    16    15    16    15    16    15    16    15    16    15    17    15    17    15    17    15    17    12    17    12    16    13    16    13    15    12    15    12    15    11    15    11    12    10    12     9    12     9    12     7    10     7    10     7    10     7    10     5    11     6    10     7    11     7    11     7    11     7    11     7    11     7    11     8    10     8    10     8     9     8    10     8    10     8     9     8     9     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    10    10    10    10    10    11    11    11    11    11    11    12    13    12    13    14    15    15    15    15    15    15    15    15    15    14    15    13    15    14    15    13    15    14    15    12    14    12    14    11    13    11    13    11    12    11    12    10    12    11    12     3    12     3    12     3    12     3    12     3    12     4    12     4    12     3    11     3    10     3     9     3     9     3     6     3     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---C--------
                                               BLH ATG     172     730                                                              
                                               BLH MIN     172      89                                                              
                                               BLH MPR     172      89                                                              
                                               BLH OVR     172      22                                                              
                                               CDS MIN     172      89                                                              
                                               EST CLI     -12      15                                                              
                                               ORF LNG     172       1                                                              
  5   1   2       bld Sp1  5g                         IMAGE:4174822.5p CCCTTTTAGCAATTCTATATTGACAAGCTGGGGGGaaaaaaaaCAGTTCATTGTTGGCAAGTAGTGATGTCTGTCGGTACAGAGTGAGGAATTCAGTGCTCTGCACCAATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCANCCACACCTTTAACAGTCTAATGGGGAGAGCAC
  5   1   2       bld Te2       in                    IMAGE:7391580.5p                                      AGACATTTCGGTCCGGATTCCGGGATGTGATGTCTGTCGGTACAGAGTGAGGAATTCAGTGCTCTGCACCAATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCAGCAGCAAGATTTAATAATTCACAATTTATGGGACCTCCTGTCACAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCCGGATTTGCACCCGACAAATCATCCGTTAAATGGAACAAACCAGCATTTTAAAGAGTGTAATCCAAAGCACAGTACTGGCTTGCCTCCCTCAGTCAGCCACTCCCTGCAGCATACTGCCTCTGGTGTCATAGATACGACTCTAGATGAGGAGTCCTATGTCCTGTGACGAAATGGTTGATCGTATAAGACTACTGACTT
  5   1   2       bld Emb1 5g                         IMAGE:6864546.5p                                         CCACGCGTCCGCCCACGCGTCCGGTGATGTCTGTCGGTACAGAGTGAGGAATTCAGTGCTCTGCACCAATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCAGCAGCAAGATTTAATAATTCACAATTTATGGGACCTCCTGTCACAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCCGGATTTGCACCCGACAAATCATCCGTTAAATGGAACAAACCAGCATTTTAAAGAGTGTAATCCAAAGCACAGTACTGGCTTGCCTCCCTCAGTCAGCCACGTCCCTGCAGCAATACTGCCTCCTGGTGTCATAGATACCGACTTCATAGATGAGGAAGTCCTTATGTCCTTGGTGATCGAAATGGGTTTTGGATCGTATAAAAGAACTACCTGGAGCTTTTGGCTTGGACAAAAATGAGTTTGATTTTTATAGACAGACTTTTGTTTTTGCAAACAGCC
  5   1   2       bld Ooc1 5g3  in                     Ooc1-db29c09.y1                                           GGGTCGACCCACGCGTCCGTAGTGATGTCTGTCGGTACAGAGTGAGGAATTCAGTGCTCTGCACCAATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCAGCAGCAAGATTTAATAATTCACAATTTATGGGACCTCCTGTCACAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCCGGATGTGCACCCGACAAATCATCCGTTAAATGGAACAAAC
  5   1   2       bld Ooc1 5g                          Ooc1-db24d12.y1                                                  GGGTCGACCCACGCGTCCGGTCTGTCGGTACAGAGTGAGGAATTCAGTGCTCTGCACCAATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCACCAGCAAGATTTAATAATTGACAATTTATGGGACCTCCT
  5   1   2       bld Te1  5g                         IMAGE:6928875.5p                                                  GGGGTTGGCAAGTAGTGATGTCTGTCGGTACAGAGTGAGGAATTCAGTGCTCTGCACCAATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCAGCAGCAAGATTTAATAATTCACAATTTATGGGACCTCCTGTCACAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCCGGATTTGCACCCGACAAATCATCCGTTAAATGGAACAAACCAGCATTTTAAAGAGTGTAATCCAAAGCACAGTACTGGCTTGCCTCCCTCAGTCAGCCACGTCCCTGCAGCAATACCTGCCTCCCTGGTGTCATAGAATACCGGACTTCATTAGA
  5   1   2       bld Egg3 5x3                        IMAGE:6869502.5p                                                      CCCCGGGGTAGTGATGTCTTTCCGTACAGAGTGAGGAATTCAGTGCTCTGCACCAATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCAGCAGCAAGATTTAATAATTCACAATTTATGGGACCTCCTGTCACAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCCGGATTTGCACCCGACAAATCATCCGTTAAATGGAACAAACCAGCATTTTAAAGAGTGTAATCCAAAGCACAGTACTGGCTTGCCTCCCTCAGTCAGCCACGTCCCTGCAGCAATACTGCCTCCTGGTGTCATAGATACCGACTTCATAGATGAGGAAGTCCTTATGTCCTTGGTGATCGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAAAATGAGTTTGATTTTATGACAGACTTTGTTTGCAAACAGCCCAACAGAGTAAGCTGTTAGGTGTGTATATTAAGAAGATAAGAGACTTAGAAACATTCCTTTATGGACACAGGAAC
  5   1   2       bld Egg3 5g                         IMAGE:6870861.5p                                                       AATTCCCGGGGTGATGTCTGTCTGTAAGAGTGAGGAATTCAGTGCTCTGCACCAATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCAGCAGCAAGATTTAATAATTCACAATTTATGGGACCTCCTGTCACAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCCGGATTTGCACCCGACAAATCATCCGTTAAATGGAACAAACCAGCATTTTAAAGAGTGTAATCCAAAGCACAGTACTGGCTTGCCTCCCTCAGTCAGCCACGTCCCTGCAGCAATACTGCCTCCTGGTGTCATAGATACCGACTTCATAGATGAGGAAGGCCTTATGTCCTTGGTGATCGAAATGGGTTTTGGATCGTATAAAAAAACTACCCGAACCTTTGGGCTTGGACAAAAATGAAGTTTTGAATTTTATTGAACAGAAATTTGGTTGTGGCAAAACGCGCGCCAAGCCAGAAATTGAAGCC
