Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 07 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7973876.3                     924 PI      85        104      285                (no blast hit)
     2   0.0    0Xl3.1-XL438p03ex.5                        566 PI      84         96      285                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6859211.5                     558 PI      86        104      285                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:8640967.5                      54 PI      84          1      752                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012770312 Xl3.1-IMAGE:8640907.5 - 32 ESTs
                                                                       ......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8640907.5                 GAATGAGATCTCAGAGCTCAACCGTAAATCCCAGAGACTAAAAGCTGAAATTGAAAATGTGAAGAAACAGATCGCCAAGCTGCAAGTATCTATTACTGAAGCAGAGGAACGTGGGGATCTTGTACTGAAAGATGCTCAGTCCAAACTTGCTGACCTGGAAGCCGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCTCTGGATGTTGAAATTGCTACTTACAGAAAACTGCTGGAAGGCGAAGAATTCAGGCTTAATTCAGATGTCAATAATGTCAGCATTTCTGTCATTAGCTCCGGTGGCAAAAGTTCCCTAGGAGGAGGAGGAGGAGGAGCAGGCTTCGGCTTTGGAAGTGGTGGTGGTGCCTTCGGTGGAAGTGGTGGCGGTGCCTTCGGTGGAAGTAGTGGCGGTGCCTACGGTGGAAGTGGTGGTGCCTACGGTGGAAGTGGTGGTGCTGCCTTTGGTGGCAGTGGTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGGAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGAAAAAAATGATAAAATAAACATAATAAAAATAATACAATGAAATACACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCTCAATAAGGGATACTGTTATGTTTCTGTAGTTGTCCACTGACTTTAATCATTGTAGCACAAATAAACAGAATTCTGCTGCAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012687847                       GATCTCAGAGCTCAACCGTAAATCCCAGAGACTAAAAGCTGAAATTGAAAATGTGAAGAAACAGATCGCCAAGCTGCAAGTATCTATTACTGAAGCAGAGGAACGTGGGGATCTTGTACTGAAAGATGCTCAGTCCAAACTTGCTGACCTGGAAGCCGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCTCTGGATGTTGAAATTGCTACTTACAGAAAACTGCTGGAAGGCGAAGAATTCAGGCTTAATTCAGATGTCAATAATGTCAGCATTTCTGTCATTAGCTCCGGTGGCAAAAGTTCCCTAGGAGGAGGAGGAGGAGGAGCAGGCTTCGGCTTTGGAAGTGGTGGTGGTGCCTTCGGTGGAAGTGGTGGCGGTGCCTTCGGTGGAAGTAGTGGCGGTGCCTACGGTGGAAGTGGTGGTGCCTACGGTGGAAGTGGTGGTGCTGCCTTTGGTGGCAGTGGTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGGAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGAAAAAAATGATAAAATAAACATAATAAAAATAATACAATGAAATACACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCTCAATAAGGGATACTGTTATGTTTCTGTAGTTGTCCACTGACTTTAATCATTGTAGCACAAATAAACAGAATTCTGCTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                      2     2     4     4     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     9     9    11    12    11    14    11    16    12    17    12    17    13    18    16    20    20    22    21    24    21    25    22    25    23    26    24    28    25    30    26    30    26    31    30    31    30    31    31    31    30    30    30    30    30    31    29    31    28    31    25    30    26    31    25    30    26    31    26    31    25    30    26    31    25    31    26    31    26    30    26    29    26    27    25    27    25    27    24    26    24    26    25    26    25    26    25    26    25    26    25    25    25    25    24    25    24    25    25    25    25    25    25    25    24    25    23    25    23    25    23    25    22    25    23    25    23    25    22    25    20    24    18    24    16    23    14    20     8    20     7    20     6    18     5    15     5    12     5    11
