Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012770409 Xl3.1-xlk164m18ex.3 - 54 ESTs
                                                                       ..-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk164m18ex.3                                                                                   ACTTGTATCACCTTCAACTATACAGCGATAGATATCCGAACCTCCAAGGTGCTCCCTTGGCTCCACATGTGACTGCTATCTCCCCCCGGAAGGGTATTTGGTCTCTACCAGTTTTTGGTGTTTACAACATGGGCGCTCTGGAACGTACCAAGTTTGGAGGGGGAAACACATTCAAATTGCCCATATGTCTGGCGCTGTCCGCATATGCTCGTTTTCAGATTCCGCCGAGGCCTTTACTTAGCCTAAAAAATAAATCAAGTCGCCTCCGTTTAGCTCGTTAACTGCTCCAGCCCCCAGCCTCATTTAGTACTGTGCTGTTTCTCCGCCTCCCCCGTCTGGTGGTAGTTTCCAGCTTGTTCTCTTCCCGCCCCCCCCCAGGCCCCAATCGTCAGTTTGTGAGGAGCCGGCTGGGAGCGCGGCTCTGGGCGTTGGGATGAGGGAACCGCCATGGAGCGCAGCCCTGACAGGAAACGTCGGTGTCTCGGACCCCGATACAGTCTCTTGGCAGAGATCGGCCGCGGCAGTTACGGGGTGGTGTACGAGGCCCTGGCCCGGAGGAGCGGAGCACGGGTGGCGGTAAAACGGATTCGATGTGATGCCCCAGAGAATGTGGAACTGGCCCTCTCAGAGTTCTGGGCCCTCACCAGTCTCCGCCGTCGCCACCCCAACGTCGTGCGATTCGAGGAATGCGTCCTACAACGTAACGGCCTGGCCCAGAAGATGTCGCACGGCAACAAGGAGTCGCGACTCTATCTGCGACTGGTTGAGACTTCTCTCAAGGGTGAGCGAATTTTGGGATATTCTGAAGAAGCTTGTTACCTATGGTTCGTAATGGAGTTCTGCGAGGGCGGTGATCTTAATCAGTATGTCCTGTCCAGACGACCAGACCCTGCTATAAACAAGAGCTTTATGCTGCAGCTGACCAGTGCTATAGCATTCCTGCACAAGAACCAGATTGTTCACCGTGATCTGAAACCGGACAATATACTCATTACCGAGCGCTCAGGGGTCCCTGTGCTCAAAGTGGCTGACTTTGGCCTTAGTAAAGTGTGCGCTGGCCTAACACCCCGCGGGAAGGAGACCACCGGTGTTGGCACCAATGAAAACAGGACTGTGAATGTGAATAAATACTGGCTGTCATCAGCGTGTGGCTCAGACTTCTATATGGCTCCAGAGGTGTGGGAGGGTCACTACACTGCCAAGGCTGACATATTTGCCCTGGGCATAATAATCTGGGCCATGATCGAACGAATTACATTTGTGGATGCAGAGACCAAGAGGGAGCTGCTCGGGACCTACATAAAGCAGGGCACTGAGATTGTCCCCGTGGGGGAGGCACTGCTAGAGAACCCAAAGATGGAACTTCACATCCCACAGAAACGTAGGACTTCCATGTCTGAAGGCATCCGGCAACTGCTGAAAGACATGCTGGCTGCGAATCCACAGGATCGACCCGATGCGTTTGAGCTGGAGACTCGAATGGACCAAGTTACATGCGCTGCTTGAAGCTGTGATACAGGTTTGACATGAATTCTGCAGTCTTACACTCCAGTTGTGGATCCCCTGTGGCACCACTTCCTTCAGCCCTCTCAGAGAAATCTCTACAGCTTGGGACTCTCATAAGCAGTCTAATAAACACTTGTAGCATCCTGCATTTTTGTGTACCTGCTGCTGGTGTCCCAGTTTGCCCAGTGTACCAAATGACTTGGTGGGACTGGTGTTGCCTCACCTGGATGTGGGCATCAAATGCCAGTGCATGGACTACGGTGTGGCAATGTCTCAAAACACTGATCTCTCTGAGCTCATCTCGCTACACAAAGGGAGACCTGAGGGCCTGAATGCTGTGGGAATGTCAGTTTTGCTGCTCTTTGTGGGAGGGTGGGGTGTCTCTTTGTGTAGGTGGCTACATCTGTGTATAAATGGTAGCCATAAACTTGTTCTATCAGTTTTTCAGACATTGCTGCCATGGCTATAGCTCTGCAAAAGTTGGTGTCTTAGTACTGCCAGCTGTGTGCCATGTTACATGTCTCAGGGATCTGGCATCTTCTACATCGATTATATTATTTTTTTTCCCCCTCTGCTCTAGACTTTGGGAGAGGGTTGTCACACACTACCCCCCGTGCCTCCTCACTCTGCACCTTAATGGTTTCCTTCCTATGCATGAACAGAAATAGATCCTTGTGTGCCCTTTGTAGCTACCACAGTGCCTACTTCCAGCACATCAACCCTGGCATGCACGACTGTGCGAATGCTGCTTACCCACTTCTTGCGCTCACTACCCTTTAGTAAGTTGTGCCTTATTTCACCTTCCCTCCTTTGGAACTGTGGAACCTTCTTCCAGCCTGAAGCAGGGCTCTGCTTAGTAGTTTGTCCTTCACTGTCATGTGTTGTGTAAGGGTTAATAAGCAATAATGGGAGGGCAGTTATAAATCTGTAGATGAGACATCCTTTACGTGGAAAACTATAATACTAGAAAACTTGTTTTCATTACCCTCTGTCGTTTTGGCAGCTTTGCTTCGTTATTTATGCAAGTGTGAATTTCCAATGAGCATACTGCCTGCTTTCTGCTCCCTTTACTTCTTACTTGGTGCCCCAAGCACACATACAATCACCTGAGCCAGTGCCATGAGCATGCAGTTTGATCTGGTGAGTCTTCATACGGTCAGGATTGCAAGAGCACAATTTGGAAATGTAATGCAAATGCAAAACTGGGGCACCATGATGCGACGTGTGCCTGGGCTCTGTGCCGGAAGCATGCAACTAAACTGCAGTGGCTGGAAGTATGAGGAGTGTGTTGAGTGGGCTGCTCCTTAATTGTGGGTAAGTTGAACGGGTAAAAGGTGGTTTGGGTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGTGTAGTACTGAGTGGTGAGTGGACTGCCTTTTCTCATTAGGGTAGTTGGGTGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACGGTACAGCTGGAGCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGCTGATTGGACGTTATGGACTGTATTTATATTTGCGGAAGCACTGTTCTCTTTTCCTCCCGTGTGATTGGCACAGATGGAAATGAGATTTCTCTTATAAATAAAGTGGTTAAACT
                                                  Xl3.1-CHK-1012686516                                                                                         ATCACCTTCAACTATACAGCGATAGATATCCGAACCTCCAAGGTGCTCCCTTGGCTCCACATGTGACTGCTATCTCCCCCCGGAAGGGTATTTGGTCTCTACCAGTTTTTGGTGTTTACAACATGGGCGCTCTGGAACGTACCAAGTTTGGAGGGGGAAACACATTCAAATTGCCCATATGTCTGGCGCTGTCCGCATATGCTCGTTTTCAGATTCCGCCGAGGCCTTTACTTAGCCTAAAAAATAAATCAAGTCGCCTCCGTTTAGCTCGTTAACTGCTCCAGCCCCCAGCCTCATTTAGTACTGTGCTGTTTCTCCGCCTCCCCCGTCTGGTGGTAGTTTCCAGCTTGTTCTCTTCCCGCCCCCCCCCAGGCCCCAATCGTCAGTTTGTGAGGAGCCGGCTGGGAGCGCGGCTCTGGGCGTTGGGATGAGGGAACCGCCATGGAGCGCAGCCCTGACAGGAAACGTCGGTGTCTCGGACCCCGATACAGTCTCTTGGCAGAGATCGGCCGCGGCAGTTACGGGGTGGTGTACGAGGCCCTGGCCCGGAGGAGCGGAGCACGGGTGGCGGTAAAACGGATTCGATGTGATGCCCCAGAGAATGTGGAACTGGCCCTCTCAGAGTTCTGGGCCCTCACCAGTCTCCGCCGTCGCCACCCCAACGTCGTGCGATTCGAGGAATGCGTCCTACAACGTAACGGCCTGGCCCAGAAGATGTCGCACGGCAACAAGGAGTCGCGACTCTATCTGCGACTGGTTGAGACTTCTCTCAAGGGTGAGCGAATTTTGGGATATTCTGAAGAAGCTTGTTACCTATGGTTCGTAATGGAGTTCTGCGAGGGCGGTGATCTTAATCAGTATGTCCTGTCCAGACGACCAGACCCTGCTATAAACAAGAGCTTTATGCTGCAGCTGACCAGTGCTATAGCATTCCTGCACAAGAACCAGATTGTTCACCGTGATCTGAAACCGGACAATATACTCATTACCGAGCGCTCAGGGGTCCCTGTGCTCAAAGTGGCTGACTTTGGCCTTAGTAAAGTGTGCGCTGGCCTAACACCCCGCGGGAAGGAGACCACCGGTGTTGGCACCAATGAAAACAGGACTGTGAATGTGAATAAATACTGGCTGTCATCAGCGTGTGGCTCAGACTTCTATATGGCTCCAGAGGTGTGGGAGGGTCACTACACTGCCAAGGCTGACATATTTGCCCTGGGCATAATAATCTGGGCCATGATCGAACGAATTACATTTGTGGATGCAGAGACCAAGAGGGAGCTGCTCGGGACCTACATAAAGCAGGGCACTGAGATTGTCCCCGTGGGGGAGGCACTGCTAGAGAACCCAAAGATGGAACTTCACATCCCACAGAAACGTAGGACTTCCATGTCTGAAGGCATCCGGCAACTGCTGAAAGACATGCTGGCTGCGAATCCACAGGATCGACCCGATGCGTTTGAGCTGGAGACTCGAATGGACCAAGTTACATGCGCTGCTTGAAGCTGTGATACAGGTTTGACATGAATTCTGCAGTCTTACACTCCAGTTGTGGATCCCCTGTGGCACCACTTCCTTCAGCCCTCTCAGAGAAATCTCTACAGCTTGGGACTCTCATAAGCAGTCTAATAAACACTTGTAGCATCCTGCATTTTTGTGTACCTGCTGCTGGTGTCCCAGTTTGCCCAGTGTACCAAATGACTTGGTGGGACTGGTGTTGCCTCACCTGGATGTGGGCATCAAATGCCAGTGCATGGACTACGGTGTGGCAATGTCTCAAAACACTGATCTCTCTGAGCTCATCTCGCTACACAAAGGGAGACCTGAGGGCCTGAATGCTGTGGGAATGTCAGTTTTGCTGCTCTTTGTGGGAGGGTGGGGTGTCTCTTTGTGTAGGTGGCTACATCTGTGTATAAATGGTAGCCATAAACTTGTTCTATCAGTTTTTCAGACATTGCTGCCATGGCTATAGCTCTGCAAAAGTTGGTGTCTTAGTACTGCCAGCTGTGTGCCATGTTACATGTCTCAGGGATCTGGCATCTTCTACATCGATTATATTATTTTTTTTCCCCCTCTGCTCTAGACTTTGGGAGAGGGTTGTCACACACTACCCCCCGTGCCTCCTCACTCTGCACCTTAATGGTTTCCTTCCTATGCATGAACAGAAATAGATCCTTGTGTGCCCTTTGTAGCTACCACAGTGCCTACTTCCAGCACATCAACCCTGGCATGCACGACTGTGCGAATGCTGCTTACCCACTTCTTGCGCTCACTACCCTTTAGTAAGTTGTGCCTTATTTCACCTTCCCTCCTTTGGAACTGTGGAACCTTCTTCCAGCCTGAAGCAGGGCTCTGCTTAGTAGTTTGTCCTTCACTGTCATGTGTTGTGTAAGGGTTAATAAGCAATAATGGGAGGGCAGTTATAAATCTGTAGATGAGACATCCTTTACGTGGAAAACTATAATACTAGAAAACTTGTTTTCATTACCCTCTGTCGTTTTGGCAGCTTTGCTTCGTTATTTATGCAAGTGTGAATTTCCAATGAGCATACTGCCTGCTTTCTGCTCCCTTTACTTCTTACTTGGTGCCCCAAGCACACATACAATCACCTGAGCCAGTGCCATGAGCATGCAGTTTGATCTGGTGAGTCTTCATACGGTCAGGATTGCAAGAGCACAATTTGGAAATGTAATGCAAATGCAAAACTGGGGCACCATGATGCGACGTGTGCCTGGGCTCTGTGCCGGAAGCATGCAACTAAACTGCAGTGGCTGGAAGTATGAGGAGTGTGTTGAGTGGGCTGCTCCTTAATTGTGGGTAAGTTGAACGGGTAAAAGGTGGTTTGGGTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGTGTAGTACTGAGTGGTGAGTGGACTGCCTTTTCTCATTAGGGTAGTTGGGTGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACGGTACAGCTGGAGCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGCTGATTGGACGTTATGGACTGTATTTATATTTGCGGAAGCACTGTTCTCTTTTCCTCCCGTGTGATTGGCACAGATGGAAATGAGATTTCTCTTATAAATAAAGTGGT
                                                      consensus depths                                                                                        2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     6     6     8     8     9    10    10    11    10    11    11    11    11    11    10    10    10    10    10    10    10    10    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    13    13    13    12    13    13    13    12    13    12    13    13    14    11    13    11    13    12    13    11    13    11    14    12    14    12    14    12    14    12    14    12    14    11    14    11    14    11    14    11    14    10    14    10    13     9    12     8    11     8    11     7    10     5    10     5     9     5     9     5     8     5     9     6    10     7    11     6    11     6    11     7    