Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xl278c14.3                           32 PI      90        575     1328                (no blast hit)

 This cluster: approximate FL confidence score = 16%

 1012770154 Xl3.1-IMAGE:6877940.3 - 40 ESTs
                                                                       ....-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6877940.3                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCAGTGTTTCCGGAGTGGTTGAAAGTATCATCCGTTGTTGAAGCCGCACGGCATTTGCGCCGCCTAAGGGCTCCCCTCCTTCCGGACATGGCGTCCGAGGACGAGGTGAGTGAGTTCCTGGGTCAAAATCCTGAAACAGCGGCGTGGTTGGAGCGTGTCCGCGGGCAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAGGGAGAGATCCCGCCGCCCCCTGAGACCAACCACAAGGAGTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCATTCAAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGATCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGGAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAAGAGAGAGGCACACTCAAGAACAGATGTAAACACAGAATTCTATGAAGAGTCAGGTAATGGCCGGCCTCTGCCTGTGTCCAAAGCTAAATCTAGTTTGAATCCTCCAGAAGAAGCAGGATATAAACATGCTGCTACTCAGGGGAGAAAAAGCCATTCTGACAGTCGATATCAAACAGCGGTTAAAGGTCCGTCCCAATCTAGCGATAATGCTCTCAAAACTACTCGCCGTTTCACTACAGAACATACCAAAGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAGCTACTTAACACCTCTATTGAATCTCTAAAGGCCACACTAGAGATTGCTTTTGTTCCACTGAAAGACCTGGCAGATTTCCCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGAATGGGCTGCGGAAAGACAATGGACACTGCCAAAGCTGTCGCTTTCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTTGAAAGAACAAAATTTAAAAGGACTGGGTACTTTGTACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTATATTTTTTCAGTTTTACAAGGGATATACCACATACTAACATTTTGCTTCAGAGCGTAAGAGCTGTATTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGAAAAAATTATTGGTTTGATTTTAGTATGATTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATTGCAATCCATAAGTGATTGCATACATTTTCCTTCTTATGGTAAGGTTCCTGAAATAAAAATGTTGAATTTAATTTAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012687190                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTCCGGAGTGGTTGAAAGTATCATCCGTTGTTGAAGCCGCACGGCATTTGCGCCGCCTAAGGGCTCCCCTCCTTCCGGACATGGCGTCCGAGGACGAGGTGAGTGAGTTCCTGGGTCAAAATCCTGAAACAGCGGCGTGGTTGGAGCGTGTCCGCGGGCAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAGGGAGAGATCCCGCCGCCCCCTGAGACCAACCACAAGGAGTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCATTCAAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGATCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGGAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAAGAGAGAGGCACACTCAAGAACAGATGTAAACACAGAATTCTATGAAGAGTCAGGTAATGGCCGGCCTCTGCCTGTGTCCAAAGCTAAATCTAGTTTGAATCCTCCAGAAGAAGCAGGATATAAACATGCTGCTACTCAGGGGAGAAAAAGCCATTCTGACAGTCGATATCAAACAGCGGTTAAAGGTCCGTCCCAATCTAGCGATAATGCTCTCAAAACTACTCGCCGTTTCACTACAGAACATACCAAAGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAGCTACTTAACACCTCTATTGAATCTCTAAAGGCCACACTAGAGATTGCTTTTGTTCCACTGAAAGACCTGGCAGATTTCCCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGAATGGGCTGCGGAAAGACAATGGACACTGCCAAAGCTGTCGCTTTCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTTGAAAGAACAAAATTTAAAAGGACTGGGTACTTTGTACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTATATTTTTTCAGTTTTACAAGGGATATACCACATACTAACATTTTGCTTCAGAGCGTAAGAGCTGTATTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGAAAAAATTATTGGTTTGATTTTAGTATGATTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATTGCAATCCATAAGTGATTGCATACATTTTCCTTCTTATGGTAAGGTTCCTGAAATAAAAATGTTGAATTTAATTTAAAAAxxA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                  2     2     2     3     2     3     3     6     4     8     4     8     6    10     6    11     8    13     8    14     9    14     9    14     9    14     9    14     9    14     9    14     9    14     9    14     9    14     9    14     7    12     7    12     6    12     7    14     7    14     7    15     8    15     8    15     8    15     8    15     8    15     8    15     8    16    10    17    10    17    10    17    16    17    16    18    16    17    16    17    16    17    16    17    16    17    16    17    15    17    16    17    16    16    16    16    16    16    16    16    16    16    15    16    16    17    16    17    16    16    15    16    16    16    15    16    13    16    14    16    15    