Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6643868.5                       7 END     3           8       42                MGC80275 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl297d14.5                           15 PI      93        499     1739                novel protein similar to cell division cycle 2-like family [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012770358 Xl3.1-IMAGE:8740614.3 - 37 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8740614.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTCCCATAAGGCAGCAACGAGAGAGATTAGTTGCAGAAGACGTAAAGCAACAAGGGAAAAATGAAAGACTAGACATGGAAACAATGCTTTCAGATTTGCAAGATGTCAGTGACAGTGAGAGAAAAACTACTTCTGCAGAATCCTCCTCAGCAGGTACTGGGTCTGCCTCAGAGGAGGAAGAGGAATCTAGTTCTGAAGAATCTGAGGAAGGAGAAGAGGAGGAGGAGGAGGAGGAAGAAGAAGAGGAGGAGGATGATGATGATGAAGAGGAGGAGGAGGAAGAAACTGGAAGTAATTCCGAAGCAGTGTCCGAGCAGTCAGCAGAGGAGGTCAGTGATGAAGAGATGAGTGAAGACGAGCGAGAGAACGGGAATCATGTTCCTGTCGAATCCAGGTTTGACCATGACTCCGCTGAGAGCGAGGAAGAAGAAGAGGATGAAGAAGACATAAGAGAAATAAGTCCACATTCAAATCCCCCGACAGATGGAGACTACGTTCCAGACTCTCCAGTCATGTCACCAGTTGAGCTGAAGCAAGAATTGCCAAAATATCTTCCAGCCCTTCAGGGCTGCCGTAGTGTTGAGGAATTCCAGTGCTTGAATCGAATTGAAGAAGGGACATATGGTGTAGTGTATAGAGCAAAAGATCGTAAAACTGATGAAATTGTGGCTCTGAAACGGTTGAAAATGGAAAAAGAGAAAGAGGGATTCCCTATCACATCTCTTCGTGAGATCAACACTATCCTAAAAGCACAACACCCGAATATTGTCACAGTGAGGGAAATTGTTGTAGGAAGTAATATGGACAAAATCTACATTGTCATGAACTATGTGGAGCATGACCTGAAAAGTCTAATGGAGACCATGAAGCAGCCTTTTCTTCCAGGTGAGGTGAAGACACTCATGATTCAACTTTTAAGGGGTGTTCGGCATCTACATGATAATTGGATTCTTCATCGAGACCTTAAGACCTCTAATTTGCTGCTCAGCCATGCTGGTATCTTAAAGGTTGGAGATTTTGGTTTGGCACGCGAGTATGGATCACCACTGAAGCCTTACACACCTATTGTAGTTACCCTTTGGTATCGAGCCCCTGAGCTGTTACTGGGTGCAAAGGAATACTCTACAGCCATTGATATGTGGTCTGTAGGTTGTATATTTGGAGAACTACTGACCCAGAAACCCCTCTTTCCTGGAAAGTCTGAGATTGATCAGATTAATAAAATATTTAAGGATCTAGGGACACCGAGTGAAAAGATCTGGCCTGGGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCACCCATAAAGATATAAGAATTTGTTACTATAAAAAAAAAACTTCATTCCTTTTTGGAGTCATAAGCAAGGACTGGAACTCCGTATTCAAAGGTCTTTGACTTATTTATTTTTCACTATTGTATATTTGTAGAATTAAAAATAATTTTTAACTA
                                                  Xl3.1-CHK-1012687406                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATAAGGCAGCAACGAGAGAGATTAGTTGCAGAAGACGTAAAGCAACAAGGGAAAAATGAAAGACTAGACATGGAAACAATGCTTTCAGATTTGCAAGATGTCAGTGACAGTGAGAGAAAAACTACTTCTGCAGAATCCTCCTCAGCAGGTACTGGGTCTGCCTCAGAGGAGGAAGAGGAATCTAGTTCTGAAGAATCTGAGGAAGGAGAAGAGGAGGAGGAGGAGGAGGAAGAAGAAGAGGAGGAGGATGATGATGATGAAGAGGAGGAGGAGGAAGAAACTGGAAGTAATTCCGAAGCAGTGTCCGAGCAGTCAGCAGAGGAGGTCAGTGATGAAGAGATGAGTGAAGACGAGCGAGAGAACGGGAATCATGTTCCTGTCGAATCCAGGTTTGACCATGACTCCGCTGAGAGCGAGGAAGAAGAAGAGGATGAAGAAGACATAAGAGAAATAAGTCCACATTCAAATCCCCCGACAGATGGAGACTACGTTCCAGACTCTCCAGTCATGTCACCAGTTGAGCTGAAGCAAGAATTGCCAAAATATCTTCCAGCCCTTCAGGGCTGCCGTAGTGTTGAGGAATTCCAGTGCTTGAATCGAATTGAAGAAGGGACATATGGTGTAGTGTATAGAGCAAAAGATCGTAAAACTGATGAAATTGTGGCTCTGAAACGGTTGAAAATGGAAAAAGAGAAAGAGGGATTCCCTATCACATCTCTTCGTGAGATCAACACTATCCTAAAAGCACAACACCCGAATATTGTCACAGTGAGGGAAATTGTTGTAGGAAGTAATATGGACAAAATCTACATTGTCATGAACTATGTGGAGCATGACCTGAAAAGTCTAATGGAGACCATGAAGCAGCCTTTTCTTCCAGGTGAGGTGAAGACACTCATGATTCAACTTTTAAGGGGTGTTCGGCATCTACATGATAATTGGATTCTTCATCGAGACCTTAAGACCTCTAATTTGCTGCTCAGCCATGCTGGTATCTTAAAGGTTGGAGATTTTGGTTTGGCACGCGAGTATGGATCACCACTGAAGCCTTACACACCTATTGTAGTTACCCTTTGGTATCGAGCCCCTGAGCTGTTACTGGGTGCAAAGGAATACTCTACAGCCATTGATATGTGGTCTGTAGGTTGTATATTTGGAGAACTACTGACCCAGAAACCCCTCTTTCCTGGAAAGTCTGAGATTGATCAGATTAATAAAATATTTAAGGATCTAGGGACACCGAGTGAAAAGATCTGGCCTGGGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCACCCATAAAGATATAAGAATTTGTTACTATAAAAAAAAAACTTCATTCCTTTTTGGAGTCATAAGCAAGGACTGGAACTCCGTATTCAAAGGTCTTTGACTTATTTATTTTTCACTATTGTATATTTGTAGAATTAAAAATAATTTTTAACTAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     