  5   1   2       bld Egg3 5g                         IMAGE:3378514.5p                                                         CCGGGTAGTGATGTCTGTCGGTACAGAGTGTGGAATTCAGTGCTCTGCACCAATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCAGCAGCAAGATTTAATAATCCACAATTTATGGGACCTCCTGTCACACATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCTCGATTTGCACTCGACAGATCATCCGATCAATGGAACAGACCAGCATTTTATAGAGTGTAATACAGAGCACAGTACTGGCTCGCCCTCCTCATCCAGC
  5   1   2       bld Emb1 5g                IMAGE:6634904-IMAGp.IMAGp                                                             GTAGTGATGTCTGTCGGTACAGAGTGAGGAATTCAGTGCTCTGCACCAATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCAGCAGCAAGATTTAATAATTCACAATTTATGGGACCTCCTGTCACAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCCGGATTTGCACCCGACAAATCATCCGTTAAATGGAACAAACCAGCATTTTAAAGAGTGTAATCCAAAGCACAGTACTGGCTTGCCTCCCTCAGTCAGCCACGTCCCTGCAGCAATACTGCCTCCTGGTGTCATAGATACCGACT
  5   1   2       bld Emb1 5x                         IMAGE:6634904.5p                                                               AGTGATGTCTGTCGGTACAGAGTGAGGAATTCAGTGCTCTGCACCAATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATTGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGGGCACTGGCACTATGTACCAGGGAATATGAACTCTAGACAATAGCATCAGACATGGCATGGTCACTGGGAATGTAAATGGCGGACATCGAAATGGCAGCATAGCGCGAGCAGCAAGAGTTAATAATTCACAGTTTATGGGGCCTCCTGTCACAAATGAAGGGGGTCAACTGAGTGCGAGCATTGAGGTTACAGAAGTGTGAACAACCAAATTGTTTGACACACCAAGCCCTTATCCAGACAACCCATTTATATCCCCCGGATTTTGCACCCCGACCAAATCCGTCCGGTTAACATGGGAAACAAAACCAAGCCAATTTTTAAGGCAAGTGGTAATTGCCCCAGAGCCACAGGAACCTGGGGGTTTGGCCCTTCCCCTCCAGGACACGCCACAAGTGTCGCCTTGGAAGAAAAAATGACGTGGCCGCCTCCCgggggggggTTCAATAAGCAATAACCGCGGAACCTTCTCTATATAGAAATGGAAGGGGAAANGCCCCTCTTTTGATGGTCCCCCCTTTGGGGCGCGGCTCCGAAAAAAAGGCGGGTGCTTGTGGGTGTCGCGNTATATTAAAAAGGAAAAACTAATCCTCGGGAGAGCTTTTTGGGGGCCTTGGGGGAAAAAACACAATGCGGCAGCTTGTGGCACTCTCTTTATTGGAACAGGAACACTCTTGTGGTTGTGTGCGTGTAAAAACACGAT
  5   1   2       bld Em10 5g                         IMAGE:8319542.5p                                                                     GTCTGTCGGTACAGAGTGAGGAATTCAGTGCTCTGCACCAATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCAGCAGCAAGATTTAATAATTCACAATTTATGGGACCTCCTGTCACAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCCGGATTTGCACCCGANCAATCATCCGTTAAATGGAACAAACCAGCATTTTAAAGAGTGTAATCCAAAGCACAGTACTGGCTTGCCTCCCTCAGTCAGCCACGTCCCTGCAGCAATACTGCCTCCTGGTGTCATAGATACCGACTTCATAGATGAGGAAGTCCTTATGTCCTTGGTGATCNGAATGGTTTGGATCGTATAAAA