17    16    17    11    16    12    15     9    15    10    13    11    14    11    14    10    14    10    13    10    13    10    13    11    14     9    14    10    14    10    14     8    11     9    12     9    11     9    11     9    11    10    12    11    13    12    14    12    14    12    14    12    14    12    14    12    14    12    14    12    13    12    13    13    14    13    14    13    13    13    13    13    13    14    14    14    14    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    17    16    17    15    16    16    17    16    17    16    17    16    17    16    17    15    17    14    17    15    15    14    14    13    13    12    12    12    12    12    12    12    12    12    12     9    12     9    12     9    12     9    12     9    12     9    12     8    11     8    11     8    11     8    11     8    11     8    11     7    10     6     9     3     5     3     5     2     4     2     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGTCCGAGGACGAGGTGAGTGAGTTCCTGGGTCAAAATCCTGAAACAGCGGCGTGGTTGGAGCGTGTCCGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGCAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAGGGAGAGATCCCGCCGCCCCCTGAGACCAACCACAAGGAGTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCATTCAAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGAATTCAAGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAACATTTTGCTTCGGAGCGTAAGAGCTGTATTGGATTGCCTTAAATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTATGAAAAAATTATTGGTTTGATTTTAGTATGATTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATTGCAATCCATAAGTGATTGCATACATTTTCCTTCTTA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             A----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------T--
                                               BLH ATG      88      14                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH MIN     438      67                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH OVR    1095      18                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               EST CLI      36       1                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xb ==== 1e-024     ACC55002.1 ARF-collaborative protein [Xenopus borealis] ==========================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN -== Bt ==== 1e-033     NP_001039608.1 CDKN2A interacting protein [Bos taurus] =========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dr ---- 2e-042     NP_001006085.1 zgc:101658 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PREDICTED - Mm ---- 2e-063     NP_765995.1 RIKEN cDNA 4921511I16 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                PREDICTED - Cf ---- 1e-063     XP_849962.1 PREDICTED: similar to collaborates/cooperates with ARF (alternate reading frame) protein [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                PREDICTED - Gg ---- 4e-064     XP_001232632.1 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Hs ---- 6e-065     NP_060102.1 hypothetical protein FLJ20036 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Xl ---- 0          NP_001083190.1 hypothetical protein LOC398792 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6877940.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGA---------------------------------------------------------------------TGA------------------TGA---------------------------------------------------------------TAG------------------------TGA---------------------------------TGA---------------------------------------------------------------------------------------------------------TAA---------------TAA------TGA---------------------TGATGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------TAA------------TAA---------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------ATG---------TAA---------TAA---------TGA------------------------------------------------------------ATG------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                    ]