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---G--------
  5   1   2       bld Skin                            IMAGE:8644935.5p GTCCTGCGCANACAAAGAATGAGATCTCAGAGCTCAACCGTAAATCCCAGAGACTAAAAGCTGAAATTGAAAATGTGAAGAAACAGATCGCCAAGCTGCAAGTATCTATTACTGAAGCAGAGGAACGTGGGGATCTTGTACTGAAAGATGCTCAGTCCAAACTTGCTGACCTGGAAGCCGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCTCTGGATGTTGAAATTGCTACTTACAGAAAACTGCTGGAAGGCGAAGAATTCAGGCTTAATTCAGATGTCAATAATGTCAGCATTTCTGTCATTAGCTCCGGTGGCAAAAGTTCCCTaggaggaggaggaggaggagcaggcttcggctttggaagtggtggtggtgccttcggtggaagtggtggcggtgccttcggtggaagtagtggcggtgcctacggtggaagtggtggtgcctacggtggaagtggtggtgCTGCCTTTGGTGGCAGTGGTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACCACAGAACATTCATTTGCTGTNATACAATACTGATGCTGTAACATGTTGTTCGCAGAACTATCCCATGCCTTCTCTTTACTAGCCACCTGTGTATGAAGAGTGATAGATTCAGCGAAGTGCTTAGCTGCATGCTCCTAGCT
  5   1   2       bld Skin                            IMAGE:8643421.5p                 GAATGAGATCTCAGAGCTCAACCGTAAATCCCAGAGACTAAAAGCTGAAATTGAAAATGTGAAGAAACAGATCGCCAAGCTGCAAGTATCTATTACTGAAGCAGAGGAACGTGGGGATCTTGTACTGAAAGATGCTCAGTCCAAACTTGCTGACCTGGAAGCCGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCTCTGGATGTTGAAATTGCTACTTACAGAAAACTGCTGGAAGGCGAAGAATTCAGGCTTAATTCAGATGTCAATAATGTCAGCATTTCTGTCATTAGCTCCGGTGGCAAAAGTTCCCTaggaggaggaggaggaggagcaggcttcggctttggaagtggtggtggtgccttcggtggaagtggtggcggtgccttcggtggaagtagtggcggtgcctacggtggaagtggtggtgcctacggtggaagtggtggtgctgcctttggtggcagtggtATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATC
  5   1   2       bld Brn3                            IMAGE:8539137.5p                        ATCTCAGAGCTCAACCGTAAATCCCAGAGACTAAAAGCTGAAATTGAAAATGTGAAGAAACAGATCGCCAAGCTGCAAGTATCTATTACTGAAGCAGAGGAACGTGGGGATCTTGTACTGAAAGATGCTCAGTCCAAACTTGCTGACCTGGAAGCCGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCTCTGGATGTTGAAATTGCTACTTACAGAAAACTGCTGGAAGGCGAAGAATTCAGGCTTAATTCAGATGTCAATAATGTCAGCATTTCTGTCATTAGCTCCGGTGGCAAAAGTTCCCTaggaggaggaggaggaggagcaggcttcggctttggaagtggtggtggtgccttcggtggaagtggtggcggtgccttcggtggaagtagtggcggtgcctacggtggaagtggtggtgcctacggtggaagtggtggtgctgcctttggtggcagtggtATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTATACAATACTGATTGCTGTAACATGTTGTTCGCAGAACTATCCCATGCCTTCTCTTTACTAAGCCACGCTGTGTATGAAGAGTGATAGATTNCAGCGAAGTGCTTAGCTTGCATGCTCACTAGCTGCTCATG
  5   1   2       bld Skin      in                    IMAGE:8641519.5p                          CTCAGAGCTCAACCGTAAATCCCAGAGACTAAAAGCTGAAATTGAAAATGTGAAGAAACAGATCGCCAAGCTGCAAGTATCTATTACTGAAGCAGAGGAACGTGGGGATCTTGTACTGAAAGATGCTCAGTCCAAACTTGCTGACCTGGAAGCCGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCTCTGGATGTTGAAATTGCTACTTACAGAAAACTGCTGGAAGGCGAAGAATTCAGGCTTAATTCAGATGTCAATAATGTCAGCATTTCTGTCATTAGCTCCGGTGGCAAAAGTTCCCTaggaggaggaggaggaggagcaggcttcggctttggaagtggtggtggtgccttcggtggaagtggtggcggtgccttcggtggaagtagtggcggtgcctacggtggaagtggtggtgcctacggtggaagtggtggtgctgcctttggtggcagtggtATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCCTGTTATACAATACTGATTGCTGTAACATGTTGTTCGCAGAACTATCCCATGCCTTCTCTTTACTAAGCACAGCTGTGTATGGAGAGTGATAGATTNCAGCAAAGTGCTTAGCTTGCATGCTCACTAGCTGTCTC
