Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl317n06.3                           34 END     4          12       11                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:8073664.5                       9 END     3           9       33                (no blast hit)
     3   1.0    0Xl3.1-IMAGE:5162252.3                       7 END     1           3       14                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4   0.0    0Xl3.1-xl317n06.3                           34 PI      79        915     1347                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012770201 Xl3.1-IMAGE:6954461.5 - 31 ESTs
                                                                       ..-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6954461.5                       CACGAGCTCCCTAAAGCAACTCCATTCCAGCAATTACTGAGTAGTGCGTAGGGAGAAGTTGACGGGGTTAGTGCGAGATGTCACTTAATAAGAACCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAAAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGACCAGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCGAATGCTATGGGATACCCGTATGCTCCGCCACCAGGACCTGGCATGTATCCACCCCCTCCTGAAATGAATCCCATTTACATGGCTCCTCCACCACCTTATCCTGGACCCCCGTACAATGGGACCCCCTACAATGGAACCCCAGCACCTTCTGCTCCCACTGGATGCATGAATGCTGGTATGCCTGGAGGTAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAACCCAGCTGACCCTCACAATGTCTATATGCCTATGGATCGTCCTCCTCCATACGCTCCAAATGATGATAAAAAGAACAATTAAACATCAAATCCTGAGCCCACTGCTACATTGTCTATGCATCTGTCTGTAGCTGGATGTCCTGTTTTATGTCCACCTGGTGTAGCCCAGACCATAGCACCCCACATGTGACTTCCTGGTAACAAGTTGTTAGTAGTGAAACATTTTGAAGAGTGTTGGAACTATTTATGCAAGGCAGAATAAATTATTTCATCCAGAAACTTTTTTCCCCCCCCACTGGTAGTCTCTCCAAAATAAACGACAAAATCCTTTGCAAAGAAGGTCGATGATCGCTGTCGGCTAATCCTGTTCTTTTAAAGGGCCTTGATAAAATCATGTTCATGCATTTGCACATCCTATCTAATTACTGTCAGGATTGATATAGAAATAGAAAGAAGAAAATGAATTACCATCTTTTCACAAGGAC
                                                  Xl3.1-CHK-1012687955                             CTCCCTAAAGCAACTCCATTCCAGCAATTACTGAGTAGTGCGCAGGGAGAAGTTGAxGGxxTTAGTGCGAGATGTCACTTAATAAGAACCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAAAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGACCAGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCGAATGCTATGGGATACCCGTATGCTCCGCCACCAGGACCTGGCATGTATCCACCCCCTCCTGAAATGAATCCCATTTACATGGCTCCTCCACCACCTTATCCTGGACCCCCCTACAATGGGACCCCCTACAATGGAACCCCAGCACCTTCTGCTCCCACTGGATGCATGAATGCTGGTATGCCTGGAGGTAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAACCCAGCTGACCCTCACAATGTCTATATGCCTATGGATCGTCCTCCTCCATACGCTCCAAATGATGATAAAAAGAACAATTAAACATCAAATCCTGAGCCCACTGCTACATTGTCTATGCATCTGTCTGTAGCTGGATGTCCTGTTTTATGTCCACCTGGTGTAGCCCAGACCATAGCACCCCACATGTGACTTCCTGGTAACAAGTTGTTAGTAGTGAAACATTTTGAAGAGTGTTGGAACTATTTATGCAAGGCAGAATAAATTATTTCATCCAGAAACTTTTTTCCCCCCCCACTGGTAGTCTCTCCAAAATAAACGACAAAATCCTTTGCAAAGAAGGTCGATGATCGCTGTCGGCTAATCCTGTTCTTTTAAAGGGCCTTGATAAAATCATGTTCATGCATTTGCACATCCTATCTAATTACTGTCAGGATTGATATAGAAATAGAAAGAAGAAAATGAATTACCATCTTTTCACAAGGACCTTTGA
                                                      consensus depths                            2     3     2     3     3     5     3     5     7    12    13    21    18    22    19    22    20    23    22    23    23    23    23    23    23    23    22    23    23    23    23    23    23    23    24    24    24    24    24    24    24    24    24    25    24    25    23    25    25    25    25    25    25    25    24    25    24    25    24    25    24    24    23    24    24    24    22    24    23    24    24    24    24    24    24    25    24    25    24    25    23    25    23    25    22    24    20    22    19    22    20    22    19    21    18    20    17    20    18    20    19    22    18    22    18    22    17    22    18    22    15    21    15    20    16    20    15    19    15    19    13    19    12    17    11    15     8    14     9    14     8    12     7    12     8    12     8    12     6    12     4    12     5    11     5    10     5    10     4    10     4     9     4     8     4     7     4     6     4     6     4     6     4     5     4     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     6     3     6     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4