  5   1   2       bld Ga18 5g                           xlk121c23ex.5p                                                                         TCTGTCGGTACAGAGTGAGGAATTCAGTGCTNTNNNNATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGNCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATANNACCAGCAGCAAGATTTAATAATTCACAATTTATGGGACCTCCTGTCACAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCCGGATTTNCACCCGACAAATCATCCGTTAAATGGNNNAAACCAGCATTTTAAAGAGNGTAATCCAAAGNANAGTACTNGCTTGCTNCNTCAGTCAGC
  5   1   2      seed Ov1  5g3  in                    IMAGE:5074669.5p                                                                                     CCACGCGTCCGGTGCTCTGCACCAATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCAGCAGCAAGATTTAATAATTCACAATTTATGGGACCTCCTGTCACAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCCGGATTTGCACCCGACAAATCATCCGTTAAATGGAACAAACCAGCATTTTAAAGAGTGTAATCCAAAGCACAGTACTGGCTTGCCTCCC
  5   1   2       bld Ga12 5g                              XL187l22.5p                                                                                                        CACCAATATCATATTACTTGGTCTCTCCGCAGACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCAGCAGCAAGATTTAATAATTCACAATTTATGGGACCTCCTGTCACAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCCGGATTTGCACCCGACAAATCATCCGTTAAATGGAACAAACCAGCATTTTAAAGAGTGTAATCCAAAGCACAGTACTGGCTTGCCTCCCTCAGTCAGCCACGTCCCTGCAGCAATACTGCCTCCTGGTGTCATAGATACCGACTTCA
  5   1   2       bld Ooc1 5g3  in                     Ooc1-db29e10.y1                                                                                                                         GGGTCGACCCACGCGTCCGCAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGTGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCAGCAGCAAGATTTAATAATTCACAATTTATGGGACCTCCTGTCACAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCCGGATTTGCACCCGACAAATCATCCGTTAAATGGAACAAACCAGCATTTTAAAGAGTGTAATCCAAAGCACAGTACTGGCTTGC
  5   1   2       bld Egg6 5g3  in                    IMAGE:4435146.5p                                                                                                                                       GACTACAAAAGGGAGAGCTGCTGTTCTCTCCTGTATATTGGGATCTGGCTCCTGATCCTCTACAATCTGCATTTTTGGAGCGTTCTCGTGCGGAGTGCAATGGCAGACCACATGATGGCAATGAATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCAGCAGCAAGATTTAATAATTCACAATTTATGGGACCTCCTGTCACAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCATACAACCATTATATCCCGGATTTGCACCCGACGAATCATCCGTTAAATGGAACAAACCAGCATTTTAAAGAGTGTAATCCAAAGCACAGTACTGGC
  5   1   2       bld Egg6      in                    IMAGE:4412619.5p                                                                                                                                                                                                                                            GGCAGACCACATGATGGCAATGAATCATAGTCGGATTCAAGATGGAACAAATGGGCTTTATCACCCAGCCCATATGATGGGGATGGGTCAATTTACCAGTGCTCATCATCATGAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATC
  5   1   2       bld Neu7      out                        XL019i09.5p                                                                                                                                                                                                                                                                  AATCATAGTCGGTTTCAAGATGGAACAAATGGTCTTCATCACCCAGCCCATAGGATGGGGATGGGTCAATTTCCCAGTCCTCATCATCATCAGCACACCTTTAACAGTCTAATGGGAGAGCACATGCACTATGTACCAGGGAATATGAACTCTAACAATAGCATCAGACATGCCATGGTCACTGGGAATGTAAATGGCGGACATCCAAATGGCAGCATAGCACCAGCAGCAAGATTTAATAATTCACAATTTATGGGACCTCCTGTCACAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCCGGATTTGCACCCGACAA
  5   1   2       bld Ga18                               xlk52k15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAACAACCAATATTTTACACACCAGCCCTATCCACACAACCATTATATCCCGGATTTGCACCCGACAAATCATCCGTTAAATGGAACAAACCAGCATTTTAAAGAGTGTAATCCAAAGCACAGTACTGGCTTGNNNCCTCAGTCAGCCACGTCCCTGCAGCAATACTGCCTCCTGGTGTCATAGATACCNACTTCATAGATGAGGAAGTCCTTATGTCCTTGGTGATCGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAAAATGAGTTTGATTTTATGACAGACTTTGTTTGCAAACAGCCCAACAGAGTAAGCTGTTAGGTGTGTATATTAAGAAGATAAGAGACTTAGAACATTCCTTTATGGACACAGAACCTTTCTTCCAGAATCTGTTACAATCGTACAGGTTTTTTTCCCCCATCACATTTTCATAACTAAGCCAATAGTTTATTGGTTTGTTTCTTGTTTAGCTCACTCACATTTTTAAGATTTCTTANTTTCCATGTTACTGCAACAACACCATATGATAGATACAGTCTTTGATTGAATGGGCCTTTAGAGNNAGANTTTCTGCACTAACTCTGCCATATTGCTTCATTTAATCTATGCATTGCTGTGAACCATTTCCCCCCCATGTGTATGCTAAACTNGAANNTTAACAAACATGGGCTANGNCTTNNTGGATCAGGNAAAGTCCTACTGCTTNNTTAANTTNCCCNATTTCCTNNNNTTTCTCTNNAGCATGATGAGAT
  5   1   2       bld Egg1                               PBX0084B12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTCGTGCCGGGCTTGCCTCCCTCAGTCAGCCACGTCCCTGCAGCAATACTGCCTCCTGGTGTCATAGATACCGACTTCATAGATGAGGAAGTCCTTATGTCCTTGGTGATCGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAAAATGAGTTTGATTTTATGACAGACTTTGTTTGCAAACAGCCCAACAGAGTAAGCTGTTAGGTGTGTATATTAAGAAGATAAGAGACTTAGAACATTCCTTTATGGACACAGAACCTTTCTTCCAGAATCTGTTACAATCGTACAGGTTTTTTTCCCCCATCACATTTTCATAACTAAGCCAATAGTTTATTGGTTTGTTTCTTGTTTAGCTCACTCACATTTTTAAGATTTCTTATTTTCCATGTTACTGCAACAACACCATATGATAGATACAGTCTTTGATTGAATGGGCCTTTAGAGGCAGATTTTCTGCACTAACTCTGCCATATTGCTTCATTTAATCTATGCATTGCTGTGAACCATTTCCCCCCCATGTGTATGCTAAACTGGAAGTTTAACAAACATGGGCTAAGCCTTGCTGGATCAGGAAAAGTCCTACTGCTTATTTAATTTGCCCAATTTCCTCC