10     8    10     7    10     7    10     8     9     7     8     7     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     8     7     8     5     7     5     7     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     6     7     9     6     9     8    10     8    10     9    10     9    10     9    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10     9     9     9     9     8    10     8    10     8    10     9    10     8    10     9    10     9    10     9    11     9    11    10    12    10    13    11    14    11    13    11    14    12    14    12    14    12    15    13    16    13    16    11    16    12    16    12    16    11    14    12    14    12    14    12    14    13    14    14    15    14    15    13    13    14    14    14    14    14    14    15    15    15    15    15    15    15    16    15    16    15    16    14    15    13    15    15    16    16    17    16    17    16    17    16    17    15    16    15    16    16    16    16    16    16    16    16    16    15    16    15    16    16    16    16    16    16    16    16    16    16    16    16    16    15    16    15    16    15    16    15    16    13    16    13    16    13    16    13    15    12    14    10    12     5     9     3     6     2     4     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----A-------
                                               BLH MIN     363     184                                                                                   
                                               BLH OVR     447     156                                                                                   
                                               EST CLI     403       9                                                                                   
                                               ORF LNG     447      16                                                                                   
  5   1   2       bld Em10 5g3  in                    IMAGE:7983071.5p CCAAGGCAGGAGGGTTCAGGATATTAAGAGAAAACGTGGCGGGCGGGCGAGCGAGCGAGCCAGTTTCTCCCCGAGCATATGAACTTGTATCACCTTCAACTATACAGCGATAGATATCCGAACCTCCAAGGTGCTCCCTTGGCTCCACATGTGACTGCTATCTCCCCCCGGAAGGGTATTTGGTCTCTACCAGTTTTTGGTGTTTACAACATGGGCGCTCTGGAACGTACCAAGTTTGGAGGGGGAAACACATTCAAATTGCCCATATGTCTGGCGCTGTCCGCATATGCTCGTTTTCAGATTCCGCCGAGGCCTTTACTTAGCCTAAAAAATAAATCAAGTCGCCTCCGTTTAGCTCGTTAACTGCTCCAGCCCCCAGCCTCATTTAGTACTGTGCTGTTTCTCCGCCTCCCCCGTCTGGTGGTAGTTTCCAGCTTGTTCTCTTCCCGcccccccccAGGCCCCAATCGTCAGTTTGTGAGGAGCCGGCTGGGAGCGCGGCTCTGGGCGTTGGGATGAGGGAACCGCCATGGAGCGCAGCCCTGACAGGAAACGTCGGTGTCTCGGACCCCGATACAGTCTCTTGGCAGAGATCGGCCGCGGCAGTTACGGGGTGGTGTACGAGGCCCTGGCCCGGAGGAGCGGAGCACGGGTGGCGG