4     5     4     5     5     5     5     5     5     5     7     7     8     8     8     8     8     8    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    12    11    12    11    12    11    12    11    12    11    12    11    12    11    13    10    13    10    13    10    13    10    13     9    13    10    13     9    13     8    12     8    12     8    11     8     9     8     9     8     9     8     9     8    10     7    10     7    10     8    11     7     9     7     9     7     9     7     9     7    10     8    10     8    10     8    10     9    11     9    10     9    10     8     9     7     9     7    10     8    11     7    10     7    10     7    10     7     9     7     9     6     8     5     7     5     7     5     7     5     8     5     9     5     9     5     9     5     9     6     9     5     9     5     9     7    11     7    10     8    11     8    11     9    12     9    12    10    14    13    16    11    16    15    19    16    21    17    21    17    21    17    21    17    20    17    20    17    20    17    20    18    21    17    20    17    20    16    20    17    20    16    19    16    19    17    19    16    18    16    18    16    18    16    18    16    18    16    18    17    18    18    18    18    18    17    18    18    18    18    18    17    18    19    19    19    19    18    18    18    18    18    18    18    18    18    18    17    18    18    18    15    17    17    17    14    15    14    14    12    13    11    12     8    11     7    10     7    10     6    10     4     5     4     4     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---A--------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ci ---- 4e-046     NP_001071697.1 mitogen-activated protein kinase [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ce ---- 2e-128     NP_495617.1 Cell division cycle 2-like 1 (83.6 kD) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- At ---- 1e-130     NP_176925.1 protein kinase family protein [Arabidopsis thaliana] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                         PROTEIN --- Dm ---- 4e-158     NP_730563.1 CG4268-PC [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 1e-164     XP_308080.4 AGAP011055-PA [Anopheles gambiae str. PEST] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 0          XP_001192015.1 PREDICTED: similar to cell division cycle 2-like 1 (PITSLRE proteins), partial [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dr ---- 0          NP_001008646.1 zgc:101589 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Gg ---- 0          NP_001026042.1 hypothetical protein LOC419406 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Cf ---- 0          XP_856944.1 PREDICTED: similar to cell division cycle 2-like 1 (PITSLRE proteins) isoform 2 isoform 5 [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ---- 0          NP_277028.1 cell division cycle 2-like 1 (PITSLRE proteins) isoform 9 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - ?? ---- 0          XP_001789402.1 PREDICTED: cell division cycle 2-like 1 (PITSLRE proteins) [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Mm ---- 0          NP_031687.2 cell division cycle 2 homolog (S. pombe)-like 2; cell division cycle 2-like 2[Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Xt ---- 0          CAJ83303.1 novel protein similar to cell division cycle 2-like family [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Xl ---- 0          NP_001086696.1 MGC80275 protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8740614.