  5   1   2       bld Egg1                            IMAGE:4678431.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTACTGGCTTGCCTCCCTCAGTCAGCCACGTCCCTGCAGCAATACTGCCTCCTGGTGTCATAGATACCGACTTCATAGATGAGGAAGTCCTTATGTCCTTGGTGATCGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAAAATGAGTTTGATTTTATGACAGACTTTGTTTGCAAACAGCCCAACAGAGTAAGCTGTTAGGTGTGTATATTAAGAAGATAAGAGACTTAGAACATTCCTTTATGGACACAGAACCTTTCTTCCAGAATCTGTTACAATCGTACAGGTTTTTTTCCCCCATCACATTTTCATAACTAAGCCAATAGTTTATTGGTTTGTTTCTTGTTTAGCTCACTCACATTTTTAAGATTTCTTATTTTCCATGTTACTGCAACAACACCATATGATAGATACAGTCTTTGATTGAATGGGCCTTTAGAGGCAGATTTTCTGCACTAACTCTGCCATATTGCTTCATTTAATCTATGCATTGCTGTGAACCATTTCCCCCCCATGTGTATGCTAAACTGGAAGTTTAACAAACATGGGCTAAGCCTTGCTGGATCAGGAAAAGTCCTACTG
  3   1   2       bld Te2       in                    IMAGE:7391580.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTGGGTCTAATCCGCTCATGAGAGAATCCTATTCTGGTGATCGAATGGTTGATCTATAAAGAATACCTGAGTTTGCTAGACAAATGAGTTGATTTATGACAGACTTTGTTGCAAACAGCCCAACAGAGTAGCTGTTAGGTGTGTATATTAAGAAGATAAGAGACTTAGAACATTCCTTTATGGACACAGAACCTTTCTTCCAGAATCTGTTACAATCGTACAGGTTTTTTTCCCCCATCACATTTTCATAACTAAGCCAATAGTTTATTGGTTTGTTTCTTGTTTAGCTCACTCACATTTTTAAGATTTCTTATTTTCCATGTTACTGCAACAACACCATATGATAGATACAGTCTTTGATTGAATGGGCCTTTAGAGGCAGATTTTCTGCACTAACTCTGCCATATTGCTTCATTTAATCTATGCATTGCTGTGAACCATTTCCCCCCATGTGTATGCTAAACTGGAAGTTTAACAAACATGGGCTAAGCCTTGCTGGATCAGGAAAAGTCCTACTGCTTATTTAATTTGCCCAATTTCCTCCTCCTTTCTCTTCTAGCATGATGAGATTGGAGTAATGTTGGTGAGACACTTTTTTTTTTTTTTACATCCCTGAAAATGTTTTGACACTTACCTAGTTGATTTAGTTCATGGGAAAAATACTACTGTGTTAAAAGCTTTTTAGGAAAAATTTGACAGTATTTTGTCCAAAACATCAGTGGGATTATCCCATAACTAATCAACTGGAAGTCAAACTCA
  5   1   2       bld Egg1                               PBX0006C12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACGAGGGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAAAATGAGTTTGATTTTATGACAGACTTTGTTTGCAAACAGCCCAACAGAGTAAGCTGTTAGGTGTGTATATTAAGAAGATAAGAGACTTAGAACATTCCTTTATGGACACAGAACCTTTCTTCCAGAATCTGTTACAATCGTACAGGTTTTTTTCCCCCATCACATTTTCATAACTAAGCCAATAGTTTATTGGTTTGTTTCTTGTTTAGCTCACTCACATTTTTAAGATTTCTTATTTTCCATGTTACTGCAACAACACCATATGATAGATACAGTCTTTGATTGAATGAGCCTTTAGAGGCAGATTTTCTGCACTAACTCTGCCATATTGCTTCATTTAATCTATGCATTGCTGTGCACCATTTCCCCCCCATGTGTATGCTAAACTGGAAGTTTAACAAACATGGGCTAAGCCTTGCTGGATCAGGAAAAGTNCTACTGCTTATTTAATTTGCCCAATTTCCTCCTCCTTTCTCTTCTAGCATGATGAGGATGGAGTAATGTTGGTGAGACACttttttttttttttttACATCCCTGAAAATGTTTTGACACTTACCTAGTTGATTTAGTTCATGGGAAAAATACTACTGTGTTAAAAGCTTTTTAGGAAAAATTTGACAGT
  5   1   2       bld Egg1                               PBX0005D12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAAAATGAGTTTGATTTTATGACAGACTTTGTTTGCAAACAGCCCAACAGAGTAAGCTGTTAGGTGTGTATATTAAGAAGATAAGAGACTTAGAACATTCCTTTATGGACACAGAACCTTTCTTCCAGAATCTGTTACAATCGTACAGGTTTTTTTCCCCCATCACATTTTCATAACTAAGCCAATAGTTTATTGGTTTGTTTCTTGTTTAGCTCACTCACATTTTTAAGATTTCTTATTTTCCATGTTACTGCAACAACACCATATGATAGATACAGTCTTTGATTGAATGAGCCTTTAGAGGCAGATTTTCTGCACTAACTCTGCCATATTGCTTCATTTAATCTATGCATTGCTGTGCACCATTTCCCCCCCATGTGTATGCTAAACTGGAAGTTTAACAAACATGGGCTAAGCCTTGCTGGATCAGGAAAAGTCCTACTGCTTATTTAATTTGCCCAATTTCCTCCTCCTTTCTCTTCTAGCATGATGAGATTGGAGTAATGTTGGTGAGACACttttttttttttttttACATCCCTGAAAATGTTTTGACACTTACCTAGTTGATTTAGTTCATGGGAAAAATACTACTGTGTtaaaagctttttaagaaaaatttgacagtatttttgtacaaaacatttttttG
