Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL515k05ex.5                         32 PI      90          1      577                (no blast hit)

 This cluster: approximate FL confidence score = 82%

 1012770254 Xl3.1-XL501e04ex.5 - 29 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL501e04ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCGGCACCATCATGAGTAGCTGTTCGATTGTTTCTCTCCTTCCCGGTGATAAGGAGCCGTCTATGCCCGACGAATGGCGACTGTATAAGCTGGCTACGCGCCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGCGCTTGCACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTCTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGATTTTTTTTTTTAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAAGAAGCATGTATCTTTGTCAAATACATATGATTTTAAATGTCTCTATGCTTGGAATGTTTTTATTGTTAAGGATGGGCTATTATAATGCACTCCTGTCTTACATGGAACC
                                                  Xl3.1-CHK-1012688217                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCATCATGAGTAGCTGTTCGATTGTTTCTCTCCTTCCCGGTGATAAGGAGCCGTCTATGCCCGACGAATGGCGACTGTATAAGCTGGCTACGCGCCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGCGCTTGCACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTCTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGATTTTTTTTTTTAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAAGAAGCATGTATCTTTGTCAAATACATATGATTTTAAATGTCTCTATGCTTGGAATGTTTTTATTGTTAAGGATGGGCTATTATAATGCACTCCTGTCTTACATxGxAxCCGCCAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              4     4     8     9     9    11    10    12    11    13    11    15    13    15    14    16    13    16    15    17    16    18    15    21    17    22    19    23    17    23    19    23    21    23    21    24    19    24    21    24    20    24    22    24    21    23    20    23    21    25    22    25    22    25    23    25    20    25    23    25    23    25    23    25    24    25    25    25    25    25    25    25    24    25    23    25    23    24    23    24    25    26    25    26    24    26    25    26    25    26    24    25    23    25    22    25    21    25    20    25    21    25    14    23    14    23    16    23    16    22    13    22    11    20    10    17     8    17     9    16     7    12     6    10     6     9     5     7     2     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------G-
                                               BLH ATG      12     273                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI     -12       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Ci ---- 4e-009     NP_001071925.1 zinc finger protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Ce ==== 4e-011     NP_505949.1 baculovirus Inhibitory Repeat family member, survivin (17.7 kD) (bir-1)[Caenorhabditis elegans] =========================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ag ---- 1e-017     XP_317026.3 inhibitor of apoptosis protein (AGAP008420-PA) [Anopheles gambiae str. PEST] =================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 6e-019     NP_650608.1 CG12265-PA [Drosophila melanogaster] ----------==============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 1e-035     XP_001175578.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dr ---= 1e-038     NP_919378.1 baculoviral IAP repeat-containing 5A; survivin 1 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Gg ---- 6e-045     NP_001012318.1 baculoviral IAP repeat-containing 5 isoform 1 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN -== Hs ==== 4e-046     NP_001159.2 baculoviral IAP repeat-containing protein 5 isoform 1 [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Cf ==== 4e-047     NP_001003348.1 survivin [Canis familiaris] ================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Bt ==== 2e-047     NP_001001855.2 baculoviral IAP repeat-containing 5 [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN -== Mm ==== 2e-047     NP_033819.1 baculoviral IAP repeat-containing 5; survivin; apoptosis inhibitor 4 [Musmusculus] ======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 3e-075     AAI23072.1 Baculoviral IAP repeat-containing 5 (survivin) [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Xl ==== 1e-090     NP_001089984.1 hypothetical protein LOC735055 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL501e04ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------TGA------------------------------------------------------------------------TAA---------------------------------------------------------------------------------ATG------------TAA------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2       bld Egg3 5x3                        IMAGE:6322986.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATTCCCGGGGGTGGCGACTTTAGGGCGCATATTTTTTGATCCGGCACCATCATGAGTAGCTGTTCGATTGTTTCTCTCCTTCCCGGTGATAAGGAGCCGTCTATGCCCGACGAATGGCGACTGTATAAGCTGGCTACGCGCCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGCGCTTGCACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTCTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATGAACAGAttttttttttttAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAAGAAGCATGTATCTTTGTCAAATACATATGATTTTAAATGTCTCTATGCTTGGAATGTTTTTATTGTTAAAGATGGGCTATTATAATGCACTCCTGTCTTACATGGAACCGCCAGGGTTAATAAACTGCNCGAGACNNNNNAANNANANAAAAAANNAAAGAGAACTAGTCTCGAAGCGGGCCCCCAC