  5   1   2       bld Skin                            IMAGE:8644486.5p                                 CTCAACCGTAAATCCCAGAGACTAAAAGCTGAAATTGAAAATGTGAAGAAACAGATCGCCAAGCTGCAAGTATCTATTACTGAAGCAGAGGAACGTGGGGATCTTGTACTGAAAGATGCTCAGTCCAAACTTGCTGACCTGGAAGCCGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCTCTGGATGTTGAAATTGCTACTTACAGAAAACTGCTGGAAGGCGAAGAATTCAGGCTTAATTCAGATGTCAATAATGTCAGCATTTCTGTCATTAGCTCCGGTGGCAAAAGTTCCCTaggaggaggaggaggaggagcaggcttcggctttggaagtggtggtggtgccttcggtggaagtggtggcggtgccttcggtggaagtagtggcggtgcctacggtggaagtggtggtgcctacggtggaagtggtggtgctgcctttggtggcagtggtATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAATCAGTGCCCAGACACACAGAATCATTCTTTGCCTGTTATACAAATCTGATTGCTGAACATGTTGTTCGCAAACCTATCCCATGCCTTCTCTTTCTAAGCAAGCTGGTATGCAGAGTGATAATTTCAGCAAATGCTTACTTCCTGCTCCTAGGTGTCCATAGGG
  5   1   2       bld Skin      in                    IMAGE:8640221.5p                                                      CTAAAAGCTGAAATTGAAAATGTGAAGAAACAGATCGCCAAGCTGCAAGTATCTATTACTGAAGCAGAGGAACGTGGGGATCTTGTACTGAAAGATGCTCAGTCCAAACTTGCTGACCTGGAAGCCGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCTCTGGATGTTGAAATTGCTACTTACAGAAAACTGCTGGAAGGCGAAGAATTCAGGCTTAATTCAGATGTCAATAATGTCAGCATTTCTGTCATTAGCTCCGGTGGCAAAAGTTCCCTaggaggaggaggaggaggagcaggcttcggctttggaagtggtggtggtgccttcggtggaagtggtggcggtgccttcggtggaagtagtggcggtgcctacggtggaagtggtggtgcctacggtggaagtggtggtgCTGCCTTTGGTGGCAGTGGTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTATACAAATACTGATTGCTGTAACATGTTGTTCGCAGAACTATCCCATGCCTTCTCTTTACTAAGCAACGCTGTGTATGGAGATTGATAGATTNCAGCGAAGTGCTTAGCTTGCATGCTCACTAGGCTGCTCATAGGGTATATCATGCCTCATAGCTACTGGCGAGAAATGATATACTATAATATCTGATCCTC
  5   1   2       bld Skin                            IMAGE:8640413.5p                                                                                                                                  GGGATCTTGTACTGAAAGATGCTCAGTCCAAACTTGCTGACCTGGAAGCCGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCTCTGGATGTTGAAATTGCTACTTACAGAAAACTGCTGGAAGGCGAAGAATTCAGGCTTAATTCAGATGTCAATAATGTCAGCATTTCTGTCATTAGCTCCGGTGGCAAAAGTTCCCTaggaggaggaggaggaggagcaggcttcggctttggaagtggtggtggtgccttcggtggaagtggtggcggtgccttcggtggaagtagtggcggtgcctacggtggaagtggtggtgcctacggtggaagtggtggtgctgcctttggtggcagtggtATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGCAGTGCAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGCTTTGTCTCATANGGGCTATTATCTTGCTCGTCATCAGCATATCTGTGCAGAGAAAAATGATAATAACTATAAATANTCATGATACCTCTCTCACGCATT
  5   1   2       bld Skin                            IMAGE:8643598.5p                                                                                                                                                                                                                                                                                                                                             AGCATTTCTGTCATTAGCTCCGGTGGCAAAAGTTCCCTaggaggaggaggaggaggagcaggcttcggctttggaagtggtggtggtgccttcggtggaagtggtggcggtgccttcggtggaagtagtggcggtgcctacggtggaagtggtggtgcctacggtggaagtggtggtgCTGCCTTTGGTGGCAGTGGTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGCAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGaaaaaaatgataaaataaacataataaaaataatacaatgaaataCACATCTCTCCCAAACTGCATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAGGTAAATAATNCATGCAGATCCTGCAGTGGCACAACAGAAGCAACATGAAAGTCATATGAACATTGTCACTCTATTCTACATTGCAATCCTCTCATAGGNA