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------ATG------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------ATG------------------TGA------------TGA---------------------------------------------------------------------------------------------------------------TGA------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2       bld Ga15      in                       XL468o10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAGAGAAGCAGCTGCACATCACAGAACAGCGAGGGAAGACCATAGTGAAAAAAACAAAGTTATCCGTAGTCGAAGTCCCATAAGGCAGCAACGAGAGAGATTAGTTGCAGAAGACGTAAAGCAACAAGGGAAAAATGAAAGACTAGACATGGAAACAATGCTTTCAGATTTGCAAGATGTCAGTGACAGTGAGAGAAAAACTACTTCTGCAGAATCCTCCTCAGCAGGTACTGGGTCTGCCTCAGAGGAGGAAGAGGAATCTAGTTCTGAAGAATCTgaggaaggagaagaggaggaggaggaggaggaagaagaagaggaggaggatgatgatgatgaagaggaggaggaggaAGAAACTGGAAGTAATTCCGAAGCAGTGTCCGAGCAGTCAGCAGAGGAGGTCAGTGATGAAGAGATGAGTGAAGACGAGCGAGAGAACGGGAATCATGTTCCTGTCGAATCCAGGTTTGACCATGACTCCGCTgagagcgaggaagaagaagaggatgaagaagacataagagaaATAAGTCCACATTCAAATCCCCCGACAGATGGAGACTACGTTCCAGACTCTCCAGTCATGTCACCAGTTGAGCTGAAGCAAGAATTGCCAAAATATCTTCCAGCCCTTCAGGGCTGCCGTANTGTTGAGGAATTCCAGTGCTTGAATCNAATTGAANAAGGGACNTATGGTGTANTGTATANANCANAANATCGTANNCTGATGAAATTGTGGCTCTGAA
  5   1   2       bld Oo1                             IMAGE:6642000.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAAGAGAGAAGCAGCTGCACATCACAGAACAGCGAGGGAAGAACCATAGTGAAAAAAACAAAGTTATCCGTAGTCGAAGTCCCATAAGGCAGCAACGAGAGAGATTAGTTGCAGAAGACGTAAAGCAACAAGGGAAAAATGAAAGACTAGACATGGAAACAATGCTTTCAGATTTGCAAGATGTCAGTGACAGTGAGAGAAAAACTACTTCTGCAGAATCCTCCTCAGCAGGTACTGGGTCTGCCTCAGAAGAGGaagaggaatctagttctgaagaatctgaggaaggagaagaagaggaggaggaagaagaagaggaggaggatgatgatgatgaagaggaggaggagGAAGAAACTGGAAGTAATTCCGAAGCAGTGTCCGAGCAGTCAGCAGAGGAGGTCAGTGATGAAGAGATGAGTGAAGACGAGCGAGAGAACGGGAATCATGTTCCTGTCGAATCCAGGTTTGACCATGACTCCGCTgagagcgaggaagaagaagaggatgaagaagacataagagaaATAAGTCCACATTCAAATCCCCCGACAGATGGAGACTACGTTCCAGACTCTCCAGTCATGTCACCAGTTGAGCTGAAGCAAGAATTGCCAAAATATCTTCCAGCCCTTCAGGGCTGCCGTAGTGTTGAGGAATTCCAGTGCTTGAATCGAATTGAAGAAGGGACATATGGTGTAGTGTATAGAGCAAAAGATCGTAAAACTGATGAAATTGTGGCTCTGAAACGGTTGAAAATGGAAAAAGAGAAAGAGGGATTCCCTATCACATCTCTTCGTGAGATTAACACTATCCCTAAAAGCACAACACCCCGAAATATTGTCACAGTGGAGGGAAAATTGGNTGTAGGAAAGTAATATGGGACNANATCCTACACTTGGTCATGAACCTATGTTGGAAACATGGACCTGAAAAGAGCTAAATGTGAAACCCATGNAAGCT
  3   1   2       bld Ga15      in                       XL468o10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGTCCCATAAGGCAGCNACGAGAGAGATTAGTTGCAGAAGACGTAAAGCAACAAGGGAAAAATGAAAGANTAGACATGGAAACAATGCTTTCAGATTTGCAAGATGTCANTGACAGTGAGAGAAAAACTACTTCTGCAGAATCCTCCTCAGCAGGTACTGGGTCTGCCTCAGAGGAGGAAGAGGAATCTAGTTCTGAAGAATCTGAGGAAGGAGAAGAGGAGGAGGAGGAGGAGGAAGAAGAAGAGGAGGAGGATGATGATGATGAAGAGGAGGAGGAGGAAGAAACTGGAAGTAATTCCGAAGCAGTNTCCGAGCAGTCAGCAGAGGAGGTCAGTGATGAAGAGATGAGTGAAGACGAGCGAGAGAACGGGAATCATGTTCCTGTCGAATCCAGGTTTGACCATGACTCCNCTGAGAGCGAGGAAGAAGAAGAGGATGAAGAAGACATAAGAGAAATAAGTCCACATTCAAATCCCCCGACAGATGGAGNCTACGTTCCAGACTCTCCAGTCATGTCACCAGTTGAGCTGAAGCAAGAATTGCCAAAATATCTTCCAGCCCTTCAGGGCTGCCGTAGTGTTGAGGAATTCCAGTGCTTGAATCGAATTGAAGAAGGGACATATGGTGTAGTGTATAGAGCAAAAGATCG
  5   1   2       add Ga18      in                      xlk120h01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGACATGGAAACAATGCTTTCAGATTTGCAAGATGTCAGTGACAGTGAGAGAAAAACTACTTCTGCAGAATCCTCCTCAGCAGGTACTGGGTCTGCCTcagaggaggaagaggaatctagttctgaagaatctgaggaaggagaagaggaggaggaggaggaagaagaagaggaggaggatgatgatgatgaagaggaggaagaaACTGGAAGTAATTCCGAAGCAGTGTCCGAGCAGTCAGCAGAGGAGGTCAGTGATGAAGAGATGAGTGAAGACGAGCGAGAGAACGGGAATCATGTTCCTGTCGAATCCAGGTTTGACCATGACTCCGCTgagagcgaggaagaagaagaggatgaagaagacataagagaaATAAGTCCACATTCGAATCCCCCGACAGATGGAGACTACGTTCCAGACTCTCCAGTCATGTCACCAGTTGAGCTGAAGCAAGAATTGCCAAAATATCTTCCAGCCCTTCNNNNNNCGTAGTGTTGAGGAATTCCAGTGCTTGAATCGAATTGAAGAAGGGACATATGGTGTAGTGTATAGAGCAAAAGATCGTAAAACTGATGAANNTGTGGCTCTGAAACGGTTGAAAATGGAAAAGAGAAAGNNGGNNTCCCTATCACATCTCTNCNTGAGATCNACACTNTCCTAAAAGCANNNNNNCCGAATATTGTCACAGTNNNGGAAATTG