  5   1   2       bld Gas7 5g                         IMAGE:4083837.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGGGTTTTGAATCCGGCACCATCATGAGTAGCTGTTCGATTGTTTCTCTCCTTCCCGGTGATAAGGAGCCGTCTATGCCCGACGAATGGCGACTGTATAAGCTGGCTACGCGCCTCATGACATTCTCTAACTGGCCATTTACCGAAGATTGCGCTTGCACCCCATAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCATATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACC
  5   1   2       bld Ga15 5g3  in                       XL481p21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTTTTGAATCCGGCACCATCATGAGTAGCTGTTCGATTGATTCTCTCCTTCCCGGTGATAAGGAGCCGTCTATGCCCGACGAATGGCGACTGTATAAGCTGGCTACGCGGCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGCGCTTGCACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTCTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGAtttttttttttAAACTGCAAACTACACNCCTGTAATGTATATATGTTTATTACAGAATAATTCNTAACCTACCCCTTGCC
  3   1   2       bld Ga15 5g3  in                       XL500e04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCGGCACCATCATGAGTAGCTGTTCGATTGTTTCTCTCCTTCCCGGTGATAAGGAGCCGTCTATGCCCGACGAATGGCGACTGTATAAGCTGGCTACGCGCCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGCGCTTGCNCCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACNCAAGAAACATTCTCCAAGCTGCTTATTCATTGCNCTGAAAAAGAAAGCAGAAGAACTGACNCTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCNCTTGGAGCAACTTGATGCTGATGAAACNCAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCNCGCTTACCTTGTATATACTCCATTAACAGATTTTTTTTTTTAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAAGAAGCATGTATCTTTGTCAAATACATATGATTTTAAATGTCTCTATGCTTGGAATGTTTTTATTGTTAAGGATGGGCTATTA
  3   1   2       bld Ga18 5g3  in                      xlk123n11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCACGCGTCCGATGAGTAGCTGTTCGATTGANTCTCTCCTTCCCGGTGATAAGGANCCGTCTATGCCCGACGAATGGCGACTGTATAAGCNGCTNCGCGGCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGNGCTTGCACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTCTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGATTTTTTTTTTTAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATANCCTNCCCCTTNCCATTCAAGAAGCA
  3   1   2       bld Ga15 5g3  in                       XL501e04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCACCATCATGAGTAGCTGTTCGATTGTTTCTCTCCTTCCCGGTGATAAGGAGCCGTNTATGCCCGACGAATGGCGACTGTATAAGCTGGCTACGCGCCTCAGGACATTCTNTAACTGGCCATTTACCGAAGATTGCGCTTGCACCCCAGAGCGGATGGCAGAGGCTGGATTTGNTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGNGTTTNTTCTGTCTTAAGGNACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACNCAAGAAACATTCTCCAAGCTGCTTATTCATTGCNCTGAAAAAGAAAGCAGAAGAACTGNCCCTGAGNGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGANCCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGNGCGGGGTCNCTTGGAGCAACNTGATGCTGATGAAACNCAGTGATGTTTTCTTTTGNTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCNCGNTTACCTTGTATATACTCCATTAACAGATTTTTTTTTTTAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAAGAAGCATGTATCTTTGTCAAATACATATGATTTTAAATGTCTCTATGCTTGGAATGTTTTTATTGTTAAGGATGGGCTATTATAATGCACTC
  5   1   2       bld Ga15 5g3  in                       XL500e04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACCATCATGAGTAGCTGTTCGATTGTTTCTCTCCTTCCCGGTGATAAGGAGCCGTCTATGCCCGACGAATGGCGACTGTATAAGCTGGCTACGCGCCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGCGCTTGCACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTCTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGAtttttttttttAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACANAATAATTCATAACCTACCCCTTGCCATTCAAGAAGCATGTATCTTTGTCAAATACATATGATTTTAAATGTCTCTATGCTTGGAATGTTTTTATTGTTAAGGATGGGCTATTATAA
  5   1   2       bld Ga15 5g3  in                       XL501e04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACCATCATGAGTAGCTGTTCGATTGTTTCTCTCCTTCCCGGTGATAAGGAGCCGTCTATGCCCGACGAATGGCGACTGTATAAGCTGGCTACGCGCCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGCGCTTGCACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTCTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGAtttttttttttAAACTGCNAACTACACACCTGTAATGTATATATGTTTATTACANAATAATTCATAACCTACCCCTTGCCATTCAAAAANCATGTATCTTTGTCAAATACATATGATTTTAAATGTCNCTATGCTTGNAATGTTTTTATTG