  5   1   2       bld Emb1 5x3                        IMAGE:5161725.5p                                                                                                                                                                                                         TTAACCACCATGTTCTTGGCTTATGACCCAGGTAATTATAGACGAGAATGGCATGATTCAGTGATATGGGTTTTATAACAAGACAATAACGCCAGTAGATGTGTATTCATACAGTATATGATCTACTAACAAAGTGCAGAATGCAAAAAAGGCACATCTAGCCTTCCCAAAATCCCAACTCTTTCGTCCCTAGGAACCTTGGTCATGTAACCAAGGCGCTACACGGCGCACGTGCAACATCCGGGTCAGTGTTTCCGGAGTGGTTGAAAGTATCATCCGTTGTTGAAGCCGCACGGCATTTGCGCCGCCTAAGGGCTCCCTTCCTTCCGGACATGGCGTCCGAGGACGAGGTGAGTGAGTTCCTGGGTCAAAATCCTGAAACAGCGGCGTGGTTGGAGCGTGTCCGCGGGCAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAGGGAGAGATCCCGCCGCCCCCTGAGACCAACCACAAGGAGTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCATTCAAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGNGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGATCATGGGGGCAAGAGAGAGCTCTTACATTTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCC
  5   1   2       bld Em10 5x3                        IMAGE:7982300.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCAGTGTTTCCGGAGTGGTTGAAAGTATCATCCGTTGTTGAAGCCGCACGGCATTTGCGCCGCCTAAGGGCTCCCCTCCTTCCGGACATGGCGTCCGAGGACGAGGTGAGTGAGTTCCTGGGTCAAAATCCTGAAACAGCGGCGTGGTTGGAGCGTGTCCGCGGGCAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAGGGAGAGATCCCGCCGCCCCCTGAGACCAACCACAAGGAGTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCATTCAAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGATCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGGAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAAGAGAGAGGCACACTNCAGAACAGATGTAAACACAGAATTCTATGAAGAGTCAGGTAATGGCCCGGCTCTGCCTGTGTCAAAGCAAATCTAGTTTGATCCTCAGAAGAAGCAGATATAACATGCTGCTACTCGGGGAGAAAAGCATTCTGCC
  5   1   2       bld Egg3 5x3                        IMAGE:6326398.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATTCCCGGGCCGGAGTGGTTGTACGATCATCCGTTGTTGAAGCCGCACGGTACTTGCGCCGCCTAAGGGCTCCCCTCCTTCCGGACATGGCGTCCGAGGACATTTGAGCGAAAAAAAGGGTTTCAATCCTGATACAGCGGCGTGGTTGGAGCGTGTCCGCGGGCAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAGGGAGAGATCCCGCCGCCCCCTGAGACCAACCACAAGGAGTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCTTTTATGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGATCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGGAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAAGAGAGAGGCACACTCAAGAACAGATGTAAACACAGAATTCTATGAAGAGTCAGGTAATGGCCGGCCTCTGCCTGTGTCCAAAGCTAAATCTAGTTTAAATCCTCCAGAAGAAGCAGGATATAAACATGCTGCTACTCAGGGGAGAAAAAGCCATTCTGACAGTCGATATCAAACAGCGGTTAAAGGTCCGTCCCAATCTAGCGATAATGCTCTCAAAACTACTCGCCGTTTTCACTACAGAACATACCCAAAGAAAGGCAGGCCTTTCTTTAACCAGACTCTACAAAACCGTGGGCTTGGGAAACT
  5   1   2       bld Ga12 5g3  in                         XL198d13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCACGAGGCTCCCCTCCTTCCGGACATGGCGTCCGAGGACGAGGTGAGTGAGTTCCTGGGTCAAAATCCTGAAACAGCGGCGTGGTTGGAGCGTGTCCGCGGGCAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAGGGAGAGATCCCGCCGCCCCCTGAGACCAACCACAAGGAGTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCATTCAAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGAATTCAAGTAGCAATGAAGGGGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGATCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGGAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAAGAGAGAGGCACACTCAAGAACAGATGTAAACACAGAATTCTATGAAGAGTCAGGTAATGGCCGGCCTCTGCCTGTGTCC
  5   1   2       bld Kid                             IMAGE:4033187.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGGCTCCCCTCCTTCCGGATATGGCGTCCGAGGACGAGGTGAGTGAGTTCCTGGGTCAAAATCCTGAAACAGCGGCGTGGTTGGAGCGTGTCCGCGGGCAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAGGGAGAGATCCCGCCGCCCCCTGAGACCAACCACAAGGAGTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCATTCAAGTTATAGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGAATTCAAGTAGCAATGAAGGGGTAGAAGAGTTACCACGCAAGAAGAAAAAATCCAATGATCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGGAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAAGAGAGAGGCACACTCAAGAACAGATGTAAACACAGAATTCTATGAAGAGTCAGGTAATGGCCGGCCTCTGCCTGTGTCCAAAGCTAAATCTAGTTTGAATCCTCCAGAAGAAGCAGGATATAAACATGCTGCTACTCAGGGGAGAAAAAGCCATTCTGACAGTCGATATCCAACAGCGGTTAAAGGTCCGTCCCAATCTAGCGATAATGCTCTCAAACCTACTCGCCGGTTCACTACAGAACATACCAAAGAAAGGCAGCCTTTCTTTTAACAGACTCTACAAAACAGTGGGCTTGGGAAACTC