  5   1   2       bld Emb1                            IMAGE:3402572.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACGCGTCcggaagaagaagaagaggaggaggaggatgatgatgatgaagaggaggaggaggaaGAAACTGGAAGTAATTCCGAAGCAGTGTCCGAGCAGTCAGCAGAGGAGGTCAGTGATGAAGAGATGAGTGAAGACGAGCGAGAGAACGGGAATCATGTTCCTGTCGAATCCAGGTTTGACCATGACTCCGCTgagagcgaggaagaagaagaggatgaagaagacataagagaaATTAGTCCACATTCAAATCCCCCGACAGATGGAGACTACGTTCCAGACTCTCCAGTCATGTCACCAGTTGAGCTGAAGCAAGAATTGCCAAAATATCTTCCAGCCCTTCAGGGCTGCCGTAGTGTTGAGGAATTCCAGTGCTTGAATCGAATTGAAGAAGGGACATATGGTGTAGTGTATAGAGCAAAAGATCGTAAAACTGATGAAATTGTGGCTCTGAAACGGTTGAAAATGGAAAAAGAGAAAGAGGGATTCCCTATCACATCTCTTCGTGAGATCAACACTATCCTAAAAGCACAACACCCGAATATTGTCACAGTGAGG
  5   1   2       bld Egg1      in                    IMAGE:4783839.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGGAAGTAATTCCGAAGCAGTGTCCGAGCAGTCAGCAGAGGAGGTCAGTGATGAAGAGATGAGTGAAGACGAGCGAGAGAACGGGAATCATGTTCCTGTCGAATCCAGGTTTGACCATGACTCCGCTgagagcgaggaagaagaagaggatgaagaagacataagagaaATTAGTCCACATTCAAATCCCCCGACAGATGGAGACTACATTCCAGACTCTCCAGTCATGTCACCAGTTGAGCTGAAGCAAGAATTGCCAAAATATCTTCCAGCCCTTCAGGGCTGCCGTAGTGTTGAGGAATTCCAGTGCTTGAATCGAATTGAAGAAGGGACATATGGTGTAGTGTATAGAGCAAAAGATCGTAAAACTGATGAAATTGTGGCTCTGAAACGGTTGAAAATGGAAAAAGAGAAAGAGGGATTCCCTATCACATCTCTTCGTGAGATCAACACTATCCTAAAAGCACAACACCCGAATATTGTCACAGTGAGGGAAATTGTTGTAGGAAGTAATATGGACAAAATCTACATTGTCATGAACTATGTGGAGCATGACCTGAAAAGTCTAATGGAGACCATGAAGCAGCCTTTTCTTCCAGGTGAGGTGAAGACACTCATGATTCAACTT
  3   1   2       bld Ooc2                            IMAGE:3745586.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAGTAATTCGGAAGCAGTGTCCGAGCAGTCAGCAGAGGAGGTCAGTGATGAATAGATGAGTGAAGACGAGCGAGAGAACGGGAATCATGTTCCTGTGGAATCCAGGTTTGACCATGACTCCGCTGAGAGCGAGGAAGAAGAAGAGGATGAAGAAGACATAAGAGAAATAAGTCCACATTCTAATCCCCCGACAGATGGAGACTACGTTCCAGACTCTCCAGTCATGTCACCAGTTGAGCTGAAGCAAGAATTGCCAAAATATCTTCCAGCCCTTCAGGGCTGCCGTAGTGTTGAGGAATTCCAGTGCTTGAATCGAATTGAAGAAGGGACATATGGTGTAGTGTATAGAGCAAAAGATCGTAAAACTGATGAAATTGTGGCTCTGAAACGGTTGAA
  5   1   2       bld Brn1                            IMAGE:6951943.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAAGCAGTGTCCGAGCAGTCAGCAGAGGAGGTCAGTGATGAAGAGATGAGTGAAGACGAGCGAGAGAACGGGAATCATGTTCCTGTCGAATCCAGGTTTGACCATGACTCCGCTgagagcgaggaagaagaagaggatgaagaagacataagagaaATTAGTCCACATTCAAATCCCCCGACAGATGGAGACTACATTCCAGACTCTCCAGTCATGTCACCAGTTGAGCTGAAGCAAGAATTGCCAAAATATCTTCCAGCCCTTCAGGGCTGCCGTAGTGTTGAGGAATTCCAGTGCTTGAATCGAATTGAAGAAGGGACATATGGTGTAGTGTATAGAGCAAAAGATCGTAAAACTGATGAAATTGTGGCTCTGAAACGGTTGAAAATGGAAAAAGAGAAAGAGGGATTCCCTATCACATCTCTTCGTGAGATCAACACTATCCTAAAAGCACAACACCCGAATATTGTCACAGTGAGGGAAATTGTTGTAGGAAGTAATATGGACAAAATCTACATTGTCATGAACTATGTGGAGCATGACCTGAAAAGTCTAATGGAGACCATGAAGCAGCCTTTTCTTCCAGGTGAGGTGAAGACACTCATGATTCAACTTTTAAGGGGTGTTCGGCATCTACATGATAATTGGATTCTTCATCGAGACCCTTAAGACCTCTAATTTGCTGCTCAGCCATGCTGGTATCTTAAAGGTTGGAGATTTTGGTTTTGGCACGCGGAGTATGGGATCACCACTGAAAGCCTTACACACCCTATTGTAGTTTACCCCTTTTGGTAATCGAAGCCCCTGGAACCTGTTTACTTGGGGGGCGCAAGGGAAATAACTCCTTACAGGCCCATTGGGAAATGGTGGGGTCCCTGGTAAGGGC
  5   1   2       bld Neu7      in                         XL045o05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGGTCAGTGATGAAGAGATGAGTGAAGACGAGCGAGAGAACGGGAATCATGTTCCTGTCGAATCCAGGTTTGACCATGACTCCGCTGAGAGCGAGGAAGAAGAAGAGGATGAAGAAGACATAAGAGAAATTAGTCCACATTCAAATCCCCCGACAGATGGAGACTACGTTCCAGACTCTCCAGTCATGTCACCAGTTGAGCTGAAGCAAGAATTGCCAAAATATCTTCCAGCCCTTCAGGGCTGCCGTAGTGTTGAGGAATTCCAGTGCTTGAATCGAATTGAAGAAGGGACATATGGTGTAGTGTATAGAGCAAAAGATCGTAAAACTGATGAAATTGTGGCTCTGAAACGGTTGAAAATGGAAAAAGAGAAAGAGGGATTCCCTATCACATCTCTTCGTGAGATCAACACTATCCTAAAAGCACAACACCCGAATATTGTCACAGTGAGGGAAATTGTTGTAGGAAGTAATATGGACAAAATCTACATTGTCATGAACTATGTGGAGCATGACCTGAAAAGTCTAATGGAGACCATGAAGCAGCCTTTTCTTCCAGGTGAGGTGAAGACACTCATGATTCAACTTTTAAGGGGGTGTTCGGCATCTACATGATAATTGGATTCTTCATCGAGAC