  3   1   2       bld Ga15 5g3  in                       XL475n08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCATCATGAGTAGCTGTTCGATTGATTCTCTCCTTCCCGGTGATAAGGAGCCGTNTATGCCCGACGAATGGCGACTGTATAAGCTGGCTACGCGGCTCAGGACATTCTNTAACTGGCCATTTACCGAAGATTGCGCTTGCNCCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCNCTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACNCAAGAAACATTNTCCAAGCTGCTTATTCATTGCNCTGAAAAAGAAAGCAGAAGAACTGACNCTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCNCTTGGAGCAACTTGATGCTGATGAAACNCAGNGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCNCGCTTACCTTGTATATACTCCATTAACAGATTTTTTTTTTTAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAAGAAG
  5   1   2       bld Ga18 5g3  in                      xlk123n11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGAGTAGCTGTTCGATTGATTCTCTCCTTCCCGGTGATAAGGAGCCGTCTATGCCCGACGAATGGCGACTGTATAAGCTGGCTACCNGCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGCGCTNNNCCCCAGAGCGGATGGCAGAGNNTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTCTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGAttttttttttttAAACTGCGAACTACACACCTGTATGTATATATGTTTATTACAGAAT
  5   1   2       bld DMZ       in                         xl227l22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTAGCTGTTCGATTGATTCTCTCCTTCCCGGTGATAAGGAGCCGTCTATGCCCGACGAATGGCGACTGTATAAGCTGGCTACGCGGCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGCGCTTGCACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTCTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGAttttttttttAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAAGAAGCATGTATCTTTGTCAAATACATATGATTTTAAATGTC
  3   1   2       add DMZ                                 rxl229l22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCTCCTTCCCGGTGATAAGGAGCCGTNTATGCCCGACGAATGGCGACTGTATAAGCTGGCTACGCGGCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGCGCTTGCACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTCTCCAAGNTGCNTNTTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACNCTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAANGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAANTGAGGTGCGGGGTCACNTGGAGCAACTTGATGNNGATGAAACCCAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCGGGCNATAAAAACTGTATANTGCTTTTTATAAAACAATCCACGCTTACCTTGNATATACTCCNTTAACAGATTTTTTTTTTAAACTGCGANCTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAATGAAGGCAGTGTATCTTTGTCNAATACATA
  5   1   2       bld Neu7      in                         XL048c11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGATAAGGAGCCGTCAATGCCCGACGAATGGCGACTGTATAAGCTGGCTACGCGCCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGCTCTTGCACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTCTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGAttttttttttttAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAAGAAGCATGTATCTTTGTCAAATACATATGATTTTAAATGTCaaaaaaaaaa
  5   1   2      seed Ga12      in                         XL198o02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGGGCCGTCTATGCCCGACGAATGGCGACTGTATAAGCTGGCTACGCGGCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGCGCTTGCACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTCTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGAtttttttttttAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCAT
  3   1   2       bld Neu7      in                         XL048c11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGCCGTCAATGCCCGACGAATGGCGACTGTATAAGCTGGCTACGCGCCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGCTCTTGCACCCCAGAGCGGATGGCANAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTNTTCTGTCTTAAGGAACTANAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACNCAAGAAACATTNTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACNCAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATANACTCCATTNACNNNTTTTTTTTTTTTAAA
  5   1   2       bld Ga15      in                       XL415a10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGACTGTATAAGCTGGCTACGCGCCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGCGCTTGCACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTCTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGAtttttttttttAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAANAAGCATGTATCTTTGTCAAATACATATGATTTTAAATGTCTCTATGCTTGGAATGTTTTTATTGTTAAGGATGGGCTATTATAATGCACTCCTGTCTTACATGGAACCCGCCAGGTTA
  3   1   2       bld Egg5      in                    IMAGE:3431027.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCAGGACATTCTCTAAATGGCCATATACAGAATATTGCGCTTGCACCCCAGAGCGCATGGCAGAGGCTGTATTTGTTCACTGCCCCAGGGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTGTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATG
  3   1   2       chi Ga18      in                      xlk144e20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGCGTCCGGCACCATCATGAGTAGCTGTTCGATTGTTTCTCTCCTTCCCGGTGATAAGGAGCCGTCTATGCCCGACGAATGGCGACTGTATAAGNNGNNNCGCGCCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGNGCTTGCACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGATTTTTTTTTTTAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATANNCTNCCCCTTNNCATTCAAGAAGCA