  5   1   2       bld Skin                            IMAGE:8642990.5p                                                                                                                                                                                                                                                                                                                                                                                                       CAGGCTTCGGCTTtggaagtggtggtggtgccttcggtggaagtggtggcggtgccttcggtggaagtagtggcggtgcctacggtggaagtggtggtgcctacggtggaagtggtggtgCTGCCTTTGGTGGCAGTGGTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGCAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAgaaaaaaatgataaaataaacataataaaaataatacaatgaaataCACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAATAATNATGCAGATCCTGCAGTGGCACAACAGAAGCAACATGAAAGTCATATGAACATGGTCACTCTATTCCTACTTGCAATCCTCTCATANGGATACGTATGTCTGAGTGTCACGACTTACATGTACCATAACAATCTGTCATaaaaaaaaaaaaaaaaGGCGCCAGCTATCCAACGGCGGCCTCCTATATTTATATCAAGAAAAT
  3   1   2       bld Tail                            IMAGE:8542773.3p                                                                                                                                                                                                                                                                                                                                                                                                                   GTGCCAAAGATCCTAGGAGAGAGAGGGACAGCCGCTGAGTGTGTGGGCTTCGTGAGGTGCGGTCCTCGGTGAGTAGTGGCGGTCCTACGTGAGGTGTGCTTACGTGAAGTGTGGTGCTGCCTAGTTGCAGTGTATTCCTGGCTCCAGGAGGTGGAGGATCAGCTCCTCAGCTCCTCATTTGTTGGTGGCGTCAGCAGTGGGAGGTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGGAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGAAAAAAATGATAAAATAAACATAATAAAAATAATACAATGAAATACACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCTCAATAAGGGATACTGTTATATTTTCAC
  5   1   2       bld Skin                            IMAGE:8645012.5p                                                                                                                                                                                                                                                                                                                                                                                                                       aagtggtggtggtgccttcggtggaagtggtggcggtgccttcggtggaagtagtggcggtgcctacggtggaagtggtggtgcctacggtggaagtggtggtgctgcctttggtggcagtggtATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGGAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGaaaaaaatgataaaataaacataataaaaataatacaatgaaataCACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAAACATGAAAGTCATTATGAAACATTGGTCACCTCTATTCCTACATTGCAATCCCTCTCATANGGATACTGTATGTTCTGTAGTGTCACTGACTTATCATGTACACAATAACAGATCTGCTGCATATaaaaaaaaaaaaaaaa
  5   1   2       bld Skin      in                    IMAGE:8640907.5p                                                                                                                                                                                                                                                                                                                                                                                                                           ggtggtggtgccttcggtggaagtggtggcggtgccttcggtggaagtagtggcggtgcctacggtggaagtggtggtgcctacggtggaagtggtggtgctgcctttggtgGCAGTGGTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGCAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGaaaaaaatgataaaataaacataataaaaataatacaatgaaataCACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAATTCCTCTCNATANGGNATACTGTATGTTCTG