                                                                   SNP                                                                       C-----------
                                                                   SNP                                                                                   --A---T-----
                                                                   SNP                                                                                                           -C------G---
                                                                   SNP                                                                                                                       ----T-------
                                                                   SNP                                                                                                                                                                                   ----------G-
                                                                   SNP                                                                                                                                                                                                                                   G-----------
                                                                   SNP                                                                                                                                                                                                                                                           T---------T-
                                                                   SNP                                                                                                                                                                                                                                                                                   -C--------G-
                                                                   SNP                                                                                                                                                                                                                                                                                               ----G--T----
                                                                   SNP                                                                                                                                                                                                                                                                                                           ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                   --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                           ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                           ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                       -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                   --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                               --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                           -T--------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -A------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----C----C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AT----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------A---C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -T------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -A--T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---C-------A
                                               BLH ATG      75     518                       
                                               BLH MIN      75     104                       
                                               BLH MPR      75     104                       
                                               BLH OVR      75      83                       
                                               EST CLI      49      40                       
                                               ORF LNG      75       4                       
  5   1   2       chi Te1                             IMAGE:6930853.5p GGGGCCCACATTTTGGTCACATGGAAGTGACATCACGTAAGCAACTCCATTCCAGCAATTACTCAGTACGTAGGGAGAAGTTGACGGGGTTAGTGCGAGATGTCACTTAATAAGAACCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAAAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGGACCAGGCGGGGTACCCCTCCAGCTCCAGGAATATATACAccccccacccccAACCATCAGGGCCCTTTTCCCATATGGGAACCCCCTGGCTATTGAATGGGATATGGGACCACCCTCCCAAATGCTATGGGGAAAACCCGTTATTGCTccccccccccGGGAGGCAGCCAAAAGCCCCAGAAACCCGCCTTCCATTGG
  5   1   2       bld Emb4 5g3  out                   IMAGE:4201822.5p                       CACGAGCTCCCTAAAGCAACTCCATTCCAGCAATTACTGAGTAGTGCGCAGGGAGAAGTTGAAGGCTTTAGTGCGAGATGTCACTCAATAAGGACCACTCTCAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTGTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAGAGGCACAAAGAAAGGATCGCTATTTCTCACCGCTTACAGGGTGATCTTCCTAAACAAGGGGAAGGATCCCATGATGTCCTTTAATATGCCATTCTACATGATGAAAGGATGCTCCATAGAACAGCCAAGTGTTTCTCTGCCAAACTACATCAAGGGG
  5   1   2       bld Te2  5g                         IMAGE:7391849.5p                       CACGAGCTCCCTAAAGCAACTCCATTCCAGCAATTACTGAGTAGTGCGCAGGGAGAAGTTGAAGGCTTTAGTGCGAGATGTCACTCAATAAGGACCACTCTCAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTGTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAGAGGCACAAAGAAAGGATCGCTATTTCTCACCGCTTACAGGGTGATCTTCCTAAACAAGGGGAAGGATCCCATGATGTCCTTTAATATGCCATTCTACATGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGGTGGCTGGGAGGGTCAAGCCTCTTTTAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTGTGCTTCCAGAACCCCTCCTGTTCCTCATGCTGCATATGGATACACACCTGCTCCAGGAGGCTATGCACATGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCTATGGGATACCCGTATGCTCCACCAGCAGGACCTGGCATGTATCCACCCCCTCCTGAAATGAATCCATTTACATGGCTCCTCCCACACCTTATCTGGACCC
  5   1   2       bld Oo1  5g                         IMAGE:6640777.5p                                       CAACTCCATTCCAGCAATTACTGAGTAGTGCGCAGGGAGAAGTTGAAGGCTTTAGTGCGAGATGTCACTCAATAAGGACCACTCTCAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTGTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAGAGGCACAAAGAAAGGATCGCTATTTCTCACCGCTTACAGGGTGATCTTCCTAAACAAGGGGAAGGATCCCATGATGTCCTTTAATATGCCATTCTACATGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGGTGGCTGGGAGGGTCAAGCCTCTTTTAAAATTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTGTGCTTCCAGAACCCCTCCTGTTCCTCATGCTGCATATGGATACACACCTGCTCCAGGAGGCTATGCACATGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCTATGGGATACCCGTATGCTCCACCAGCAGGACCTGGCATGTATCCACCCCCTCCTGAAATGAATCCCATTTACATGGCTCCTCCCACACCTTATCCTGGACCCCCCTACAATGGGACCCCCTACAATGGAACCCCAGCACCTTCTGCTCCCACTGGATGCATGAATGCTGGTATGCCTGGAGGTAGCAAAGCTGCAAAAGCTGCATCCAGTGGCGTATTATAACCCAGCTGACCCTCACAATGTCTATATGGCCTATGGGATCGTCCTCCTCCATACGCTTCCAAATGATGATTAAAA
  5   1   2       bld Te1  5g                         IMAGE:6928029.5p                                               GGATTCCAGCAATTACTCAGTACGTAGGGAGAAGTTGACGGTGTTAGTGCGAGATGTCACTTAATAAGAACCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAGAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGACCAGGCGGGTACCCTCCAGCTCCAGGAATATATACaccccccaccccaaccatcaggccccttatccatatgggaccccccTGCTTATGAATGGGATATGGGACCACCCTCCAAAATGCTTATGGGGGATACCCCCGTTATGGCTTCCCGCCCACCCAGGTTAGGGACCCTGGGGCCATGGTTATtccccattccccccctcccTTGGAAT