  3   1   2       bld Ga12      in                         XL198o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCATTTACCGAAGATTGCGCTTGCACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTCTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACNCTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGATTTTTTTTTTTAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAAGAAGCATGTATCTTTGTCAAATACATATGATTTTAAATGTCTCTATGCTTGGAATGTTTTTATTGTTAAGGATGGGCTATTATAATGCACTCCTGTCTTACATGGAACCGCCAGGT
  5   1   2       chi Ga18      in                      xlk144e20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCATCATGAGTAGCTGTTCGATTGTTTCTCTCCTTCCCGGTGATAAGGAGCCGTCTATGCCCGACGAATGGCGACTGTATAAGCTGGCTACNNNCTCAGGACATTCTCTAACTGGCCATTTACCGAAGATTGCGCTTNCACCCCAGAGCGGATGGCAGAGGNTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGAtttttttttttAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAAGAAGCATGTATCTTTGTCAAATACATATGATTTTAAATGTCANANA
  3   1   2       bld Ga15      in                       XL415a10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACNGAAGANTGCGNTTGCACCCCAGAGCGGATGGCAGAGGCTTGGATTTGTTCNCTGGCCCCAGNGACAACAGTCCAGATGTGGTTAAGNGTTTCTTCTGTNNTAAGGAACTAGAAGGNTGGCAGCCTGAAGATGACCCTATGGATGAACNCAAGAAACATTNTCCAAGCTGCTTATTCATTGCNCTGAAAAAGAAAGCAGAAGAACTGNCCCTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCNCTTGGAGCAACTTGATGCTGATGAAACNCAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGATTTTTTTTTTTAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAAGAAGCATGTATCTTTGTCNAAATACATATGATTTTAAATGTCTCTATGCTTG
  5   1   2       bld Egg5      in                    IMAGE:3431027.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGATTGCGCTTGCACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCAGTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTCTCCAAGCTGCTTATTCATTGCACTTGAGAAGATAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATAT
  3   1   2       bld Ga15      in                       XL502a23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCAGAGCGGATGGCAGAGGCNGGATTTGTTCACTGCCCCAGTGACNACAGTCCAGANGTGGTTAAGTGTTTGTTCTGTCTTAAGGAACTAGAAGGTTGGCAGCCTGNAGATGACCCTATGGATGAACNCAAGNAACATTNTCCAAGCTGCTTATTCATTGCNCTGAAAAAGAAAGCAGAAGAACNGACNCTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCNCTTGGAGCAACTTGATGCTGATGAAACNCAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCNCGCTTACCTTGTATATACTCGCNTTAACAGATTTTTTTTTTTAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAAGAAGCATGTATCTTTGTCAAATACGATATGATTTTAAAGT
  5   1   2       bld Ga15      in                       XL502a23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGATGTGGTTAAGTGTTTCTTCTGTCTTAAGGAACTAGAANGTTGGCAGCCTGAAGATGACCCTATGGATGAACACAAGAAACATTCTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAATAACAATCCACGCTTACCTTGTATATACTCCATTAACAGAtttttttttttAAACTGCGAACTACNCAC
  3   1   2       bld DMZ       in                         xl227l22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACAAGAAACATTCTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGNCACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTNGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACNGAATTTATATATTCCCGGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGATTTTTTTTTTAAACTGCGAACTACACACCTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAAGAAGCATGTATCTTTGTCAAATACATATGATTTTAAATGTCTCTATGCTTGGAATGTTTTTATTGTTAAGGATGGGCTATTATAATGCACTC
  5   1   2       bld Ga15 5g3  in                       XL475n08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTCTCCAAGCTGCTTATTCATTGCACTGAAAAAGAAAGCAGAAGAACTGACACTGAGCGAGTTCCTGAAACTGGATTTGGAGCGTACAAAAATCAAAATGCAAAAGCAGATGAACCTGCGCATTGAATGTTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGCAACTTGATGCTGATGAAACACAGTGATGTTTTCTTTTGTTGTATTTTATTACTGAATTTATATATTCCCTGGCTATAAAAACTGTATATTGCTTTTTATAAAACAATCCACGCTTACCTTGTATATACTCCATTAACAGAtttttttttttAAACTGCNAACTAC
  3   1   2       add Ga15 5g3  in                       XL481p21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAACNCAGTGATGTTTTCTTTNGTTGTATTTTATTACGGAATTTATATATTCCCGGGCTATAAAAACTGTATATNGCTTTTTATAAAACAATCCNCGCTTACCTNGTATATACTCCATTAACAGATTTTTTTTTTTAAACTGCGAACTACACACCTGTAANGTATATANGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAAGAAGCANGTATCTTNGTCAAATACATANGATTTTAAANGTCTCT
  3   1   2       add Ga15                               XL412e04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CNCAGTGANGTNTTCTTTTGTTGTATTTTATTACTGAATTNATATATTCCCNGGCNATAAAAACNGTATANTGCTTTTTNNAAAACAATCCNNGNNTNCCTTGTATANACTCCATTAACAGATNTTTTTNTTTAAACTGCGAACTACACACCTGTAATGTATATATGTNTATTACAGAATAATTCATANCCTNCCCCTTGCCATTCAAGAAGCATGTATCTTTGTCAAATNCATACGATTTTAAATGTCTCTATGCTNGGAATGTTTNTANTGTTAAGGAGGGGCTATTATAATGCA
  3   1   2       bld Ga12                                 XL201k05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGAACTACACACNTGTAATGTATATATGTTTATTACAGAATAATTCATAACCTACCCCTTGCCATTCAAGAAGCATGTATCTTNGTCAAATNCATANGATTTTAAATGTCTCCTATGCATGGAATGTTNNTATTGCNAAGGATGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)