  3   1   2      seed Skin      in                    IMAGE:8640221.3p                                                                                                                                                                                                                                                                                                                                                                                                                              TGTGTGCCNTTCGTGGNAAGTGTGGNCGTGCCNTTCGGTGGAAGTAGTGGCGGTGCNTACGTGGnAAGTGGTGGTGCCTACGGTGGAAGTGGTGGTGCTGCCTTTGGTGGCAGTGGTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGGAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGAAAAAAATGATAAAATAAACATAATAAAAATAATACAATGAAATACACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCTCAATAAGGGATACTGTTATGTTTCTGTAGTGTCCACTGACTTAATCATGAGCACAATACAG
  3   1   2       bld Skin      in                    IMAGE:8640907.3p                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTCGTTGAAGTTGTGGCGTGCCTTCGGTGGAAGTAGTGGCGGTGCCTACGGTGAAGTGGTGGTGCCTACGGTGGAAGTGGTGGTGCTGCCTTTGGTGGCAGTGGTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGCAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGAAAAAAATGATAAAATAAACATAATAAAAATAATACAATGAAATACACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATTCCTCTCAATAAGGGATACTGTTATGTTTCTGTAGTGTCCACNGACTTAATCATGAGCACACTCCCCATTGACTTNNTTTT
  3   1   2       bld Skin      in                    IMAGE:8641519.3p                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTTGGTGGAAGTGTGGCGGTGCCTTGGTGGAAGTAGTGCGGTGCnTACGGTGAAAGTGTGGTGCnTACGTGGAAGTGGTGGTGCTGCCTTTGGTGNCAGTGGTATTTCCTTTGACTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGGAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGAAAAAAATGATAAAATAAACATAATAAAAATAATACAATGAAATACACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCTCAATAAGGGATACTGTTATGTTTCTGTAGTGTCCACTGACTTAATCATGAGCCAAACATCTTTTNNNNNAAGGTGCT
  3   1   0       chi Skin      in                    IMAGE:8640453.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACGGTGGGCCAACCTTATTTGGGCCCCTAGAAAACCAAGATATTTTTTTTTTGCGGGATCCCAAAGATTGAATTTTTCCCCCCCCTTGGGGGCAAGGGTTTTTCCTTGGCTCAGGGAGGGGAAGATTCAGTTCCCCAGCTCCTCATTTGGGGGGGCGTCAGCAGTGGGAGTTTTCATCGAGTCAGTCCAGTTACAGGAGTTAATCAAGTCCAGAAAGGAGCCCGAAATCCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTATTACAAATACTGATTGCTGTAAACATGTTGNTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGGAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGAAAAAAATGATAAAATAAACATAATAAAAATAATACAATGAAATACACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCTCAATAAGGGATACTGTTAGGTTCTGTAGTCTCCAC
  3   1   2       bld Skin                            IMAGE:8641813.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAATGGTGCGGTGCTTCCGTGGAAGTAGTGCGGTGCCTACGGTGAAAGTGTGGTGCNTACGGTGGAAGTGGTGGTGCTGCTTTTGTGGCACATGGTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCTCAAAGCTCTTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGCAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGAAAAAAATGATAAAATAAACATAATAAAAATAATACAATGAAATACACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCTCAATAAGGGATACTGTTATGTTTCTGTAGTGTCCACGACTTAATCATGGCCCAAACATTTTTTNNNNNNNCCCGC