  5   1   2       bld Ga12 5g3  in                         XL158a07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTTGAAGCCGCACGGCATTTGCGGCGCCTAAGGGCTCCCCTCCTTCCGGACATGGCGTCCGAGGACGAGGTGAGTGAGTTCCTGGGTCAAAATCCTGAAACAGCGGCGTGGTTGGAGCGTGTCCGCGGGCAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAGGGAGAGATCCCGCCGCCCCCTGAGACCAACCACAAGGAGTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCATTCAAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGAATTCAAGTAGC
  5   1   2       bld Ga12 5g3  in                         XL214l04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGAGGGCCGCACGGCATTTGCGCCGCCTAAGGGCTCCCCTCCTTCCGGACATGGCGTCCGAGGACGAGGTGAGTGAGTTCCTGGGTCAAAATCCTGAAACAGCGGCGTGGTTGGAGCGTGTCCGCGGGCAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAGGGAGAGATCCCGCCGCCCCCTGAGACCAACCACAAGGAGTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCATTCAAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGATCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGGAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAAGAGAGAGGCACACTCAAGAACAGATGTAAACACAGAATTCTATGAAGAGTCAGGT
  5   1   2       bld DMZ  5g3  in                         xl312d11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCCCCTCCTTCCGGACATGGCGTCCGAGGACGAGGTGAGTGAGTTCCTGGGTCAAAATCCTGAAACAGCGGCGTGGTTGGAGCGTGTCCGCGGACAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAGGGAGAGATCCCGCCGCCCCCTGAGACCAACCACAAGGAGTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCATTCAAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGAATTCAAGTAGCAATGAAGGGGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGATCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGGAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAAGAGAGAGGCACACTCAAGAACAGATGTAAACACAGAATTCTATGAAGAGTCAGGTAATGGCCGGCCTCTGCCTGTGTCCAATGCTAAATCTAGTTTGAATCCTCCAGAAGAAGCAGGATATAAACATGCTGCTACTCAG
  5   1   2       bld DMZ  5g3  in                         xl330a10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGCTCCCCTCCTTCCGGACATGGCGTCCGAGGACGAGGTGAGTGAGTTCCTGGGTCAAAATCCTGAAACAGCGGCGTGGTTGGAGCGTGTCCGCGGGCAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAGGGAGAGATCCCGCCGCCCCCTGANACCAACCACNAGGAGTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCATTCAAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGATCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCANAAACCANCCAGGTGATGCAAGGGAGAGATCATCTGGAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAAGAGAGAGGCACACTCAAGAACAGATGTAAACACNGAATTCTATGAAGAGTCAGGTAATGGCCGGCCTCTGCCTGTGTCCAAAGCTAAATCTAGTTTGAATCCTCCAGAAGAAGCAGGATATAAACATGCTGCTACTCAC
  5   1   2       bld Ga15 5g3  in                       XL415k06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCTCCCCTCCTTCCGGACATGGCGTCCGAGGACGAGGTGAGTGAGTTCCTGGGTCAAAATCCTGAAACAGCGGCGTGGTTGGAGCGTGTCCGCGGGCAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAGGGAGAGATCCCGCCGCCCCCTGAGACCAACCACAAGGAGTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCATTCAAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGATCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGGAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAANAGAGAGGCACACTCAAGAACAGATGTAAACACAGAATTCTATGAAGAGTCAGGTAATGGCCGGCCTCTGCCTGTGTCCAATGCTAAATCTAGTTTGAATCCTCCANAANAANCANGATATAAACATGCTGCTACTCANGGGAGAAAAAGCCATTCTGACAGTCNATATCAA
  5   1   2       bld Kid                    IMAGE:4033187-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGAGTGAGTTCCTGGGTCAAAATCCTGAAACAGCGGCGTGGTTGGAGCGTGTCCGCGGGCAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAGGGAGAGATCCCGCCGCCCCCTGAGACCAACCACAAGGAGTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCATTCAAGTTATAGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGAATTCAAGTAGCAATGAAGGGGTAGAAGAGTTACCACGCAAGAAGAAAAAATCCAATGATCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGGAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAAGAGAGAGGCACACTCAAGAACAGATGTAAACACAGAATTCTATGAAGAGTCAGGTAATGGCCGGCCTCTGCCTGTGTCCAAAGCTAAATCTAGTTTGAATCCTCCAGAAGAAGCAGGATATAAACATGCTGCTACTCAGGGGGAGAAAAAGCCATTCTGACAGTCGATATCAAACAGCGGTTAAAGGTCCGTCCCAATCTAGCGATAAATGCTCTCAAACCTACTCGCCGTTTCACTACAGAACATACCAAAGAAAGGCAGCCCTTTCTTTAACAGACTCTACAAAACAGTGGGCTTGGAAACTTTGTATCTGCTGGGGGGTTTTCAATG