  5   1   2       bld Em10                            IMAGE:8321232.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTCAGTGATGAAGAGATGAGTGAAGACGAGCGAGAGAACGGGAATCATGTTCCTGTCGAATCCAGGTTTGACCATGACTCCGCTgagagcgaggaagaagaagaggatgaagaagacataagagaaATTAGTCCACATTCAAATCCCCCGACAGATGGAGACTACATTCCAGACTCTCCAGTCATGTCACCAGTTGAGCTGAAGCAAGAATTGCCAAAATATCTTCCAGCCCTTCAGGGCTGCCGTAGTGTTGAGGAATTCCAGTGCTTGAATCGAATTGAAGAAGGGACATATGGTGTAGTGTATAGAGCAAAAGATCGTAAAACTGATGAAATTGTGGCTCTGAAACGGTTGAAAATGGAAAAAGAGAAAGAGGGATTCCCTATCACATCTCTTCGTGAGATCAACACTATCCTAAAAGCACAACACCCGAATATTGTCACAGTGAGGGAAATTTGTTGTAGGAAGTAATATGGACAAAATCTACATTGTCATGAACTATGTGGAACATGACCTGAAAAGTCTAATGGAGACCATGAAGCAGCCTTTTCTTCCAGGTGAGGTGAAGACTCTCATGATTCAACTTTTAAGGGGTGTTCTGCATCTACATGATTATTGGATTCTTCATCGAGGACCTTTAGACCCTCAATTTTGCTGCTCAACCATGCTGGTATCT
  3   1   2       bld Egg4                            IMAGE:3743210.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCATCCAAATCCCCCGACAGATGGAGACTACGTTCCAGACTCTCCAGTCATGTCACCAGTTGAGCTGAAGCAAGAATTGCCAAAATATCTTCCAGCCCTTCAGGGCTGCCGTAGTGTTGAGGAATTCNCAGTGCTTGAATCGAATTGAAGAAGGGACATATGGTGTAGTGTATAGAGCAAAAGATCGTAAAACTGATGAAATTGTGGCTCTGAAACGGTTGAAA
  5  -1   2       bld Bla2                            IMAGE:7299198.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTACAGTgagagagagagaTTCTATCGTGCTTCGTGCGGAAAGGGAGACTAGGATGCACTCATCCCGCGTGGATCTCAGCTTCATCATTCACAGTGAGTAGCAGATGCAATATTTCAGCCTCAGGTGCGTAGTGTGAGATTCCATGCTGATCGAATGAAGAGGACATTGGTGTAGGTTAGAGCAAAAGACGTAAAACTGAGAAATTGGGCTCTGAAACGGTGAAAATGGAAAAAGAGAAAGAGGGATTCCCTATCACATCTCTTCGTGAGATCAACACTATCCTAAAAGCACAACACCCGAATATTGTCACAGTGAGGGAAATTGTTGTAGGAAGTAATATGGACAAAATCTACATTGTCATGAACTATGTGGAACATGACCTGAAAAGTCTAATGGAGACCATGAAGCAGCCTTTTCTTCCAGGTGAGGTGAAGACACTCATGATTCAACTTTTAAGGGGTGTTCGGCATCTACATGATAATTGGATTCTTCATCGAGACCTTAAGACCTCTAATTTGCTGCTCAGCCATGCTGGTATCTTAAAGGTTGGAGATTTTGGTTTGGCACGCGAGTATGGATCACCACTGAAGCCTTACACACCTATTGTAGTTACCCTTTGGTATCGAGCCCCTGAGCTGTTACTGGGTGCAAAGGAATACTCTACAGCCATTGATATGTGGTCTGTAGGTTGTATATTTGGAGAACTACTGACCCAGAAACCCCTCTTTCCTGGAAAGTCTGAGATTGATCAGATTAATAAAATATTTAAGGATCTAGGGACACCGAGTGAAAAGATCTGGCCTGGGTAAAAGAAGAATaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCAATCGCCCAAGATT
  5   1   2       bld Bone      in                    IMAGE:8740614.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCAGTTCTGCATGGCCCTAGCACATCACATTCGAATTCGTCCCGAATTCCAGTGCTTGAATCGAATTGAAGAAGGGACATATGGTGTAGTGTATAGAGCAAAAGATCGTAAAACTGATGAAATTGTGGCTCTGAAACGGTTGAAAATGGAAAAAGAGAAAGAGGGATTCCCTATCACATCTCTTCGTGAGATCAACACTATCCTAAAAGCACAACACCCGAATATTGTCACAGTGAGGGAAATTGTTGTAGGAAGTAATATGGACAAAATCTACATTGTCATGAACTATGTGGAGCATGACCTGAAAAGTCTAATGGAGACCATGAAGCAGCCTTTTCTTCCAGGTGAGGTGAAGACACTCATGATTCAACTTTTAAGGGGTGTTCGGCATCTACATGATAATTGGATTCTTCATCGAGACCTTAAGACCTCTAATTTGCTGCTCAGCCATGCTGGTATCTTAAAGGTTGGAGATTTTGGTTTGGCACGCGAGTATGGATCACCACTGAAGCCTTACACACCTATTGTAGTTACCCTTTGGTATCGAGCCCCTGAGCTGTTACTGGGTGCAAAGGAATACTCTACAGCCATTGATATGTGGTCTGTAGTTGTATATTTGGAGAACTACTGACCCAGAAACCCCTCTTTCCTGGAAAGTCTGAGATTGATCAGATTAATAAATATTTAAGATCTAGGGACACGAGTGAAAAGATCTGGCCTGGGTACATGACTCCTGCATTAGAAAATGACTTCACTGATATCGTATAACATCTTCGTAAGAGATTGGTGCCTGCTTTCCGACAGATTTGGACCTGAACAGTTCTCCATATGTCAGCAAAGAAAATCATGCAGATGCTTAAGACATGATATTCTGAATCATCATTGAACGCAGTTCACATGCACCCTT