  3   1   0       chi Skin                            IMAGE:8641408.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTAAATAGAGAGTTCGATCTTTTTTGCTAACGTTTGATTTATGCTTATATGTGGGTGAAGTGCTGGAGGATGGGCGTTGGTTTGGGGGGTGATGATCTTATTTTGTCTAATAGTCAGTATGCTTTCTAAGAGAAGTTCATCTTTTGTAGTGGTGTTCATGAGCTGAAGTTATGATCAAATCAGTCCGCTCATTGTAGTATATTTTGTCTGTTAGGAGCGCCATTTATCATTGTCCAGGACTCACAGATTCTTTCATTTGCGTGTTAATACAAATAGAGATGTACTGTCNTCTTGTTGGTAGGCAAAACCTATCCCCATGCCTTTCTGTCTTACTAAAGCACACGCTGTGTAGTGGAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTTTTGTATGCTGGTCCATCAAGCATAATCTTGTGCAGGAGAAAAAAATGATAAAATAAACATAATAAAAATAATACAATGAAATACACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCTCAATAAGGGATACTGTTATGTTTGTGCAATTTACACTGCCTTANCCCCCCNCnnnnnnnnnnAnnnnnTnnnnnAAAAGTATAGG
  5  -1   2       bld Skin                            IMAGE:8642303.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTCTCGGGAAGGGGCGTCTTCGTAATTAGGCGTCCTCGTGGAGGGTGTGCTCGTGGAAGGGTGTGCTACGTGGAAGTGTGTGCTGCTTGGTGCCAGTGTATTCTTTGGCTCAGAAGTGAGGATTCAGCTCCTCAAGCTCCCATTTGGTGGTGCGTCAGCAGTGGGAGGTTTCATCGAGTCAGTCCAGTTACAGGAGTAATCCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCAATTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGGAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTTTCCTCAATAAGGGGCTCTTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGaaaaaaattataaaataaacataataaaaataatacaatgaaataCACATCTCTCCCAACTGCAATATAAGGATTCATTTCATCTGTGAGTCTGATGCCCCATCATTGCTTTATAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCCCAATAAGGGATACTGTTATGTTTCTGTAGTTGTCCACTGACTTTAAGCATTGTAGCACAAATAAACAGAATTCTGCTGCAATTaaaaaaaaaaaaaaa
  5   1   2       bld Skin                            IMAGE:8642189.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCCTAcggtggaagtggtggtgcctacggtggaagtggtggtgctgcctttggtggCAGTGGTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGGAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGaaaaaaatgataaaataaacataataaaaataatacaatgaaataCACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCTCAATAAGGATACTGTTATGTTCTGTAGTTGTCACTGACTTTATCATGTAGCACAATAACAGAATCTGCTGCATATAANNAAnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnGGGGGGGCGCAGCTGATCTAAACCGGCGCCTCGCC
  5   1   2       bld Skin      in                    IMAGE:8641449.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           gtggaagtggtggtgcctacggtggaagtggtggtgctgcctttggtggcagtggTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGCAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAgaaaaaaatgataaaataaacataataaaaataatacaatgaaataCACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCTCTCATAAGGGATACTGTATGTTCTGTAGTGTCACTGACTTAATCATGTACACAATAACAGAATCTGCTGCATTaaaaaaaaaaaaaaaaaaaaaaaaaaGGCGCGCAGCTGAATTCAACGCGTCAGCTTCCCTATGACGATACAACAACTGAAAA
  3   1   2       chi Skin      in                    IMAGE:8641449.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGAAGTGGTTGTGCCTTACGTGGGAAGTGGTGGTGCTGCCTTTGGTGGCAGTGGTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGCAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGAAAAAAATGATAAAATAAACATAATAAAAATAATACAATGAAATACACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCTCAATAAGGGATACTGTTATGTTTCGTACGTTTCAATGGCCNTAATTATGTGCNAAATGGCAACCGGACGGAAGAAGTTTAATGGGTT