  5   1   2       bld Ga15      in                       XL461o07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCCGCCGAGGACGAGGTGAGTGAGTTCCTGGGTCAAAATCCTGAAACAGCGGCGTGGTTGGAGCGTGTCCGCGGGCAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAG
  5   1   2       bld Ga15      in                       XL513b04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGAGGACGAGGTGAGTGAGTTCCTGGGTCAAAATCCTGAAACAGCGGCGTGGTTGGAGCGTGTCCGCGGGCAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAGGGAT
  5   1   2       bld Lens                                 BM928996.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGAAACAGCGGCGTGGTTGGAGCGTGNCCGCGGGCAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAGGGAATTTATTCTCCGGAACCTGAGTGATGTGTGCGGGGAGGGAGAGATCCCGCCGCCCCCTGAGACCAACCACAAGGAGTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCATTCAAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGAATTCAAGTAGCAATGAAGGGGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGAGCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGGAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAAGAGAGAGGCACACTCAAGAACAGATGTAAACACAGAATTCTATGAAGAGTCAGGTAATGGCCGGCCTCTGCCTGTGTCCAAAGCTAAATCTAGNTTGAATCCTCCAGAAGAAGCAGGATATAAACATGCTGCTACTCANGGGGAGAAAAAGCCATTCTGACAGTCGATATCAAACAGCGGGTAAAGGTCCGTCCCAATCTAGCGATAATGCTCTCAAACCTACTCGNC
  3  -1   2       chi Ga11                            IMAGE:3475238.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAAAAGCTGGAGCCCAGCTTGCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGCAGATCTCAATTCCCCGGGAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGAATTCAAGTAGCAATGAAGGGGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGATCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGGAAAAATCTGTGATGGTTCTATTCCATCTACTAGTCTAAATAAGAGAGAGGCACACTCAAGAACAGATGTAAACACAGAATTCTATGAAGAGTCAGGTAATGGCCGGCCTCTGCCTGTGTCCAAAGCTAAATCTAGTTTGAATCCTCCAGAAGAAGCAGGATATAAACATGCTGCTACTCAGGGGAGAAAAAGCCATTCTGACAGTCCATATCAAACAGCGG
  5   1   2       bld Tad1      in                    IMAGE:6877940.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACTCTATGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCATTCAAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGAATTCAAGTAGCAATGAAGGGGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGATCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGGAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAAGAGAGAGGCACACTCAAGAACAGATGTAAACACAGAATTCTATGAAGAGTCAAGTAATGGCCGGCCTCTGCCTGTGTCCAAAGCTAAATCTAGTTTTGATCCTCCAGAAAAAGCAGGATATAAACCTGCTGCTACTCAGGGGAAAAAAACCATTCTTAACATCCATATCAACAGCGGTTAAAAGTCCGCCCCAATCTAGCGATAATGGTCTCAAACTACCCGCCGTTTTCCTCCCAAACTTACCAAAGAAAAGGCAGCCtttttttttAAAGACCTCCACCAAAACAAGGGCTTTGGAAAACTTTATTCTGCCCGGGGGGTTTTAAAGGCCaacccccccacccaggaaaagacttcctttacccccccctatttgaaacccccaaagagcgcccccccTATAAGAAATGGCTTTTCTGTTCCCCCTTTAAAAAAGACCTCGGGCGAAAATTTTCCTCCCaaaaaaaaaaaC
  5   1   2       bld Ov1       in                    IMAGE:5073248.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACGCGTCCGGTGTGGGCCAATCATGTGTTCACCGGCTGCAGGTACCCCATTCAAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGATCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGGAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAAGAGAGAGGCACACTCAAGAACAGATGTAAACACAGAATTCTATGAAGAGTCAGGTAATGGCCGGCCTCTGCCTGTGTCCAAAGCTAAATCTAGTTTGAATCCTCCAGAAGAAGCAGGATATAAACATGCTGCTACTCAGGGGAGATAAAGCCATTCTGACAGTCGATATCAAACAGCGGTTAAAGGTCCGTCCCAATCTAGCGATAATGCTCTCAAAACTACTCGCCGTTTCACTACAGAACATACCAAAGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGG
  5   1   2       bld Egg1                               PBX0088B11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGAGGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGAGCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGAAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAGAACAGATGTAAACACAGAATTCTATGAAGAGTCAGGTAATGGCCGGCCTCTGCCTGTGTCCAAAGCTAAATCTAGTTTGAATCCTCCAGAAGAAGCAGGATATAAACATGCTGCTACTCAGGGGAGAAAAAGCCATTCTGACAGTCGATGTCAAACAGCGGTTAAAGGTCCGTCCCAATCTAGCGATAATGCTCTCAAACCTACTCGCCGTTTCACTACAGAACATACCAAAGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGG
  5   1   2       bld Egg1                               PBX0105A08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGAGCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGAAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAGAACAGATGTAAACACAGAATTCTATG
