Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL211c23.3                           13 END     7          35       53                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012770271 Xl3.1-IMAGE:6864373.5 - 20 ESTs
                                                                       ...-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6864373.5                                                                                                                                                                                                                                                    TTTAGTCTGTATGTCCCTAGTGCGCCTCCGTACGTTGCGTCTTGAAGGGGGCGTGGACACGTGTGTAAACTCCAATGGTGGAACTCGTGGGAAAGTTTTAGGCTGTTGCGAGCAGTTCGTGCTGGGGAGACGATTTGGCATTAGGAAGCGTGAAAGAAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGCTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACGGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCCCAAGCACAACCACGTCAAGACTACATGAAGGGGCTGAGTATCATAGGGGTGCAGCAAATAGACAGAGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCATTCTGTGAGATTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATCAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGTACATACTGTAAAACCAAACATGCAAGAGGAGAACTTGCCAGTTA
                                                  Xl3.1-CHK-1012689877                                                                                                                                                                                                                                                          CTGTATGTCCCTAGTGCGCCTCCGTACGTTGCGTCTTGAAGGGGGCGTGGACACGTGTGTAAACTCCAATGGTGGAACTCGTGGGAAAGTTTTAGGCTGTTGCGAGCAGTTCGTGCTGGGGAGACGATTTGGCATTAGGAAGCGTGAAAGAAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGCTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACGGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCCCAAGCACAACCACGTCAAGACTACATGAAGGGGCTGAGTATCATAGGGGTGCAGCAAATAGACAGAGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCATTCTGTGAGATTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATCAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGTACATACTGTAAAACCAAACATGCAAGAGGAGAACTTGCCAGTTACCCAGT
                                                      consensus depths                                                                                                                                                                                                                                                         2     2     2     2     2     2     2     2     2     2     4     4     5     5     5     5     8     8    11    11    11    11    14    15    14    15    15    15    17    17    17    17    17    17    17    17    17    17    19    19    17    17    17    17    17    17    19    19    19    19    17    17    19    19    19    19    17    17    17    17    19    19    17    17    17    17    17    18    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    17    18    18    18    17    18    18    18    18    18    18    18    17    18    16    18    16    18    14    16    15    16    14    16    13    15    13    15    12    14    12    14    11    12    11    12    10    11     8    10     7     8     7     8     5     6     5     6     4     5     4     5     4     5     3     5     3     5     3     4     2     4     2     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------T--
                                               BLH ATG     214     760                                                                                                                                                                                                                                                    
                                               BLH MIN     214     128                                                                                                                                                                                                                                                    
                                               BLH MPR     202     128                                                                                                                                                                                                                                                    
                                               BLH OVR     190     985                                                                                                                                                                                                                                                    
                                               CDS MIN     190     128                                                                                                                                                                                                                                                    
                                               EST CLI      89       7                                                                                                                                                                                                                                                    
                                               ORF LNG     190      46                                                                                                                                                                                                                                                    