  5   1   2       bld Egg1                            IMAGE:4784027.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGATCATCACTATCCTAAAAGCACAACACCCGAATATTGTCACAGTGGAGGGAAATTGTTGTAGGAAGTAATATGGACAAAATCTACATTGTCATGAACTATGTGGAGCATGACCTGAAAAGTCTAATGGAGACCATGAAGCAGCCTTTTCTTCCAGGTGAGGTGAAGACACTCATGATTCAACTTTTAAGGGGTGTTCGGCATCTACATGATAATTGGATTCTTCATCGAGACCTTAAGACCTCTAATTTGCTGCTCAGCCATGCTGGTATCTTAAAGGTTGGAGATTTTGGTTTGGCACGCGAGTATGGATCACCACTGAAGCCTTACACACCTATTGTAGTTACCCTTTGGTATCGAGCCCCTGAGCTGTTACTGGGTGCAAAGGAATACTCTACAGCCATTGATATGTGGTCTGTAGGTTGTATATTTGGAGAACTACTGACCCAGAAACCCCTCTTTCCTGGAAAGTCTGAGATTGATCAGATTAATAAAATATTTAAGGATCTAGGGACACCGAGTGAAAAGATCTGGCCTGGGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCG
  5   1   2       bld Ga15                               XL504p02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATATTGTCACAGTGAGGGAAATTGTTGTAGGAAGTAATATGGACAAAATCTACATTGTCATGAACTATGTGGAGCATGACCTGAAAAGTCTAATGGAGACCATGAAGCAGCCTTTTCTTCCANGTGAGGTGAAGACACTCATGATTCANCTTTTAAGGGGTGTTCGGCATCTACATGATAATTGGATTCTTCATCNAGACCTTAAGACCTCTAATTTGCTGCTCAGCCATGCTGGTATCTTAAAGGTTGGAGATTTTGGTTTGGCA
  5   1   2       bld Gas9                                 BG409678.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCCACGCGTCCGGTGGAACATGACCTGAAAAGTCTAATGGAGACCATGAAGCAGCCTTTTCTTCCAGGTGAGGTGAAGACACTCATGATTCAACTTTTAAGGGGTGTTCGGCATCTACATGATAATTGGATTCTTCATCGAGACCTTAAGACCTCTAATTTGCTGCTCAGCCATGCTGGTATCTTAAAGGTTGGAGATTTTGGTTTGGCACGCGAGTATGGATCACCACTGAAGCCTTACACACCTATTGTAGTTACCCTTTGGTATCGAGCCCCTGAGCTGTTACTGGGTGCAAAGGAATACTCTACAGCCATTGATATGTGGTCTGTAGGTTGTATATTTGGAGAACTACTGACCCAGAAACCCCTCTTTCCTGGAAAGTCTGAGATTGATCAGATTAATAAAATATTTAAGGATCTAGGTACACCGAGTGAAAAGATCTGGCCTGGGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTNCGTGAAACCCCACTTNCAATTGAGCCAGCCATGT
  5   1   2       bld DMZ                                  xl264b11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTTTTCTTCCAGGTGAGGTGAAGACACTCATGATTCAACTTTTAAGGGGTGTTCGGCATCTACGTGATAATTGGATTCTTCATCGAGACCTTAAGACCTCTNATTTGCTGCTCAGCCATGCTGGTATCTTAAAGGTTGGAGATTTTGGTTTGGCACGCGANT
  3   1   2       bld Bone      in                    IMAGE:8740614.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAACGAGAGGTGTCGCATCTACATGATAATTGATCTTCATCGAGACGTAGACTTTATTTGCTGTCAAGCCATGCTGGTATCCTAAGGTTGGAGATTTGTTGGCACGCGAGTATGGATCACCATGAAGCGTACACACTATTGTAGTACCTTTGGTATCGAGCCCCTGAGCTGTTACTGGTGCAAGGAATACTCCTACAGCCATTGATATGTGGTCTGTAGGGTGTATATTTGGAGAACTACTGACCCAGAAACCCCTCTTTCCTGGAAAGTCTGAGATTGATCAGATTAATAAAATATTTAAGGATCTAGGGACACCGAGTGAAAAGATCTGGCCTGGGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCACCCATAAAGATATAAGAATTTGTTACTATAAAAAAAAAACTTCATTCCTTTTTGGAGTCATAAGCAAGGACTGGAACTCCGTATTCAAAGGTCTTTGACTTATTTATTTTCACTATTGTATATTGAGAAA
  5   1   2       bld Egg1                               PBX0143C01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGATTCTTCATCGAGACCTTAAGACCTCTAATTTGCTGCTCAGCCATGCTGGTATCTTAAAGGTTGGAGATTTTGGTTTGGCACGCGAGTATGGATCACCACTGAAGCCTTACACACCTATTGTAGTTACCCTTTGGTATCGAGCCCCTGAGCTGTTACTGGGTGCAAAGGAATACTCTACAGCCATTGATATGTGGTCTGTAGGTTGTATATTTGGAGAACTACTGACCCAGAAACCCCTCTTTCCTGGAAAGTCTGAGATTGATCAGATTAATAAAATATTTAAGGATCTAGGGACACCGAGTGAAAAGATCTGGCCTGGGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATA
  3   1   2       bld Ga18      in                      xlk120h01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CNNNNTAGTTNCCCTTTGGTATCGAGNCCTGAGCTGNTNCTGGGTGCAAAGGAATNCTCTACAGCCATTGATATGTGGTCTGTAGGTTGTATATTTGGAGANCTACTGACCCAGAAACCCCTCTTTCCTGGAAAGTCTGAGATTGATCAGATTAATAAAATATTTAAGGATCTAGGTACACCGAGTGAAAAGATCTGGCCTGGGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGNNNNCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCNANCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCAGAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCACCCATAAAGATATAAGAATTTGTTACTATAAAAAAAAAACTTCATTCCTTTTTGGAGTCATAAGCAAGGACTGGACNCCGTATTCAAAGNTCTTTGACTTATTTNTTTTCACTATTGTA