  5   1   2       bld Eye1 5g                         IMAGE:6957790.5p                                                            TGAGTAGTGCGCAGGGAGAAGTCGAAGGCTTTAGTGCGAGATGTCACTCAATAAGGACCACTCTCAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTGTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAGAGGCACAAAGAAAGGATCGCTATTTCTCACCGCTTACAGGGTGATCTTCCTAAACAAGGGGAAGGATCCCATGATGTCCTTTAATATGCCATTCTACATGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGAGGGCTGGGAGGGTCAAGCCTCTTTTAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTGTGCTTCCAGAACCCCTCCTGTTCCTCATGCTGCATATGGATACACACCTGCTCCAGGAGGCTATGCACATGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCTATGGGATACCCGTATGCTCCACCAGCAGGACCTGGCATGTATCCACCCCCTCCTGAAATGAATCCCATTTACATGGCTCCTCCACCACCTTATCCTGGACCCCCCTACAATGGGGACCCCCTACAATGGAACCCCAGCACCTTTCTGCTCCCACTGGATGCATGAATGCCTGGTATGCCCTGGGAGGTAGCAAAACTGCAAGAAGCTGCATCCAGTGCCGTAATTATAACCCCAGCTGAACCCTCACAATGGTCCTATATTGCTTATGGGATCGTCCCT
  5   1   2       bld Ov1  5g                         IMAGE:8329572.5p                                                            TACTCAGTACGTAGGGAGAAGTTGACGGGGTTAGTGCGAGATGTCACTTAATAAGAACCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAGAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGACCAGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCGAATGCTATGGGATACCCGTATGCTCCGCCACCAGGACCTGGCATGTATCCACCCCCTCCTGAAATGAATCCCATTTACATGGCTCCTCCACCACCTTA
  5   1   2       bld Brn1 5g                         IMAGE:6954461.5p                                                             ACTCAGTACGTAGGGAGAAGTTGACGGGTTTAGTGCGAGATGTCACTTAATAAGAACCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAAAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGACCAGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCGAATGCTATGGGATACCCGTATGCTCCGCCACCAGGACCTGGCATGTATCCACCCCCTCCTGNAATGAATCCCATTTACATGGCTCCTCCACCACCTTATCCTGGACCCCCGTATAATGGACCCCCATATAATGGAACCCCAGCACCTTCAGCTCCCTCTGGATCCATGGATACTGGTATGCCTGGGAGGCAGCAAAGCCACAGAAGCAGCATCCCGTGCATATTAAAAACCCCAGCTGGACCCGCACCAATGTGGTACATGC
  5   1   2       bld Te1  5g                         IMAGE:6930292.5p                                                               GGGAGTACGTAGGGAGAAGTTGACGGGGTTAGTGCGAGATGTCACTTAATAAGAACCACTCACAGGGGGCCGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAAAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGACCAGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCGAATGCTATGGGATACCCGTATGCTCCGCCACCAGGACCTGGCATGTATCCACCCCCTCCTGAAATGAATCCCATTTACATGGCTCCTCCACCACCTTATCCTGGACCCCCGTATA
  5   1   2       bld Sp1  5g                         IMAGE:5513516.5p                                                               CTCAGTACGTAGGCATTATTGACGGGTTTAGTGCGAGATGTCACTTAATAAGAACCTTTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAAAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGCAGGATATGGACCAGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCCTTATCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCGAATGCTATGGGATACCGTATGCTCCGCCACCGNACTTGGCATGTATCCACCCCTCCTGAAATGAATCCATTTACATGGCTCTCCACAACTTATCTGGACCCCGTATATGACCCCCTAAAAGAACCCGCCCTTCGC
  5   1   2       bld Ga12      in                         XL168a01.5p                                                                      TACGTAGGGAGAAGTTGACGGGGTTGTGCGAGATGTACTTAATAAGAACCACTCACAGGGGGCCGGGATATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAAAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGACCAGGCGGGTACCCTCCA
  5   1   2      seed Ga12 5g3  out                        XL204i20.5p                                                                       GAGGGAGAAGTTGACGGGGTTAGTGCGAGATGTCACTTAATAAGAACCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAAAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGACCAGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCGAATGCTATGGGATACCCGTATGCTCCGCCACCAGGACCTGGCATGTATCCACCCCCTCCTGAAATGAATCCCATTTACATGGCTCCTCCACCACCTTATCCTGGACCCCC
  5   1   2       bld Gas7 5g                IMAGE:3747713-IMAGp.IMAGp                                                                          CGAGAAGTTGACGGGGTTAGTGCGAGATGTCACTTAATAAGAACCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAAAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGACCAGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCGAATGCTATGGGATACCCGTATGCTCCGCCACCAGGACCTGGCATGTATCCACCCCCTCCTGAAATGAATCCCATTTACATGGCTCCTCCACCACCTTATCCTGGACCCCCGTATAATGGACCCCCATATAATGGAACCC