  5  -1   2       bld Tail                            IMAGE:8542817.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAACTACCTGAGCTTTGGCTTGGACAAAATGAGTTTGATTTTATGACAGACTTTGTTTGCAAACAGCCCAACAGAGTAAGCTGTTAGGTGTGTATATTAAGAAGATAAGAGACTTAGAACATTCCTTTATGGACACAGAACCTTTCTTCCAGAATCTGTTACAATCGTACAGGTTTTTTTCCCCCATCACATTTTCATAACTAAGCCAATAGTTTATTGGTTTGTTTCTTGTTTAGCTCACTCACATTTTTAAGATTTCTTATTTTCCATGTTACTGCAACAACACCATATGATAGATACAGTCTTTGATTGAATGGGCCTTTAGAGGCAGATTTTCTGCACTAACTCTGCCATATTGCTTCATTTAATCTATGCATTGCTGTGAACCATTTCCCCCCCATGTGTATGCTAAACTGGAAGTTTAACAAACATGGGCTAAGCCTTGCTGGATCAGGAAAAGTCCTACTGCTTATTTAATTTGCCCAATTTCCTCCTCCTTTCTCTTCTAGCATGATGAGATTGGAGTAATGTTGGTGAGACACtttttttttttttttACATCCCTGAAAATGTTTTGACACTTACCTAGTTGATTTAGTTCATGGGAAAAAGACTACTGTGTTAAAAGCTTTTTAGGaaaaatttgacagtatttttgtacaaaacattttttgagaaaatacttgttaatttattttaATTTGCCAATGTCAA
  5   1   2       bld Egg1      in                    IMAGE:4784117.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACTTAGAACATTCCTTTATGGACACAGAACCTTTCTTCCACAATCTGTTACAATCGTACAGGTTTTTTTCCCCCATCACATTTTCATAACTAAGCCAATAGTTTATTGGTTTGTTTCTTGTTTAGCTCACTCACATTTTTAAGATTTCTTATTTTCCATGTTACTGCAACAACACCATATGATAGATACAGTCTTTGATTGAATGAGCCTTTAGAGGCAGATTTTCTGCACTAACTCTGTTATATTGCTTCATTTAATCTATGCATTGCTGTGCACCATTTCCCCCCCATGTGTATGCTAAACTGGAAGTTTAACAAACATGGGCTAAGCCTTGCTGGATCAGGAAAAGTCCTACTGCTTATTTAATTTGCCCAATTTCCTCCTCCTTTCTCTTCTAGCATGATGAGATTGGAGTAATGTTGGTGAGACACtttttttttttttttttACATCCCTGAAAATGTTTTGACACTTACCTAGTTGATTTAGTTCATGGGAAAAATACTACTGTGTTAAAAGCTTTTTAGGAAAAATTTGACAGTATTTTT
  3   1   2       bld Egg6 5g3  in                    IMAGE:4435146.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTTACAATCGTACAGGTTTTTTTCCCCCATCACATTTTCATAACTAAGCCAATAGTTTATTGGTTTGTTTCTTGTTTAGCTCACTCACATTTTTAAGATTTCTTATTTTCCATGTTACTGCAACAACACCATATGATAGATACAGTCTTTGATTGAATGGGCCTTTAGAGGCAGATTTTCTGCACTAACTCTGCCATATTGCTTCATTTAATCTATGCATTGCTGTGAACCATTTCCCCCCCATGTGTATGCTAAACTGGAAGTTTAACAAACATGGGCTAAGCCTTGCTGGATCAGGAAAAGTCCTACTGCTTATTTAATTTGCCCAATTTCCTCCTCCTTTCTCTTCTAGCATGATGAGATTGGAGTAATGTTGGTGCGACACTTTTTTTTTTTTTTTTACATCCCTGAAAATGTTTTGACACTTACCTAGTTGATTTAGTTCATGGGAAAAATACTACTGTGTTAAAAGCTTTTTAGGAAAAATTTGACAGTATTTTTGTACAAAACATTTTTTGAGAAAATACTTGTTAATTT
  3   1   2       bld Egg1      in                    IMAGE:4784117.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGGTTTTTTTCCCCCATCACATTTTCATAACTAAGCCAATAGTTTATTGGTTTGTTTCTTGTTTAGCTCACTCACATTTTTAAGATTTCTTATTTTCCATGTTACTGCAACAACACCATATGATAGATACAGTCTTTGATTGAATGAGCCTTTAGAGGCAGATTTTCTGCACTAACTCTGCCATATTGCTTCATTTAATCTATGCATTGCTGTGCACCATTTCCCCCCCATGTGTATGCTAAACTGGAAGTTTAACAAACATGGGCTAAGCCTTGCTGGATCAGGAAAAGTCCTACTGCTTATTTAATTTGCCCAATTTCCTCCTCCTTTCTCTTCTAGCATGATGAGATTGGAGTAATGTTGGTGAGACACTTTTTTTTTTTTTTTTTACATCCCTGAAAATGTTTTGACACTTACCTAGTTGATTTAGTTCATGGGAAAAATACTACTGTGTTAAAAGCTTTTTAGGAAAAATTTGACAGTATTTTTGTACATAACATTTTTTGAGAAAATACTTGTTAGTTTATTTTAATTGTGCCAATGTCAATAAAGAGATGTAAAGTGAAAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5074669.