  5   1   2       bld Skin                            IMAGE:8643837.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTACGGTGGAAGTGGTGGTGCTGCCTTTGGTGGCAGTGGTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGCAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGaaaaaaatgataaaataaacataataaaaataatacaatgaaataCACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCTCAATAAGGGATACTGTTATGTTTCTGTAGTTGTCACTGACTTTATCATTGTAGCACNAATAACAGAATCTGCTGCATATaaaaaaaaaaaaaaaaaaaaaaaGGCGGCGCAAGCTGATTCCTAACGCGCTCAGCTCTCGCTAATGATCTATACTAATCAACTGAAGATCTGTGATTGACACACACGATGATGA
  5   1   2       bld Skin                            IMAGE:8640281.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TACGGTGGAAGTGGTGGTGCTGCCTTTGGTGGCAGTGGTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGGAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGaaaaaaatgataaaataaacataataaaaataatacaatgaaataCACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTGCAAATCCCTCTCAATAGGGAACTGTTATGTTCTGTAGTTGTCCCTGACTTAATCATGTACACAATAACAGAATTTCTGCATATAGaaaaaaaaaaaaaaaaaaGGCGGCCCAGCCAATATCAACCCGCCACCCCGCCATATGACATATATCAACTAAATATTATATTGAAACAAAAGCGAAATCT
  5   1   2       bld Skin                            IMAGE:8642588.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCTACTNCCTTTCNCTNCACTCATATTTCCTCCCTTTTAAGAGGTGGAGGATTCAGCTCCTCAAGCTCCAGGTTGGGTGGTGGCGTCAGCAGATGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCAATTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGGAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTTTCCTCAATAAGGGGCTCTTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGaaaaaaattataaaataaacataataaaaataatacaatgaaataCACATCTCTCCCAACTGCAATATAAGGATTCATCTCATCTGTGAGTCTGATGCCCCATCATTGCTTTATAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCCCAATAAGGGATACTGTTATGTTTCTGTAGTTGTCCATTGACTTTAAGCATTGTAGCACAAATAAACAGAACTCTGCTGCaaaaaaaaaataaaaaaacaaaaaaaaGGGGCGGCGCAAGGCTGAATCTTAGACCCGCTCGAGCTTCCCCTATTGGATCTATTACTAATCCGACTGAAAAACTTGTGGTTGGAAACCACCTGATGCGGAAAAGTTTTTGGATTTTAGCTTGCTATTGAATTAAATG
  5   1   2       bld Skin                            IMAGE:8642205.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCTGCCTTTGGTGGCAGTGGTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGCAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGaaaaaaatgataaaataaacataataaaaataatacaatgaaataCACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCTCAATAAGGGATACTGTTATGTTTCTGTAGTTGTCCACTGACTTTAATCATTGTAGCACAATAAACAGAATTCTGCTGNCATATaaaaaaaaaaaaaaaaaaaaaaGGGCGGCCGCAGGCTGATATCTCAGACGCGCTCAGCTCTCGCTAAGGATCGATACTAATCGACTGAAGATCATGTGAGTGGACACCACTA
  5   1   2       bld Skin      in                    IMAGE:8640453.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGCCTTTGGTGGCAGTGGTATTTCCTTTGGCTCAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGGAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGaaaaaaatgataaaataaacataataaaaataatacaatgaaataCACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCTCAATAANGGGATACTGTATGTTTCTGTAGTTGTCCACTGACTTTATCATTGTAGCACAAATAACANGAATCTGCTGCATATNaaaaaaaaaaaaaaaaaaaGGGCGCGCAGGCTGATTCCTAACGCGCTCAGCTCCGCTAATGATCGATACTAATCAGATGAAGATCTGTGAGTGACACCACTGATGCTGAAAGCTATGGAATG