  5   1   2       bld Te2  5g                         IMAGE:7207254.5p                                                                          GGAGAAGTTGAAGGCTTTAGTGCGAGATGTCACTCAATAAGGACCACTCTCAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTGTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAGAGGCACAAAGAAAGGATCGCTATTTCTCACCGCTTACAGGGTGATCTTCCTAAACAAGGGGAAGGATCCCATGATGTCCTTTAATATGCCATTCTACATGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGGTGGCTGGGAGGGTCAAGCCTCTTTTAAAATTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTGTGCTTCCAGAACCCCTCCTGTTCCTCATGCTGCATATGGATACACACCTGCTCCAGGAGGCTATGCACATGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCTATGGGATACCCGTATGCTCCACCAGCAGGACCTGGCATGTATCCACCCCCTCCTGAAATGAATCCATTTACATGGCTCCTCCACACCTTATCCTGGACCCCCTACATGGGACCCCTACATGGAACCCAGCACTTCTGCTCCACTGGAGCATGATGCTGTATGCTGGAGTACAAGCTGCAAGCTGCTCAGTGGTTATAACACTGAC
  5   1   2       bld Oo1  5g                         IMAGE:6643861.5p                                                                           GAGAAGTTGAAGGCTTTAGTGCGAGATGTCACTCAATAAGGACCACTCTCAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTGTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAGAGGCACAAAGAAAGGATCGCTATTTCTCACCGCTTACAGGGTGATCTTCCTAAACAAGGGGAAGGATCCCATGATGTCCTTTAATATGCCATTCTACATGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGGTGGCTGGGAGGGTCAAGCCTCTTTTAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTGTGCTTCCAGAACCCCTCCTGTTCCTCATGCTGCATATGGATACACACCTGCTCCAGGAGGCTATGCACATGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCCACCCCACCATCAGGCCCTTATCCATATGGACCCCCCTGCTATGAATGGATATGGACCCACCTCCAAAATCCTATGGGGATACCCCGTATGCTCCCCCCGCCAGGAACCTGGGCATGTAATTCACCCCCCTTCTGAAAATGAAATCCCCATTTTAACTGGGNTTCTTCCACCAACCTTTATCCCGGGAAcccccccctttaaaatgggggacccccccttaacaatgggaaaccccccaggcacccttttggggctccccccccTGGGAAATGGCCTGGGAAAGGGCT
  5   1   2       bld Lu1                             IMAGE:4633243.5p                                                                             GACGCGTGGGCGGGTTTAGTGCGAGATGTACTTATAAGAACCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAAAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGNGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTNTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATA
  5   1   2       bld Emb4 5g                         IMAGE:5514303.5p                                                                              AAGTTGACGGGGCTAGTGCGAGATGTCACTTAATAAGAACCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAGAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGACCAGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCGAATGCTATGGGATACCCGTATGCTCCGCCACCAGGACCTGGCATGTATCCACCCCCTCCTGAAATGAATCCCATTTACATGGCTCCTCCACCACCTTATCCTGGACCCCCGTATAATGGACCCCCATATAATGGAACCCCAC
  5   1   2       bld Lu1       out                   IMAGE:4633270.5p                                                                                GCGTGGGCGGTTTAGTGCGAGATGTACTTAATAAGAACCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAAAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGACCAGGCGGGTACCCTCCAGCTCCAGGA
  5   1   2       bld Emb4 5g                         IMAGE:5542988.5p                                                                                GTTGACGGGGTTAGTGCGAGATGTCACTTAATAAGAACCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAGAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGACCAGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCGAATGCTATGGGATACCCGTATGCTCCGCCACCAGGACCTGGCATGTATCCACCCCCTCCTGAAATGAATCCCATTTACATGGCTCCTCCACCACCTTATCCTGGACCCCCCGTATAATGGACCCCCATATAATGGAACCCCAGCACCTTCAGCTCCCTCTGGATCCATGGNATACTGGGTATGCCTGGAGGCAGCAAAGCCACAGAAGCAGCATCCAGTGCATATTATAACCCAGCTGACCCGCACCATGTGTACCTTCCCCTATGGGATCGTCC
  5   1   2       bld Ga12 5g3  out                        XL180p20.5p                                                                                GTTGACGGGGTTAGTGCGAGATGTCACTTAATAAGAACCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGCAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAAAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGACCAGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCGAATGCTATGGGATACCCGTATGCTCCGCCACC