  5   1   2       bld DMZ       in                         xl279o23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAATGAAGGGGTAGAAGAGTTACCACGCAAGAAGCAAAAATCCAATGAGCATGGGGCAAGAGAGAGCTCTTACATTGACGACACAGTAGAAATCAGAAACCAGCCAGGTGATGCAAGGGAGAGATCATCTGGAAAAATCTGTGATGGTTATATTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAGAACAGATGTAAACACAGAATTCTATGAAGAGTCAGGTAATGGCCGGCCTCTGCCTGTGTCCAAAGCTAAATCTAGTTTGAATCCTCCAGAAGAAGCAGGATATAAACATGCTGCTACTCAGGGGAGAAAAAGCCATTCTGACAGTCGATGTCAAACAGCGGTTAAAGGTCCGTCCCAATCTAGCGATAATGCTCTCAAACCTACTCGCCGTTTCACTACAGAACATACCAAAGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAGCTACTTAACACCTCTATTGAATCTCTAAAGGCCACACTAGAGATTGCTTTTGTTCCACTGAAAGACCTGGCAGATTTCCCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGAATGGGCTGCGG
  3   1   2       bld DMZ  5g3  in                         xl312d11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAAGAACAGATGTAAACCCCAGAATTCTATGAAGAGTCAGGTAATGGCCGGCCTCTGCCTGTGTCCAATGCTAAATCTAGTTTGAATCCTCCAGAAGAAGCAGGATATAAACATGCTGCTACTCAGGGGAGAAAAAGCCATTCTGACAGTCGATATCAAACAGCGGTTAAAGGTCCGTCCCAATCTAGCGATAATGCTCTCAAAACTACTCGCCGTTTCACTACAGAACATACCAAAGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAGCTACTTAACACCTCTATTGAATCTCTAAAGGCCACACTAGAGATTGCTTTTGTTCCACTGAAAGACCTGGCAGATTTCCCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGAATGGGCTGCGGAAAGACAATGGACACTGCCAAAGCTGTCGCTTTCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTGAAAGAAGAAAATTAAAAGGAC
  5   1   2       bld Ooc1      in                      xlnoc003p15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGTCAGGTAATGGCCGGCCTCTGCCTGTGTCCAAAGCTAAATCTAGTTTGAATCCTCCAGAAGAAGCAGGATATAAACATGCTGCTACTCAGGGGAGAAAAAGCCATTCTGACAGTCGATATCAAACAGCGGTTAAAGGTCCGTCCCAATCTAGCGATAATGCTCTCAAACCTACTCGCCGTTTCACTACAGAACATACCAAAGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAGCTACTTAACACCTCTATTGAATCTCTAAAGGCCACACTAGAGATTGCTTTTGTTCCACTGAAAGACCTGGCAGATTTCCCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGAATGGGCTGCGGAAAGACAATGGACACTGCCAAAGCTGTCGCTTT
  3   1   2       bld Ga15 5g3  in                       XL415k06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTGCCTGTGTCCAATGCTAAATCTAGTTTGAATCCTCCAGAAGAAGCAGGATATAAACATGCTGCTACTCAGGGGAGAAAAAGCCATTCTGACAGTCGATATCAAACAGCGGTTAAAGGTCCGTCCCAATCTAGCGATAATGCTCTCAAAACTACTCGCCGTTTCACTACAGAACATACCAAAGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAGCTACTTAACACCTCTATTGAATCTCTAAAGGCCACACTAGAGATTGCTTTTGTTCCACTGAAAGACCTGGCAGATTTCCCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGAATGGGCTGCGGAAAGACAATGGACACTGCCAAAGCTGTCGCTTTCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTTGAAAGAAGAAAATTTAAAAGGACTGGGTACTTGACTATAA
  3   1   2       bld Ga12 5g3  in                         XL198d13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCAGAAGAAGCAGGATATAACCATGCTGCTACTCAGGGGAGAAAAAGCCATTCTGACAGTCGATATCAAACAGCGGTTAAAGGTCCGTCCCAATCTAGCGATAATGCTCTCAAAACTACTCGCCGTTTCACTACAGAACATACCAAAGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAGCTACATAACACCTCTATTGAATCTCTAAAGGCCACACTAGAGATTGCTTTTGTTCCACTGAAAGACCTGGCAGATTTCCCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGAATGGGCTGCGGAAAGACAATGGACACTGCCAAAGCTGTCGCTTTCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTTGAAAGAAGAAAATTTAAAAGGACTGGGTACTTTGTACTTATAAAACATCAG
  3   1   2       bld DMZ  5g3  in                         xl330a10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGGGGAGAAAAAGCCATTCTGACAGTCGATATCAAACAGCGGTTAAAGGTCCGTCCCAATCTAGCGATAATGCTCTCAAAANTACTCGCCGTTTCACTACAGAACATACCAAAGAAAGGCAGCCTTTCTTTANCAGACTNTACAAANCAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAGCTACTTAACACCTCTATTGAATCTCTAAAGGCCACACTAGAGATTGCTTTTGTTCCACTGAAAGACCTGGCAGATTTCCCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGAATGGGCTGCGGAAAGACAATGGACACTGCCAAAGCTGTCGCTTTCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTGANAGAAGAAAATTAAAAGGA
  3   1   2      seed Tad1      in                    IMAGE:6877940.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTTAAAGGTCCGTCCCAATCTAGCGATAATGCTCTCAAAACTACTCGCCGTTTCACTACAGAACATACCAAAGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAGCTACTTAACACCTCTATTGAATCTCTAAAGGCCACACTAGAGATTGCTTTTGTTCCACTGAAAGACCTGGCAGATTTCCCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGAATGGGCTGCGGAAAGACAATGGACACTGCCAAAGCTGTCGCTTTCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTTGAAAGAACAAAATTTAAAAGGACTGGGTACTTTGTACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTATATTTTTTCAGTTTTACAAGGGATATACCACATACTAACATTTTGCTTCAGAGCGTAAGAGCTGTATTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGAAAAAATTATTGGTTTGATTTTAGTATGATTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATTGCAATCCATAAGTGATTGCATACATTTTCCTTCTTATGGTAAGGTTCCGG
  5   1   2       bld Gas8      in                    IMAGE:3516951.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACCAAAGAAAGGCACCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAGCTACTTAACACCTCTATTGAATCTCTAAAGGCCACACTAGAGATTGCTTTTGTTCCACTGAAAGACCTGGCAGATTTCCCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGAATGGGCTGCGGAAAGACAATGGACACTGCCAAAGCTGTCGCTTTCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATGTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAAATTCGACCTCCAAACTTACCTGCAGCAGTAAAAAACCCTCATGAACTTGTG
  3   1   2       bld Ga15      in                       XL461o07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTNCTGGGGGTTTCAATGCCAACCTCANCCNCGAAGAGGGTACTTAACNCCTGCTATTGAATCTCTAAAGGCCACTCTNGAGATTGCTTTTGTTCCTCTGAAAGACCTGGCAGATTTCCCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCNGTTTATNTAGGAATGGGCNNCGGAAAGACAATGGNCACTGCCAAAGGCTGTCGCTTTCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGNTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAANCCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTNGAAAGAACAAAATTAAAAGGACTG
  3   1   2       bld DMZ       in                         xl279o23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GNTTCAATGCCANCCTCAACCATGAAGAGCTACTTAACACCTCTATTGAATCTCTAAAGGCCACACTAGAGATTGCTTTTGTTCCACTGAAAGACCTGGCAGATTTCCCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGAATGGGCTGCGGAAAGACAATGGACACTGCCAAAGCTGTCGCTTTCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTTGAAAGAACAAAATTTAAAAGGACTGGGTACTTTGTACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTATATTTTTTCAGTTTTACAAGGGATATACCACATACTAACATTTTGCTTCAGAGCGTAAGAGCTGTATTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGAAAAAATTATTGGTTTGATTTTAGTATGATTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATTGCAATCCATAAGTGATTGCATACATTT
  3   1   2       bld Ga15      in                       XL513b04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTATTGGAATCTCTAAAGGCCACACTAGAGATTGCTTTTGTTCCACNGAAAGACCTGGCAGATTTCCCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGAATGGGCTGCGGAAAGACAATGGACACTGCCAAAGCTGTCGCTTTCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTTGAAAGAACAAAATTTAAAAGGACTGGGTACTTTGTACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTATATTTTTTCAGTTTTACAAGGGATATACCACATACTAACATTTTGCTTCAGAGCGTAAGAGCTGTATTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGAAAAAATTATTGGTTTGATTTTAGTATGATTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATTGCAATCCATAAGTGATTGCATACATTTTCCTTCTTATGGTAAG
  3   1   2       bld Ga12 5g3  in                         XL214l04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTAAAGGCCACACTAGAGATTGCTTTTGTTCCACTGAAAGACCTGGCAGATTTCCCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGAATGGGCTGCGGAAAGACAATGGACACTGCCAAAGCTGTCGCTTTCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTTGAAAGAAGAAAATTTAAAAGGACTGGGTACTTTGTACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTATATTTTTTCAGTTTTACAAGGGATATACCACATACTTACTAACATTTTGCTTCGGAGCGTAAGAGCTGTATTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGAAAAAATTATTGGTTTGATTTTAGTATGATTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATTGCAATCCATAAGTGATTGCATACATTTTCCTTCTTATGGTAAGGT
  3   1   2       bld Ooc1      in                      xlnoc003p15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACTAGAGATTGCTTTTGTTCCACTGAAAGACCTGGCAGATTTCCCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGAATGGGCTGCGGAAAGACAATGGACACTGCCAAAGCTGTCGCTTTCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTTGAAAGAAGAAAATTTAAAAGGACTGGGTACTTTGTACTTATTAAAACATCAGGTTTAATTTAA