  5   1   2       bld Ga12 5g3  in                         XL151b12.5p                                                           GGCCGTTTCTCCCCGANCATATGAACTTGTATCACCTTCAACTATACAGCGATAGATATCCGAACCTCCAAGGTGCTCCCTTGGCTCCACATGTGACTGCTATCTCCCCCCGGAAGGGTATTTGGTCTCTACCAGTTTTTGGTGTTTACAACATGGGCGCTCTGGAACGTACCAAGTTTGGAGGGGGAAACACATTCAAATTGCCCATATGTCTGGCGCTGTCCGCATATGCTCGTTTTAGATTCCGCCGAGGCCTTTACTTAGCCTAAAAAATAAATCAAGTCGCCTCCGTTTAGCTCGTTAACTGCTCCAGCCCCCAGCCTCATTTAGTACTGTGCTGTTTCTCCGCCTCCCCCGTCTGGTGGTAGTTTCCAGCTTGTTCTCTTCCCGccccccccccAGGCCCCAATCGTCAGTTTGTGAGGAGCCGGCTGGGAGCGCGGCTCTGGGCGTTGGGATGAGGGAACCGCCATGGAGCGCAGCCCTGACAGGAAACGTCGGTGTCTCGGACCCCGATA
  5   1   2       bld Ga15 5g3  in                       XL402k17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGCTGGGAGCGCGGCTCTGGGCGTTGGGATGAGGGAACCGCCATGGAGCGCAGCCCTGACAGGAAACGTCGGTGTCTCGGACCCCGATACAGTCTCTTGGCAGAGATCGGCCGCGGCAGTTACGGGGTGGTGTACGAGGCCCTGGCCCGGAGGAGCGGAGCACGGGTGGCGGTAAAACGGATTCGATGTGATGCCCCAGAGAATGTGGAACTGGCCCTCTCAGAGTTCTGGGCCCTCACCAGTCTCCGCCGTCGCCACCCCAACGTCGTGCGATTCGAGGAATGCGTCCTACAACGTAACGGCCTGGCCCAGAAGATGTCGCACGGCAACAAGGAGTCGCGACTCTATCTGCGACTGGTTGAGACTTCTCTCAAGGGTGAGCGAATTTTGGGATATTCTGAAGAAGCTTGTTACCTATGGTTCGTAATGGAGTTCTGCGAGGGCGGTGATCTTAATCAGTATGTCCTGTCCAGACGACCAGACCCTGCTATAAACAAGAGCTTTATGCTGCAGCTGACCAGTGCTATAGCATTCCTGCACAAGAACCAGATTGTTCACCGTGATCTGAAACCGGACAATATACTCATTACCGAGCGCTCANGGGTCCCTGTGCTCAAAGTGGCTGACTTTGGCCTTANTAAAGTGTGCGCTGGCCTAACACCCCGCGGGAA
  5   1   2       bld Te2  5g3  in                    IMAGE:7391550.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGCTGGGAGCGCGGCTCTGGGCGTTGGGATGAGGGAACCGCCATGGAGCGCAGCCCTGACAGGAAACGTCGGTGTCTCGGACCCCGATACAGTCTCTTGGCAGAGATCGGCCGCGGCAGTTACGGGGTGGTGTACGTGGCCCTGGCCCGGAGGAGCGGAGCACGGGTGGCGGTAAAACGGATTCGATGTGATGCCCCAGAGAATGTGGAACTGGCCCTCTCAGAGTTCTGGGCCCTCACCAGTCTCCGCCGTCGCCACCCCAACGTCGTGCGATTCGAGGAATGCGTCCTACAACGTAACGGCCTGGCCCAGAAGATGTCGCACGGCAACAAGGAGTCGCGACTCTATCTGCGACTGGTTGAGACTTCTCTCAAGGGTGAGCGAATTTTGGGATATTCTGAAGAAGCTTGTTACCTATGGTTCGTAATGGAGTTCTGCGAGGGCGGTGATCTTAATCAGTATGTCCTGTCCAGACGACCAGACCCTGCTATAAACAAGAGCTTTATGCTGCAGCTGACCAGTGCTATAGCATTCCTGCACAAGAACCAGATTGTTCACCGTGATCTGAAACCGGAAATATACTCATTACCAGCGCTCAGGGGTCCTGTGCTCAAGTGGCTGATTTGGCCTAGTAAGTGTGCCTGGCCTACACCCGCGGGAGGAGACACNGTGTTNGCACATAAACAGACTGGATGTGATAATATGCTGTATCACTGGGTCAATCATATGTCGAGGTG