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACAACCCCATATGATAGATACAGTCTTTGATTGAATGGGCCTTTAGAGGCAGATTTTTTGCCCTAACTTTGCCATATTGGTTCATTTAATTTATGCATTGCTGTGAACCATTTCCCCCCCATGTGTATGGTAAACTGGAAGTTTAACAAACATGGGGTAAACCTTGCTGGATCAGGAAAAGTCCTACTGCTTATTTAATTTGCCCAATTTCCTCCTCCTTTTTTTTTTAGCATGATGAGATTGGGGTAATGTTGGTGAGACCCTTTTTTTTTTTTTTTTCATCCCCGAAAAAGTTTTGACCCTTACCTAGTTGATTTAGTTCATGGGAAAAATATTTCTGTGTTAAAAGCTTTTTTGGAAAAATTTGCCAGTATTTTTGTTCAAAACATTTTTTGGGAAAATACTTGTTAATTTATTTTAATTTGCCAATGTCAATAAAGGGATGTAAAGTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Ooc1 5g3  in                     Ooc1-db29e10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGATTGAATGGGCCTTTAGAGGCAGATTTTCTGCACTAACTCTGCCATATTGCTTCATTTAATCTATGCATTGCTGTGAACCATTTCCCCCCCATGTGTATGCTAAACTGGAAGTTTAACAAACATGGGCTAAGCCTTGCTGGATCAGGAAAAGTCCTACTGCTTATTTAATTTGCCCAATTTCCTCCTCCTTTCTCTTCTAGCATGATGAGATTGGAGTAATGTTGGTGAGACACTTTTTTTTTTTTTTACATCCCTGAAAATGTTTTGACACTTACCTAGTTGATTTAGTTCATGGGAAAAATACTACTGTGTTAAAAGCTTTTTAGGAAAAATTTGACAGTATTTTTGTACAAAACATTTTTTGAGAAAATACTTGTTAATTTATTTTAATTTGCCAATGTCAATAAAGAGATGTAAAGTGAAAAAAAAAA
  3   1   2       bld Ooc1 5g3  in                     Ooc1-db29c09.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTGAATGGGCCTTTAGAGGCAGATTTTCTGCACTAACTCTGCCATATTGCTTCATTTAATCTATGCATTGCTGTGAACCATTTCCCCCCCATGTGTATGCTAAACTGGAAGTTTAACAAACATGGGCTAAGCCTTGCTGGATCAGGAAAAGTCCTACTGCTTATTTAATTTGCCCAATTTCCTCCTCCTTTCTCTTCTAGCATGATGAGATTGGAGTAATGTTGGTGAGACACTTTTTTTTTTTTTTTACATCCCTGAAAATGTTTTGACACTTACCTAGTTGATTTAGTTCATGGGAAAAATACTACTGTGTTAAAAGCTTTTTAGGAAAAATTTGACAGTATTTTTGTACAAAACATTTTTTGAGAAAATACTTGTTAATTTATTTTAATTTGCCAATGTCAATAAAGAGATGTAAAGTGAAAAAAAAAA
  3   1   2       bld Egg6      in                    IMAGE:4412619.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTTCTGCACTAACTCTGCCATATTGCTTCATTTAATCTATGCATTGCTGTGAACCATTTCCCCCCCATGTGTATGCTAAACTGGAAGTTTAACAAACATGGGCTAAGCCTTGCTGGATCAGGAAAAGTCCTACTGCTTATTTAATTTGCCCAATTTCCTCCTCCTTTCTCTTCTAGCATGATGAGATTGGAGTAATGTTGGTGCGACACTTTTTTTTTTTTTTACATCCCTGAAAATGTTTTGACACTTACCTAGTTGATTTAGTTCATGGGAAAAANTACTACTGTGTTAAAAGNCTTTTTAGGAAAAATTTGACAGTATTTTTGTACAAAACATTTTTTGAGAAAATACTTGTTAATTT
  3   1   2       bld Egg6                            IMAGE:4412621.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTTCTGCACTAACTCTGCCATATTGCTTCATTTAATCTATGCATTGCTGTGAACCATTTCCCCCCCATGTGTATGCTAAACTGGAAGTTTAACAAACATGGGCTAAGCCTTGCTGGATCAGGAAAAGTCCTACTGCTTATTTAATTTGCCCAATTTCCTCCTCCTTTCTCTTCTAGCATGATGAGATTGGAGTAATGTTGGTGCGACACTTTTTTTTTTTTTTACATCCCTGAAAATGTTTTGACACTTACCTAGTTGATTTAGTTCATGGGAAAAATACTNNACTGTGTTAAAAGNCTTTTTAGGAAAAATTTGACAGTATTTTTGTACAAAACATTTTTTGAGAAAATACTTGTTAATTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)