  5   1   2       bld Egg1                               PBX0106F12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCTGCGGAAAGACAATGGACACTGCCAAAGCTGTCGCTTTCCGGGAAGCTGTATAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTTGAAAGAACAAAATTTAAAAGGACTGGGTACTTTGTACTTATTAAAACATCAGGtttattttatttgaaatatttatattttttcagttttaCAAGGGATATACCACATACTAACATTTTGCTTCAGAGCGTAAGAGCTGTATTGGATTGCCTTAAATTGCtttatgtggttttatgaaaaaattattggtttgattttagtatgatttttaattaaaatggTCTTTAACCTTGTAAATGATTGCAATCCATAAGTGATTGCATACATTTTCCTTCTTAT
  3   1   2       bld Ov1       in                    IMAGE:5073248.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGGAAAGACAATGGACACTGCCAAAGCTGTCGCTTTCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGATGTAGTTAGAATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTTGAAAGAACAAAATTTAAAAGGACTGGGTACTTTGTACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTATATTTTTTCAGTTTTACAAGGGATATACCACATACTAACATTTTGCTTCAGAGCGTAAGAGCTGTATTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGAAAAAATTATTGGTTTGATTTTAGTATGATTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATTGCAATCCATAAGTGATTGCATACATTTTCCTTCTTATGGTAAGGTTCCTGAAATAAAAATGTTGAATTTAATTTAAAAAAAAAAAAAAAG
  3   1   2       bld Ov1                             IMAGE:5048049.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTTGAAAGAAGAAAATTTAAAAGGACTGGGTACTTTGTACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTATATTTTTTCAGTTTTACAAGGGATATACCACATACTTACTAACATTTTGCTTCGGAGCGTAAGAGCTGTATTGGATTGCCTTAAATTGCTTAATGTGGTTTTATGAAAAAATTATTGGTTTGATTTTAGTATGATTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATTGCAATCCATAAGTGATTGCATACATTTTCCTTCTTATGGTAAGGTTCCTGAAATAAAAAAGTTGAATTTAAAA
  5   1   2       bld Ga15      in                       XL485p22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTTGAAAGAACAAAATTTAAAAGGACTGGGTACTTTGTACTTATTAAAACATCAGGtttattttatttgaaatatttatattttttcagttttaCAAGGGATATACCACATACTAACATTTTGCTTCAGAGCGTAAGAGCTGTATTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGAAAAAATTATTGGTTTGATTTTAGTATGATTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATTGCAATCCATAAGTGATTGCATACATTTTCCTTCTTATGGTAAGGTTCCTgaaataaaaatgttgaatttaatttaaaaatcataataaatagctaataattanaaaaaaaaaaaaaaaaaaaaaaNAANACCNNANANNNNA
  3   1   2       bld Ga15      in                       XL485p22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATATGCAGAAGAAAATTTAATGGCCGTGACGTGGAGGACTTGGTACTTGTTGACGAGGAATTTCGACCTCCAAACTTACCTCCAGCAGTAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTTGAAAGAACAAAATTTAAAAGGACTGGGTACTTTGTACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTATATTTTTTCAGTTTTACAAGGGATATACCACATACTAACATTTTGCTTCAGAGCGTAAGAGCTGTATTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGAAAAAATTATTGGTTTGATTTTAGTATGATTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATTGCAATCCATAAGTGATTGCATACATTTTCCTTCTTATGGTAAGGTTCCTGAAATAAAAATGTGAA
  3   1   2       bld Ga12 5g3  in                         XL158a07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCAGTAAAAAACCCTCATGAACTTGTGTAACAAGAGATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTTGAAAGAACAAAATTTAAAAGGACTGGGTACTTTGTACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTATATTTTTTCAGTTTTACAAGGGATATACCACATACTAACATTTTGCTTCAGAGCGTAAGAGCTGTATTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGAAAAAATTATTGGTTTGATTTTAGTATGATTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATTGCAATCCATAAGTGATTGCATACATTTTCCTTCTTATGGTAAGGTTCC
  3   1   2       bld Gas8      in                    IMAGE:3516951.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATTTCTTTGTTGGGTGGAAAGAACAACATTTAAACAGAACTTGTGTAAAAGAGATTTCTTCCTTAGGTTGAAAGAAGAAAATTTAAAAGGACTGGGTACTTTGTACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTATATTTTTTCAGTTTTACAAGGGATATACCACATACTTACTAACATTTTGCTTCGGAGCGTAAGAGCTGTATTGGATTGCCTTAAATTGCTTAATGTGGTTTTATGAAAAAATTATTGGTTTGATTTTAGTATGATTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATTGCAATCCATAAGTGATTGCATACATTTTCCTTCTTATGGTAAGGTTCCTGAAATAAAAAAGTTGAATTTAAAAAAAAAAAAAAA
  5   1   2       bld Gas5                            IMAGE:3747516.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGACTGGGTACTTTGTACTTATTAAAACATCAGGtttattttatttgaaatatttatattttttcagttttaCAAGGGATATACCACATACTAACATTTTGCTTCAGAGCGTAAGAGCTGTATTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGAAAAAATTATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)