  5   1   0       chi Ga15      out                      XL422d07ex.5p AAGGAGACCATTTTCAGCCGTAGAACACATGAATGAAACTCATGCCTCTTGAGTTTTCAGGGTTTGCCAATTAGAAATATTACAGAAGAACAACCTCCCAAAGTGTGCCACCCTCCTCATGAACCACATCCAATGCTCTCCCTTCAGTTGCCCTCCTATCAAATACCTGGGCTAAGAGAAATATCGCAAAGGAGTTAGTGGCTGTCATGTTACATCTGATGTGCTGGCTCTCCGGGATTCATCACTGTCAGTTGCTCACTTTCCTTCTAGGTTGTTATGGGGGAGCATATGATTGTAGATTGGGCCCTTTGCAGAGGAGGGACACTTTTAAAAATCACCAAGCATGGGTGGTGGTGACTTCCTACCCACGTCTTTGAAGGCCTGGATCACAACTTTTATAGAGATGCTACACGTTACAATCTGAAAGGATCTTAAGCTTATTTATATTTTACAGGAAATGCTTGCTATATGTGAGTCTTTGCTGGGCGACATTGAAGACATGGTATTAGATACAGTCCCAAAGCCTCATGATCGCCAGTCTGCAAGACAAAATGTAGTACCCAGAGCACGGAAAAGAAATAAAAACATCATCCAAGAGGAATAACCCCCTGCTGATAGGTTTGCTCATATTTTAACTTCTTTGGTTCCAGTTTTGCTGTTAACCCTTTGCCTGCCAGTTGTTTTTGCTATGTTAAGGCATGGGCATGGTAACCAAACAT
  5   1   0       chi Egg1                               PBX0124D01.5p                                                                                                                                                                CACGAGGCACGTTGGGGATAAGATTTACCATTAGGAAGCGCGAAAGGAAAAGGAGACCATTTTCAGCCGTAGAACACATGAATGAAACTCATGCCTCTTGAGTTTTCAGGGTTTGCCAATTAGAAATATTACAGAAGAACAACCTCCCAAAGTGTGCCACCCTCCTCATGAACCACATCCAATGCTCTCCCTTCAGTTGCCCTCCTATCAAATACCTGGGCTAAGAGAAATATCGCAAAGGAGTTAGTGGCTGTCATGTTACATCTGATGTGCTGGCTCTCCGGGATTCATCACTGAAATGCTTGCTATATGTGAGTCTTTGCTGGGCGACATTGAAGACATGGTATTAGATACAGTCCCAAAGCCTCATGATCGCCAGTCTGCAAGACAAAATGTAGTACCCAGAGCACGGAAAAGAAATAAAAACATCATCCAAGAGGAATAACCCCCTGCTGATAGGTTTGCTCATATTTTAACTTCTTTGGTTCCAGTTTTGCTGTTAACCCTTTGCCTGCCAGTTGTTTTTGCTATGTTAAGGCATGGGCATGGTAACCAAACATAAGAGAGTAG
  5   1   2       bld Ov1  5g                         IMAGE:6318393.5p                                                                                                                                                                                                                                                 GACTTTAGTCTGTATGTCCCTAGTGCGCCTCCGTACGTTGCGTCTTGAAGGGGGCGTGGACACGTGTGTAAACTCCAATGGTGGAACTCGTGGGAAAGTTTTAGGCTGTTGCGAGCAGTTCGTGCTGGGGAGACGATTTGGCATTAGGAAGCGTGAAAGAAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGTTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACGGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAANAAAGTTGTAGTGGTCTGGATGTGTTCCCCAAGCACAACCCACGTCAGACTACATGAAGGGGCTGAGTATCATAGGGGGTGCAGCAAATAGACAGAAGTGGTTGAAGGTTGTAGAAGAAACAATTTAAAGGGTCATTCCTTGTGAAAATTGCCTGGNGGGTCAGAAAAAAGGAATAATGGGAAAAACCGGGTTTGGGNGGGGGAAGGCCTCGGATTTGGGA
  5   1   2       bld Ga12 5g                              XL143p09.5p                                                                                                                                                                                                                                                  GCTTTAGTCTGTATGTCCCTAGTGCGCCTCCGTACGTTGCGTCTTGAAGGGGGCGTGGACACGTGTGTAAACTCCAATGGTGGAACTCGTGGGAAAGTTTTAGGCTGTTGCGAGCAGTTCGTGCTGGGGAGACGATTTGGCATTAGGAAGCGTGAAAGAAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGCTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACGGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGCTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCCCAAGCACAACCACGTCAAGACTACATGAAGGGGCTGAGT
  5   1   2       bld Ov1  5g3  out                   IMAGE:8329434.5p                                                                                                                                                                                                                                                                                                     GGCGTGGACACGTGTGTAAACTCCAATGGTGGAACTCGTGGGAAAGTTTTAGGCTGTTGCGAGCAGTTCGTGCTGGGGAGACGATTTGGCATTAGGAAGCGTGAAAGAAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGTTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACGGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCCCAAGCACAACCACGTCAAGACTACATGAAGGGGCTGAGTATCATAGGGGTGCAGCAAATAGACAGAGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCATTCTGTGAGATTGCTGGGTCAGAAA
  5   1   2       bld Ov1  5g3  out                   IMAGE:8329410.5p                                                                                                                                                                                                                                                                                                      GCGTGGACACGTGTGTAAACTCCAATGGTGGAACTCGTGGGAAAGTTTTAGGCTGTTGCGAGCAGTTCGTGCTGGGGAGACGATTTGGCATTAGGAAGCGTGAAAGAAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGTTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACGGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCCCAAGCACAACCACGTCAAGACTACATGAAGGGGCTGAGTATCATAGGGGTGCAGCAAATAGACAGAGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCATTCTGTGAGATTGC
  5   1   2       bld Neu7 5g3  out                        XL021e08.5p                                                                                                                                                                                                                                                                                                                         CTCCAATGGTGGAACTCGTGGGAAAGTTTTAGGCTGTTGCGAGCAGTTCGTGCTGGGGAGACGATTTGGCATTAGGAAGCGTGAAAGAAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGCTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACAGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCTCAAGC
  5   1   2       bld Emb3 5g                         IMAGE:3400926.5p                                                                                                                                                                                                                                                                                                                                             GGAAAGTTTTAGGCTGTTGCGAGCAGTTCGTGCTGGGGAGACGATTTGGCATTAGGAAGCGTGAAAGAAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGCTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACGGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAAGAGTCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGATGTGTTCCCCTAGCACCAACAACGTCATGACTACATTGAAGGGGCTGATGTTTATAGGGGTGCAGCAAATTCACACAGTGGTTGAATTTTTCGAAGAAACATTAAAGGTCATTTTGTGGAGTTGCTGGTTCAAAAAATGATATTGCACAACCGT
  5   1   2       bld Ga15 5g3  out                      XL439e05ex.5p                                                                                                                                                                                                                                                                                                                                               AAAGTTTTAGGCTGTTGCGAGCAGTTCGTGCTGGGGAGACGATTTGGCATTAGGAAGCGTGAAAGAAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGCTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACAGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCCCAAGCACAACCACGTCAAGACTACATGAAGGGGCTGAGTATCATAGGGGTGCAGCAAATAGACAGAGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCATTCTGTGAGATTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATCAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGNTTTGAATGCTTGTACATACTGTAAAACCAAA
  5   1   2       bld Emb1 5g                         IMAGE:6864373.5p                                                                                                                                                                                                                                                                                                                                                    TTTAGGCTGTTGCGAGCAGTTCGTGCTGGGGAGACGATTTGGCATTAGGAAGCGTGAAAGAAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGCTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACGGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCTCAAGCACAACCACGTCAAGACTACATGAAGGGGCTGAGTATCATAGGGGTGCAGCAAATAGACAGAGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCATTCTGTGAGATTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATCAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGTACATACTGTAAAACCAAACATGCAAGAAGAGAACTTGCCAGTTACCCAGTTTGAAGAAATTGGTTGACAGAAGCCACGCAGTCCTTTCCAAAGAGGGNTGTCTTGCGAAGATCA
  5   1   2       bld Oo1  5g                         IMAGE:3404724.5p                                                                                                                                                                                                                                                                                                                                                      TAGGCTGTTGCGAGCAGTTCGTGCTGGGGAGACGATTTGGCATTAGGAAGCGTGAAAGAAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGCTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACAGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTTAACAGTTGCACTGTGAAGAGTNCAGCTGAGGACCAACTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAATAAAAAAGTTGTAGTGTCTTGAATGTGTTCCCCAAGCA
  5   1   2      seed Egg1 5g                            PBX0116E04.5p                                                                                                                                                                                                                                                                                                                                                             CACGAGGCAGTTCGTGCTGGGGAGACGATTTGGCATTAGGAAGCGTGAAAGAAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGCTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACGGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCCCAAGCACAACCACGTCAAGACTACATGAAGGGGCTGAGTATCATAGGGGTGCAGCAAATAGACAGAGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCATTCTGTGAGATTGCTGGGTCAGAAAAAGGATAATGGAAAA
  5   1   2       bld Oo1  5g                         IMAGE:5079920.5p                                                                                                                                                                                                                                                                                                                                                               GCGAGCAGTTCGTGCTGGGGAGACGATTTGGCATTAAGAAGCGTGAAAGAAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGCTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACAGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCTCAAGCACAACCACGTCAAGACTACATGAAGGGGCTGAGTATCATACGGGTGCAGCAAATAGACAGAGTGGTTAGAGTTGTAGAAGAAACAATTAAAGGTCATTCTGTGAGATTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGCGGGAGCTCGATTGGATTTGCCAAAGATCCGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGTACATACTGTAAAACCAAACATGCAAGAAGGAGAACTTGCCCATTTCCCCATTTGAAGCAATTGGTTGACCAGACCCACGCAAGCCTTTCCCAAGAAGTGTGGTTTGCCCAAATCCTGGGCTGACCAAGGGAAAAAACCCTGGAACCCCTATGGGCCaaaaaaaaT
  5   1   2       bld Ga12 5g3  out                        XL211c23.5p                                                                                                                                                                                                                                                                                                                                                                                    GGCGATTTGGCATTAGGAAGCGTGAAAGAAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGCTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACGGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCCCAAGCACAACCACGTCAAGACTACATGAAGGGGCTGAGTATCATAGGGGTGCAGCAAATAGACAGAGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCATTCTGTGAGATTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGA
  5   1   2       bld Ga12 5g3  out                        XL144p09.5p                                                                                                                                                                                                                                                                                                                                                                                      GCGATTTGGCATTAGGAAGCGTGAAAGAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGCTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACGGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCCCAAGCACAACCACGTCAAGACTACATGAAGGGGCTGAGTATCATAGGGGTGCAGCAAATAGACAGAGTGGTTGAAGTTGTAGAAGAA
  5   1   2       bld Ga12 5g                              XL212a02.5p                                                                                                                                                                                                                                                                                                                                                                                      CGATTTGGCATTAGGAAGCGTGAAAGAAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGCTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACGGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCCCAAGCACAACCACGTCAAGACTACATGAAGGGGCTGAGTATCATAGGGGTGCAGCAAATAGACAGAGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCATTCTGTGAGATTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGA
  5   1   2       bld Emb1 5g                         IMAGE:6632191.5p                                                                                                                                                                                                                                                                                                                                                                                       GATTTGGCATTAGGAAGCGTGAAAGAAAAAGAGACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGCTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACAGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCCCAAGCACAACCACGTCAAGACTACATGAAGGGGCTGAGTATCATAGGGGTGCAGCAAATAGACAGAGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCATTCTGTGAGATTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATCAGGAAAGACCCCACTGATAGAAATCATTTCCATTCATACAGGGTGGTTTGAATGCTTGTACATACTGTAAAAACAAACCTGGCAAGAGGAGAACTTGCCAGTTACCCAGNTGAAGAAATTGGTTGACAGAACCCACCCATCTTTTCCAAGAGGGTTGGCTGCCAAGATCTGGCTGAACCACCGAAAACCCTGGAGCTTATGGCAGAAA
  5   1   2       bld Neu7 5g3  out                        XL045p19.5p                                                                                                                                                                                                                                                                                                                                                                                                                        ACATTTAATAGCCATAGTACCCTTGAATGAAACTCGCACCTCTTGAGGAAATGCCTGCTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACAGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCTCAAGCACAACCACGTCAAGACTACATGAAGGGGCTGAGTATCATAGGGGTGCAGCAAATAGACAGAGTGGTTGAAGTTGTAGAAGAAAC
  5   1   2       bld Ga12 5g                              XL153k16.5p                                                                                                                                                                                                                                                                                                                                                                                                                        ACATTTAATAGCCATAGTACCCTNGAATGAAACTCGCACCTCTTGAGGAAATGCCTGCTGTCTGTGAGTCTTTGCTGGATGACATTGAAGATATGGTCTCCGCTACGGACCCAAAGCCTCATGATCGCCAGTCTGCTAGAAAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAACATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCAGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCCCAAGCACAACCACGTCAAGACTACATGAAGGGGCTGAGTATCATAGGGGTGCAGCAAATAGACAGAGTGGTT
  5   1   2       bld Oo1                             IMAGE:5079029.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCACTCAGAAGATCTGGATCCGTACATGGGGGCTGCTCACATAATAACTCCGATGGTGAATATATGGCGGGGCAGCTGGCTGCATATGGCTACAGTATAACCGAACAGCCTGAGAAAGCAGATTTGTGGCTGCTAAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCCCAAGAAGCAAATAAAAAAGTTGTAGTGTCTGGATGTGTTCCTCAAGCACAACCACGTCAAGACTACATGAAGGGGCTGAGTATCATAGGGGTGCAGCAAATAGACAGAGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCATTCTGTGAGATTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATCAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGTACATACTGTAAAACCAAACATGCAAGAGGAGAACTTGCCAGTTACCCAGTTGAAGAATTGGTTGACAGAGCCACGCAGTCTTTCCAAGAGGGTGTCTGCGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCAGAGACATTGGGACAGATCTCCCAACGCTCTTATGGAAGGCTGGTTGAAGTTATCCCCTGAGGGGGGCCATGGTGAGGGCTAGGCATGACCAAACCCCCCTTATATATTAGAGNACCCTGGAGGAAATGGNAAAAGATCCTAAATCTTCCGCGAGGGGATGGCATTCCTTAATATTCCTGGAAAATCTGCCTTCAGACAGGGCGGTTCCTGGNACCCGAACGAGAGAATCCCTGCATTCCCAACCTCCAAACCACTGGGTGGGACTTTTCCTAAAAGACCAACTCGCCCGGAACTCACAATCCGGTTCCGGAACCTCTTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)