  5   1   2       bld DMZ  5g                              xl284p08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGCTGGGAGCGCGGCTCTGGGCGTTGGGATGAGGGAACCGCCATGGAGCGCAGCCCTGACAGGAAACGTCGGTGTCTCGGACCCCGATACAGTCTCTTGGCAGAGATCGGCCGCGGCAGTTACGGGGTGGTGTACGAGGCCCTGGCCCGGAGGAGCGGAGCACGGGTGGCGGTAAAACGGATTCGATGTGATGCCCCAGAGAATGTGGAACTGGCCCTCTCAGAGTTCTGGGCCCTCACCAGTCTCCGCCGTCGCCACCCCAACGTCGTGCGATTCGAGGAATGCGTCCTACAACGTAACGGCCTGGCCCAGAAGATGTCGCACGGCAACAAGGAGTCGCGACTCTATCTGCGACTGGTTGAGACTTCTCTCAAGGGTGAGCGAATTTTGGGATATTCTGAAGAAGCTTGTTACCTATGGTTCGTAATGGAGTTCTGCGAGGGCGGTGATCTTAATCAGTATGTCCTGTCCAGACGACCAGACCCTGCTATAAACAAGAGCTTTATGCTGCAGCTGACCAGTGCTATAGCATTCCTGCACAAGAACCAGATTGTTCACCGTGATCTGAAACCGGACAATATACTCATTACCGAGCGCTCAGGGGTCCCTGTGCTCAAAGTGGCTGACTTTGGCCTTAGTAAAGTGTGCGCTGGCCTAACACCCCGCGGGAAGGAGACCACCGGTGTTGGCACC
  5   1   2       bld Te2  5g3  in                    IMAGE:7391549.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGCTGGGAGCGCGGCTCTGGGCGTTGGGATGAGGGAACCGCCATGGAGCGCAGCCCTGACAGGAAACGTCGGTGTCTCGGACCCCGATACAGTCTCTTGGCAGAGATCGGCCGCGGCAGTTACGGGGTGGTGTACGAGGCCCTGGCCCGGAGGAGCGGAGCACGGGTGGCGGTAAAACGGATTCGATGTGATGCCCCAGAGAATGTGGAACTGGCCCTCTCAGAGTTCTGGGCCCTCACCAGTCTCCGCCGTCGCCACCCCAACGTCGTGCGATTCGAGGAATGCGTCCTACAACGTAACGGCCTGGCCCAGAAGATGTCGCACGGCAACAAGGAGTCGCGACTCTATCTGCGACTGGTTGAGACTTCTCTCAAGGGTGAGCGAATTTTGGGATATTCTGAAGAAGCTTGTTACCTATGGTTCGTAATGGAGTTCTGCGAGGGCGGTGATCTTNATCAGTATGTCCTGTCCAGACGACCCAGACCTGCTATAAACAGAGCTTTATGCTGCAGCTGACCAGTGCTATAGCATTCCTGCACAAGAACCAGATTGTTCACCGTGATCTNGAACGGGANATATACTCATTACCGAGCGCTCAGGGGTCCCTGTGCTCNAAGTGGCTGACTTTGGCTTAGTAAGTGTGCGCTGGCCCTACACCCGCGGAAGGAGACAACGGTGTTGCACCATGAAACAGACTGTGATGTGATAATA
  5   1   2       bld Thy  5g                         IMAGE:8548667.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGCGGCTCTGGGCGTTGGGATGAGGGAACCGCCATGGAGCGCAGCCCTGACAGGAAACGTCGGTGTCTCGGACCCCGATACAGTCTCTTGGCAGAGATCGGCCGCGGCAGTTACGGGGTGGTGTACGAGGCCCTGGCCCGGAGGAGCGGAGCACGGGTGGCGGTAAAACGGATTCGATGTGATGCCCCAGAGAATGTGGAACTGGCCCTCTCAGAGTTCTGGGCCCTCACCAGTCTCCGCCGTCGCCACCCCAACGTCGTGCGATTCGAGGAATGCGTCCTACAACGTAACGGCCTGGCCCAGAAGATGTCGCACGGCAACAAGGAGTCGCGACTCTATCTGCGACTGGTTGAGACTTCTCTCAAGGGTGAGCGAATTTTGGGATATTCTGAAGAAGCTTGTTACCTATGGTTCGTAATGGAGTTCTGCGAGGGCGGTGATCTTAATCAGTATGTCCTGTCCAGACGACCAGACCCTGCTATAAACAAGAGCTTTATGCTGCAGCTGACCAGTGCTATAGCATTCCTGCACAAGAACCAGATTGTTCACCGTGATCTGAAACCGGACAATATACTCATTACCGAGCGCTCAGGGGTCCCTGTGCTCAAAGTGGCTGACTTTGGCCTTAGTAAAGTGTGCGCTGGCCNTACACCCCGCGGGAAGGAGACCACCGGTGTTGGCACCNATGAAACANGACTGTGATGTGAAAANTACTGGCTGTCTCAGCGTGTGCTCAGACTCTATATGCTCAGAGTGTGGAGGTCACTACCTGCAGCTGACTATTGCCTGGCTATATCTGGCTGA