  5   1   2       bld Gas5 5g3  out                   IMAGE:3747713.5p                                                                                 TTGACGGGGTTAGTGCGAGATGTCACTTAATAAGAACCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAAAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACG
  5   1   2       bld Oo1  5g3  out                   IMAGE:5078004.5p                                                                                           TAGTGTTAGATGTCACTCAATAAGGACCACTCTCAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTGTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAGAGGCACAAAGAAAGGATCGCTATTTCTCACCGCTTACAGGGTGATCTTCCTAAACAAGGGGAAGGATCCCATGATGTTCTTTAATATGCCATTCTACATGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGGTGGCTGGGAGGGTCAAGCCTCTTTTAAAATTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTGTGCTTCCAGAACCCCTCCTGTTCCTCATGCTGCATATGGATACACACCTGCTCCAGGAGGCTATGCACATGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCTATGGGATACCCG
  5   1   2       bld Oo1                             IMAGE:5078010.5p                                                                                                                     CCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAAAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGACCAGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATGCTATGGGATACCCGTATGCTCGGCCACCAGGACCTGGCATGTATCCATCCCCT
  5   1   2       bld Ga12                                 XL205i20.5p                                                                                                                                                                                                                                   AAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATANAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAANACCTCTTTTAAACTTACATTTNACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCANAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTNCCTCATGCTGCATATGGATACACTCC
  5   1   2       bld Int2      out                   IMAGE:8822167.5p                                                                                                                                                                                                                                                                                   TACTTTTTTGAAAGTTCACAATATTTACAAAATCGTCCCTGCCATTCTACATGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGGTGGCTGGGAGGGTCAAGCCTCTTTTAAAATTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTGTGCTTCCAGAACCCCTCCTGTTCCTCATGCTGCATATGGATACACACCTGCTCCAGGAGGCTATGCACATGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCTATGGGATACCCGTATGCTCCACCAGCAGGACCTGGCATGTATCCACCCCCTCCTGAAATGAATCCCATTTACATGGCTCCTCCACCACCTTATCCTGGACCCCCCTACAATGGGACCCCCTACAATGGAACCCCAGCACCTTCTGCTCCCACTGGATGCATGAATGCTGGTATGCCTGGAGGTAGCAAAGCTGCATAAGCTGCATCCAGTGCGTATTATAACCCAGCTGACCCTCACAATGTCTATAATGCCTATGGATCGTCCTTCCTCCATACGCTCCAAATGATGATAAAAGAACATTTAAACATCCATATCCTGAACCTACCTGCAC
  3   1   2       bld Ga12      in                         XL168a01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGACAAATCATGTTNAAAATGGNAANTTNTGNTTNCCAGAGCCCNTCNTGTTCNTCATGNTGCATATGGATACANTCNTGNTGCAGGAGGATATGGACCAGGNGGGTACCNTCCAGNTCCAGGAATATATACACCCCCACCCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCGAATGCTATGGGATACCCGTATGCTCCGCCACCAGGACCTGGCATGTATCCACCCCCTCCTGAAATGAATCCCATTTACATGGCTCCTCCACCACCTTATCCTGGACCCCCGTATAATGGACCCCCATATAATGGAACCCCAGCACCTTCAGCTCCCTCTGGATCCATGGATACTGGTATGCCTGGAGGCAGCAAAGCCACAGAAGCAGCATCCAGTGCATATTATAACCCAGCTGACCCGCACAATGTGTACATGCCTATGGATCGTCCACCTCCATATGCTCCCTATGAGGATAAGAAGAACAATTAAACATCAAATCCGGAGCCCACTGCTACATTGCCTATACATCTCTCTGTAACTGTCCTGTTTTATGTCCACCTGGTGTAGCCCAGACCAGCTTGATAACCATTGCACCCCACATGAGACATCCTGCTAATAGGTTGTTAGTAGTGATACATTTTGAAGAGTATGTGGAACTATTTACAGTAGTAAGGCAGA