  3   1   2       bld Ga18                             rxlk128n02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTAGTTACCNTTNGNTATCGAGCCCCTGAGCTNNTNCTGGGTGCAAAGNAATNCTCTACAGCCATTGATATGTGGTCTGTAGGTTGTATATTTGGAGAACTACTGACCCAGNAACCCCTCTTTCCTGGAAAGTCTGAGATTGATCAGATTAATAAAATATTTAAGGATCTAGGGACACCGAGTGAAAAGATCTGGCCTGGGTACAATGANCTCCCTGCCATTAAGAAAATGNCCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGNNNNNTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGNCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGANCNNNNATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCAGAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCACCCATAAAGATATAAGAATTTGTTACTATAAAAAAAAAACTTCATTCCTTTTTGGAGTCATAAGCAAGGACTGGACNCCGTATTCAAAGNTCTTTGACTTATTTNTTNTNNNTATTGTANAT
  5   1   2       bld Egg1                               PBX0089C06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACGAGGGAGAACTACTGACCCAGAAACCCCTCTTTCCTGGAAAGTCTGAGATTGATCAGATTAATAAAATATTTAAGGATCTAGGGACACCGAGTGAAAAGATCTGGCCTGGGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCA
  5   1   2      seed Egg1                               PBX0097H06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGAACTACTGACCCAGAAACCCCTCTTTCCTGGAAAGTCTGAGATTGATCAGATTAATAAAATATTTAAGGATCTAGGGACACCGAGTGAAAAGATCTGGCCTGGGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCACCCATAAAGATATAAGAATTTGTTACTATaaaaaaaaaaCTTCATTCCTTTTTGGAGTCATAAGCAAGGACTGGAACTCCGT
  5   1   2       bld Egg1                               PBX0030E03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCTCTTTCCTGGAAAGTCTGAGATTGATCAGATTAATAAAATATTTAAGGATCTAGGGACACCGAGTGAAAAGATCTGGCCTGNGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTANAAGATGTTTTTCCATGGGAAATTNTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCACCCATAAAGATATAAGAATTTGTTACTATaaaaaaaaaaCTTCATTCCTTTTTGGAGTCA
  5   1   2       bld Egg1                               PBX0031E02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCAGATTAATAAAATATTTAAGGATCTATGGACACCGAGTGAAAAGATCTGGCCTGCGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCTAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTATGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCCAATACTGAAAATTCCAGCATACCACCCATAATGATATAAGAATTTGTTACTATTaaaaaaaaaCTTCATTCCTTTTTGGAGTCATAAGCAAGGACT
  5   1   2       bld Neu2      in                    IMAGE:2943142.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTTTAAGGATCTAGGTACACCGAGTGAAAAGATCTGGCCTGGGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTACGTGAAACCGCACTTGCAATTGAGCCAGCCATGTATCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTAAGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTT
  5   1   2       bld Egg1                               PBX0141G01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACGAGGGATCTAGGGACACCGAGTGAAAAGATCTGGCCTGGGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTAAGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCACCCATAAAGATATAAGAATTTGTTACTATaaaaaaaaaaCTTCATTCCTTTTTG
  5   1   2       bld Egg1                               PBX0135F07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCACGAGGCGAGTGAAAAGATCTGGCCTGGGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAAGAGCTTCTGCAGCTGGGCCCAGAATCAGCCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCACCCATAAAGATATAAGAATTTGTTACTATaaaaaaaaaaCTT
  3   1   2       bld Ov1  5g3  out                   IMAGE:5073384.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGTGAAAAGATCTGGCCTGGGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAATCGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCACCCATAAAGATATAAGAATTTGTTACTATAAAAAAAAAAAAAAAG