  5   1   2       bld Skin                            IMAGE:8643699.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGGAGGTGGAGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGGAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGaaaaaaatgataaaataaacataataaaaataatacaatgaaataCACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCTCAATAAGGGATACTGTTATGTTTCTGTAGTTGTCCACTGACTTTAATCATTGTAGCACAAATAAACAGAATTCTGCTGNCATATaaaaaaaaaaaaaaaaaaaaaaaaaaaGGCGGCCGCAGGCTGATTCTCTAGACGCGCTCGAGCTCTCGCCTATGTGAGTCGTATACGTGATCAGACTGATAGATCATGATGAGTTGGACACACACTGATGATGAAAAAGCTTATGTGAATGGAGCATGCTATTGACATAAGCGCAA
  5   1   2       chi Skin                            IMAGE:8640820.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGTGTGATTAAAGGAAGAACTCATTAGAATTCGAATTCGTCCCCAAAAGTTCCCTaggaggaggaggaggaggagcaggagTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGCAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCTTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGaaaaaaatgataaaataaacataataaaaataatacaatgaaataCACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCTCAATAAGGGATACTGTTATGTTTCTGTAGTTGTCCACTGACTTTAATCATTGTAGCACAAATAAACAGAATTCTGCTGCAATaaaaaaaaaaaaaaaaaaaaaaaaaTG
  5   1   2       bld Skin                            IMAGE:8644092.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCATTTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGCAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTGTCCTCAATAAGGGGCTATTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAgaaaaaaatgataaaataaacataataaaaataatacaatgaaataCACATCTCTCCCAACTGCAATTTAAGGATTCATCTCATCTGTGACTCTGATGCCCCATCATTGCTTTACAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCTCAATAAGGGATACTGTTATGTTTCTGTAGTTGTCCACTGACTTTAATCATTGTAGCACAAATAAACAGAATTCTGCTGCaaaaaaaaaaaaaaaaaaaaaaaaaaNGGGCGGCGCAAGGCTGATATTCTAGACGCGCTCGAGCTCTCGCCTATATGAGCGTATACGTGATCAGACTGATAGATCATGATGAGTTGGACACACACAGATGCATGAAAATGCTTATGGAATTGGAGCATGCTATTGACATAAGCGCATACAGTAACAATG
  3   1   2       bld Skin      in                    IMAGE:8641014.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCAATTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGGAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTTTCCTCAATAAGGGGCTCTTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGAAAAAAATTATAAAATAAACATAATAAAAATAATACAATGAAATACACATCTCTCCCAACTGCAATATAAGGATTCATCTCATCTGTGAGTCTGATGCCCCATCATTGCTTTATAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCCCAATAAGGGATACTGTTATGTTTCTGTAGTGTCCACGACCTTAAGCATGAGCCCAANNNCCNTTGCTTNNNNNNTTTTCC
  5   1   2       bld Skin      in                    IMAGE:8641014.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCTCCTCATTTGGTGGTGGCGTCAGCAGTGGGAGGTTTTCATCGAGTCAGTCCAGCTACAGGAGTTAATCAAGTCAAGAAATGAGGCCAGAAATCAGTGCCCAGAACACACAGAATCATTCAATTGCCTGTTAATACAAATACTGATTGCTGTAAACATGTTGTTCCGCAGAACCTATCCCCATGCCTTTCTCTTTTACTAAAGCACACGCTGTGTAGTGGAGGATGTGAATAGAATTTCCAGCAGAAAGTGGCTTTAGCTTTGCCATGCCTCCACTAAGGCTTTTCCTCAATAAGGGGCTCTTATTCTATGCTCGTCCATCAAGCATAATCTTGTGCAGGAGaaaaaaattataaaataaacataataaaaataatacaatgaaataCACATCTCTCCCAACTGCAATATAAGGATTCATCTCATCTGTGAGTCTGATGCCCCATCATTGCTTTATAAAGGTAAAATAATCAATGCAGATACCTGCAGTGGCACAAACAGAAGCAAACATGAAAAGTCATTATGAAACATTGGTCACCTCTATTTCCTACATTTGCAAATCCCTCCCAATAAGGGATACTGTTATGTTTCTGTAGTTGTCCACTGACTTTAAGCATTGTAGCACAAATAAACAGAATTCTGCTGCAATTTaaaaaaaaaaaaaaaaaaaaaaaaGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)