  5   1   2       bld Brn1                            IMAGE:6955491.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCTATGGGATACCCGTATGCTCCACCAGCAGGACCTGGCATGTATCCACCCCCTCCTGAAATGAATCCCATTTACATGGCTCCTCCACCACCTTATCCTGGACCCCCCTACAATGGGACCCCCTACAATGGAACCCCAGCACCTTCTGCTCCCACTGGATGCATGAATGCTGGTATGCCTGGAGGTAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAACCCAGCTGACCCTCACAATGTCTATATGCCTATGGATCGTCCTCCTCCATACGCTCCAAATGATGATAAAAAGAACAATTAAACATCAAATCCTGAGCCCACTGCTACATTGTCTATGCATCTGTCTGTAGCTGGATGTCCTGTTTTATGTCCACCTGGTGTAGCCCAGACCATAGCACCCCACATGTGACTTCCTGGTAACAAGTTGTTAGTAGTGAAACATTTTGAAGAGTGTTGGAACTATTTATGCAAGGCAGAATAAATTATTTCATCCAGTAACTTTcccccccccACTGGTAGTCTCTTCAAAATAAACGACAAAATCCTTTGCAAAGAAGGTCGATGATCACTGTCTGCTAATCCTGTTCTTTTAAAGGGCCTTGATAAAATCATGTTCATGCATTTGCACAGCCTATCTAATTACTGTCAGGATTGATATAGAAATAGAAAGAAGAAAATGAATTACCATCTTTTCACAAGGACCTTTTGAAAAGTCTTTCAAGTTATGGCTGCTATAGGAGATGGAGTTATCCGCCATGGNGCCTAAAATATTACTGGCCCATAGAGGTTTAAAGACCCTCCTCCATAAACTAATAGTG
  5  -1   2       add Em10                            IMAGE:7980689.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTACTTACAAAGGGGACATTTACTGCTAGAAAATGTTGGTTTAGAAACAAAATATGTAGTGTATTAGCATTTATTTTCAGTAGGACNTGGCATGTATCCATCCCCTCCTGAAATGAATCCCATTTACATGGCTCCTCCACCACCTTATCCTGGACCCCCGTATAATGGACCTCCGTATAATGGAACCCCAGCACCTTCAGCTCCTTCTGGATCCATGGATACTGGAATGCCTGGTGAGTTCTAGTAAAATGTTTTGACTTGCTCTCTTTTGTCACAAAATATTCAGTACTGGTGCTTTTGGGGAAACGGCTTTTGGACATTTGAGCAGTGGTTAGCTCAGCCCATGAGCTTTAGTTTTGTGGATTTCTTGAAGGAGAAGGTATTGTATGACCACTGTCTGAAAATATTGTGCAGTAGGTTCTGATGCATTGTGTTGTTTTTTGTTTTAAAGGAGGCAGCAAAGCCACAGAAGCAGCATCCAGTGCATATTATAACCCAGCTGACCCGCACAATGTGTACATGCCTATGGTGAGTTCATCATTTTGTATTAATATAATGCAGTGGTGTTATTTGCAATTTGTTAATCAGACCTGTCTTTTCTACAGGATCGTCCACCTCCATATGCTCCCTATGAGGATAAGAAGAACAATTAAACATCAAATCCGGAGCCCACTGCTACATTGCCTATACATCTCTCTGTAACTGTCCTGTTTTATGTCCACCTGGTGTAGCCCAGACCAGCTTCATAACCATTGCACCCCACATGAGAC
  5   1   2       add Tad1                            IMAGE:6937308.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTGGACCCCCCTACAATGGGACCCCCTACAATGGAACCCCAGCACCTTCTGCTCCCACTGGATGCATGAATGCTGGTATGCCTGGAGGTAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAACCCAGCTGACCCTCACAATGTCTATATGCCTATGGATCGTCCTCCTCCATACGCTCCAAATGATGATAAAAAGAACAATTAAACATCAAATCCTGAGCCCACTGCTACATTGTCTATGCATCTGTCTGTAGCTGGATGTCCTGTTTTATGTCCACCTGGTGTAGCCCAGACCATAGCACCCCACATGTGACTTCCTGGTAACAAGTTGTTAGTAGTGAAACATTTTGAAGAGTGTTGGAACTATTTATGCAAGGCAGAATAAATTATTTCATCCAGAAACTTTTTTccccccccACTGGTAGTCTCTCCAAAATAAACGACAAAATCCTTTGCAAAGAAGGTCGATGATCGCTGTCGGCTAATCCTGTTCTTTTAAAGGGCCTTGATAAAATCATGTTCATGCATTTGCACATCCTATCTAATTACTGTCAGGATTGATATAGAAATAGAAAGAAGAAAATGAATTACCATCTTTTCCCAAGGAACTTTTGAAAGGTCTTCCCAGTTATGGGCTGCTATAGAAGATTGGAGTTATCCCGCCATTGGTGGCTAAAAAATTACCTGCCCCATAAAAATTTAAAGGACCTTCTTCCATAAACTTATAATTGGGTCCAGGGTCCCAACCTTGGCATTCCTTTTAAGGAAGAAAATAAAATTTATTTTCCTGGTTC
  5   1   2       add Int2                            IMAGE:8526580.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGGGACCCCCTACAATGGAACCCCAGCACCTTCTGCTCCCACTGGATGCATGAATGCTGGTATGCCTGGAGGTAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAACCCAGCTGACCCTCACAATGTCTATATGCCTATGGATCGTCCTCCTCCATACGCTCCAAATGATGATAAAAAGAACAATTAAACATCAAATCCTGAGCCCACTGCTACATTGTCTATGCATCTGTCTGTAGCTGGATGTCCTGTTTTATGTCCACCTGGTGTAGCCCAGACCATAGCACCCCACATGTGACTTCCTGGTAACAAGTTGTTAGTAGTGAAACATTTTGAAGAGTGTTGGAACTATTTATGCAAGGCAGAATAAATTATTTCATCCAGAAACTTTTTTccccccccACTGGTAGTCTCTCCAAAATAAACGACAAAATCCTTTGCAAAGAAGGTCGATGATCGCTGTCGGCTAATCCTGTTCTTTTAAAGGGCCTTGATAAAATCATGTTCATGCATTTGCACATCCTATCTAATTACTGTCAGGATTGATATAGAAATAGAAAGAAGAAAATGAATTACCATCTTTTCACAAGGACCTTTGAAAGGTCTTCCAAGTTATGGCTGCTATAGAGATGGAGTTATCCGCCATGGTGCTAAATATTACTGCCCATAGAGATTAGGGGACTCTCATACTATAGTGGTCAGGTCAGCTGCATCATATAGAGATAATAAATCTGTATACTAGTATCTCTATATGAATGATGAAGGACATGCTAGACATTCCTCCTCATAATGAAGTTCAGCATTCATGCTAGGGACTCTGAATCACATCATCTCTTAGGCT
  5   1   1       add He1       out                   IMAGE:4406983.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATTTATGCAAGGCAGAATAAATTATTTCATCCAGTAACTTTTcccccccccACTGGTAGTCTCTTCAAAATAAACGACAAAATCCTTTGCAAAGATGGTCGATGATCACTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)