  3   1   2       bld Neu7 5g3  out                        XL050n03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCCTGGGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTTCTTTCCGACCAAGGATTTGAACTCATGAACAAGTTTNTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACANAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCANAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATNTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCACCCATAAAGATATAAGAATTTGTTACTATAAAAAAAAAACTTCATTCCTTTTTGGAGTCATAAGCAAGGACTGGAACTCCGTATTCAAAGGTCTTTNACTTATTTATTTTTCACTA
  3   1   2       bld Neu7      in                         XL045o05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTNTCACATATTGTCCAGCAAANAGAATCAGTGCANAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACANAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAANACTGAAAATTCCAGCATACCACCCATAAAGATATAAGAATTTGNTACTATAAAAAAAAAACTTCATTCCTTTTGGAGTCATAAGCAAGGACTGGAACTCCGTATTCAAAGGTNCTTGACTTTTTNTTTTNCACTATT
  3   1   2       bld Lu1                             IMAGE:4674199.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGTACAATGAACTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCACCCATAAAGATATAAGAATTTGTTACTAT
  3   1   2       bld Neu2      in                    IMAGE:2943142.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATGAACTCCCTGCCATTAAGAAAATACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTCCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCACCCATAAAGATATAAGAATTTGTTACTATAAAAAAAAAACTTCATTCCTTTTTGGAGTCATAAGCAAGGACTGGAACTCCGTATTCAAAGGTCTTTGACTTATTTATTTTTCACTATTGTATATTTGTAGAATTAAAAATAATTTTTAACTAGAAAAAAAAAAAA
  3   1   2       bld Egg1      in                    IMAGE:4783839.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCCCTGCCATTAAGAAAATGACCTTCACTGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCACCCATAAAGATATAAGAATTTGTTACTATAAAAAAAAAACTTCATTCCTTTTTGGAGTCATAAGCAAGGACTGGAACTCCGTATTCAAAGGTCTTTGACTTATTTATTTTTCACTATTGTATATTTGTAGAATTAAAAATAATTTTTAACTAAAA
  3   1   2       bld Ov1                             IMAGE:5074170.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGATTATCCGTATAACAATCTTCGTAAGAGATTTGGTGCTCTGCTTTCAGACCAAGGATTTGAACTCATGAACAAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATTTTAAAGATACTGGATTTCCCCTGACCCCAACCAACCAAGGAGCTTTTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCCCCCATAAAGATATAAGAATTTGTTACTATAAAAAAAAAACTTCATTTCTTTTTGGAGTCATAAGCAAGGACTGGAACTCCGTATTCAAAGGTCTTTGACTTATTTATTTTTCACTATTGTATATTTGTAGAATTAAAAATAATTTTTAACTAAAAAAAAAAAAAAAAG
  3   1   2       bld Oo1  5g3  out                   IMAGE:3404936.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGTTTCTCACATATTGTCCAGCAAAGAGAATCAGTGCAGAGGATGGCTTAAAGCATGAATATTTCCGTGAAACCCCACTTCCAATTGAGCCAGCCATGTTTCCAACATGGCCAGCTAAGAGTGAACAACAGAGGGTTAAACGTGGCACAAGTCCTCGTCCCCCAGAGGGAGGCTTAGGGTACAGCCAGCTGGGAGATGATGATCTTAAAGATACTGGATTTCACCTGACCACAACCAACCAAGGAGCTTCTGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCACCCATAAAGATATAAGAATTTGTTACTATAAAAAAAAAACTTCATTCCTTTTTGGAGTCATAAGCAAGGACTGGAACTCCGTATTCAAAGGTCTTTGACTTATTTATTTTTCACTATTGTATATTTGTAGAATTAAAAATAATTTTTAACT
  3   1   2       bld Ga15                               XL483e19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCAGCTGGGCCAGGATTCAGTCTCAAGTTTTAAACTTGCCTTAAAAGATGTTTTTCCATGGGAAATTTTAGGATCTTTTGAAGTTGCAAATACTGAAAATTCCAGCATACCNCCCATAAAGATATAAGAATTTGTTACTATAAAAAAAAAACTTCATTCCTTTTTGGAGTCATAAGCAAGGACTGGAACTCCGTATTCAAAGGTCTTTGACTTATTTATTTTTCACTAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)