  5   1   2       bld Ooc3 5g3  in                    IMAGE:3436500.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCGGCTCTGGGCGTTGGGATGAGGGAACCGCCATGGAGCGCAGCCCTGACAGGAAACGTTTGTGTCTCGGACCCCGATACAGTCTCTTGGCAGAGATCGGCCGCGGCAGTTACGGGGTGGTGTACGAGGCCCTGGCCCGGAGGAGCGGAGCACGGGTGGCGGTAAAACGGATTCGATGTGATGCCCCAGAGAATGTGGAACTGGCCCTCTCAGAGTTCTGGGCCCTCACCAGTCTCCGCCGTCGCCACCCCAACGTCGTGCGATTCGAGGAATGCGTCCTACAACGTAACGGCCTGGCCCAGAAGATGTCGCACGGCAACAAGGAGTCGCGACTCTATCTGCGACTGGTTGAGACTTCTCTCAAGGGTGAGCGAATTTTGGGATATTCTGAAGAAGCTTGTTACCTATGGTTCGTAATGGAGTTCTGCGAGGGCGGTGATCTTAATCAGTATGTCCTGTC
  5   1   2       bld Ov1                    IMAGE:6316905-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGAAACCCTGCCATCGGAGCCGCAGCCCTAGACAGGAAACGTCGGTGTCTCGGACCCCGATACAGTCTCTTGGCAGAGATCGGCCGCGGCAGTTACGGGGTGGTGTACGAGGCCCTGGCCCGGAGGAGCGGAGCACGGGTGGCGGTAAAACGGATTCGATGTGATGCCCCAGAGAATGTGGAACTGGCCCTCTCAGAGTTCTGGGCCCTCACCAGTCTCCGCCGTCGCCACCCCAACGTCGTGCGATTCGAGGAATGCGTCCTACAACGTAACGGCCTGGCCCAGAAGATGTCGCACGGCAACAAGGAGTCGCGACTCTATCTGCGACTGGTTGAGACTTCTCTCAAGGGTGAGCGAATTTTGGGATATTCTGAAGAAGCTTGTTACCTATGGTTCGTAATGGAGTTCTGCGAGGGCGGTGATCTTAATCAGTATGTCCTGTCCAGACGACCAGACCCTGCTATAAACAAAAGCTTTATGCTGCAGCTGACCAGTGCTATAGCATTCCCGCACAAGAACCAAATTGTTCA
  5   1   2       bld Ov1  5g                         IMAGE:6316905.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATGAGGGAACCGCCATGGAGCGCAGCCCTGACAGGAAACGTCGGTGTCTCGGACCCCGATACAGTCTCTTGGCAGAGATCGGCCGCGGCAGTTACGGGGTGGTGTACGAGGCCCTGGCCCGGAGGAGCGGAGCACGGGTGGCGGTAAAACGGATTCGATGTGATGCCCCAGAGAATGTGGAACTGGCCCTCTCAGAGTTCTGGGCCCTCACCAGTCTCCGCCGTCGCCACCCCAACGTCGTGCGATTCGAGGAATGCGTCCTACAACGTAACGGCCTGGCCCAGAAGATGTCGCACGGCAACAAGGAGTCGCGACTCTATCTGCGACTGGTTGAGACTTCTCTCAAGGGTGAGCGAATTTTGGGATATTCTGAAGAAGCTTGTTACCTATGGTTCGTAATGGAGTTCTGCGAGGGCGGTGATCTTAATCAGTATGTCCTGTCCAGACGACCAGACCCTGCTATAAACAAGAGCTTTATGCTGCAGCTGACCAGTGCTATAGCATTCCTGCACAAGAACCAGATTGTTCACCGTGATCTGAAACCGGACAATATACTCATTACCGAGCGCTCAGGGGTCCCTGTGCTCAAAGTGGCTGACTTTGGCCTTAGTAAAGTGTGCGCTGGCCTAACACCCCGCGGGAAGGAGACCACCGGTGTTGGCACCAATGAAAACAGGACTGTGAATGTGAATAAATACTGGCTGTCATCAGCGTGTGGCTCAGACTTCTATATGGCTCCAGAGGTGTGGGAGGGTCACTACACTGCCCAGGCTGACATATTTGCCCCTGGGCATAATAATCTGGGGCCATGATTCGAACGAAATTACATTTGTTGGATGCAAAA
  5   1   2       bld Te2  5g                         IMAGE:7209898.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAACCGCCATGGAGCGCAGCCCTGACAGGAAACGTCGGTGTCTCGGACCCCGATACAGTCTCTTGGCAGAGATCGGCCGCGGCAGTTACGGGGTGGTGTACGAGGCCCTGGCCCGGAGGAGCGGAGCACGGGTGGCGGTAAAACGGATTCGATGTGATGCCCCAGAGAATGTGGAACTGGCCCTCTCAGAGTTCTGGGCCCTCACCAGTCTCCGCCGTCGCCACCCCAACGTCGTGCGATTCGAGGAATGCGTCCTACAACGTAACGGCCTGGCCCAGAAGATGTCGCACGGCAACAAGGAGTCGCGACTCTATCTGCGACTGGTTGAGACTTCTCTCAAGGGTGAGCGAATTTTGGGATATTCTGAAGAAGCTTGTTACCTATGGTTCGTAATGGAGTTCTGCGAGGGCGGTGATCTTAATCAGTATGTCCTGTCCAGACGACCAGACCCTGCTATAAACAAGAGCTTTATGCTGCAGCTGACCAGTGCTATAGCATTCCTGCACAAGAACCAGATTGTTCACCGTGATCTGAAACCGGACAATATACTCATTACCGAGCGCTCAGGGGTCCCTGTGCTCAAAGTGGCTGACTTTGGCCTTAGTAAAGTGTGCGCTGGCCTAACACCCCGCGGGAAGGAGACCACCGGTGTTGGCACCAATGAAACAGGACTGTGAATGTGAATAATACTGGCTGTCATCAGCGTGTGGTCAGACTCTATTGGCTCCAGAGTGTGGGAGGTCACTACCTGCAGCTGACTATTGCCTGGCATATATCTGGCATGATGACGATACATTGTGATCGAGACAGAGACTCTCGACTCTAGCG
  5   1   2       bld Te2N                            IMAGE:7201853.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TACGAGGCCCTGGCCCGGAGGAGCGGAGCACGGGTGGCGGTAAAACGGATTCGATGTGATGCCCCAGAGAATGTGGAACTGGCCCTCTCAGAGTTCTGGGCCCTCACCAGTCTCCGCCGTCGCCACCCCAACGTCGTGCGATTCGAGGAATGCGTCCTACAACGTAACGGCCTGGCCCAGAAGATGTCGCACGGCAACAAGGAGTCGCGACTCTATCTGCGACTGGTTGAGACTTCTCTCAAGGGTGAGCGAATTTTGGGATATTCTGAAGAAGCTTGTTACCTATGGTTCGTAATGGAGTTCTGCGAGGGCGGTGATCTTAATCAGTATGTCCTGTCCAGACGACCAGACCCTGCTATAAACAAGAGCTTTATGCTGCAGCTGACCAGTGCTATAGCATTCCTGCACAAGAACCAGATTGTTCACCGTGATCTGAAACCGGACAATATACTCATTACCGAGCGCTCAGGGGTCCCTGTGCTCAAAGTGGCTGACTTTGGCCTTAGTAAAGTGTGCGCTGGCCTAACACCCCGCGGGAAGGAGACCACCGGTGTTGGCACCAATGAAAACAGGACTGTGAATGTGAATAAATACTGGCTGTCATCAGCGTGTGGCTCAGACTTCTATATGGCTCCAGAGGTGTGGGAGGGTCACTACACTGCCAAGGCTGACATATTTGCCCTGTGCATAATAATCTGGGCCATGATCGATCGAATTACATTTGTGGATGCAGAGACCAAGACGGAGCTGCTCGGGGACTACATAAAGCAAGGCACTG
  5   1   2       bld Ooc2      in                    IMAGE:3747121.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGTGCGATTCGAGGAATGCGTCCTACAACGTAACGGCCTGGCCCAGAAGATGTCGCACGGCAACAAGGAGTCGCGACTCTATCTGCGACTGGTTGAGACTTCTCTCAAGGGTGAGCGAATTTTGGGATATTCTGAAGAAGCTTGTTACCTATGGTTCGTAATGGAGTTCTGCGAGGGCGGTGATCTTAATCAGAATGTCCTGTCCAGACGACCAGACCCTGCTATAAACAAGAGCTTTATGCTGCAGCTGACCAGTGCTATAGCATTCCTGCACAAGAACCAGATTGTTCACCGTGATCTGAAACCGGACAATATACTCATTACCGAGCGCTCAGGGGTCCCTGTGCTCAAAGTGGCTGACTTTGGCCTTAGTAAAGTGTGCGCTGGCCTAACAC
  5   1   2       bld Te2N                            IMAGE:7205637.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGCAACAAGGAGTCGCGACTCTATCTGCGACTGGTTGAGACTTCTCTCAAGGGTGAGCGAATTTTGGGATATTCTGAAGAAGCTTGTTACCTATGGTTCGTAATGGAGTTCTGCGAGGGCGGTGATCTTAATCAGTATGTCCTGTCCAGACGACCAGACCCTGCTATAAACAAGAGCTTTATGCTGCAGCTGACCAGTGCTATAGCATTCCTGCACAAGAACCAGATTGTTCACCGTGATCTGAAACCGGACAATATACTCATTACCGAGCGCTCAGGGGTCCCTGTGCTCAAAGTGGCTGACTTTGGCCTTAGTAAAGTGTGCGCTGGCCTAACACCCCGCGGGAAGGAGACCACCGGTGTTGGCACCAATGAAAACAGGACTGTGAATGTGAATAAATACTGGCTGTCATCAGCGTGTGGCTCAGACTTCTATATGGCTCCAGAGGTGTGGGAGGGTCACTACACTGCCAAGGCTGACATATTTGCCCTGGGCATAATAATCTGGGCCATGATCGAACGAATTACATTTGTGGATGCAGAGACCAAGAGGGAGCTGCTCGGGACCTACATAAAGCAGGGCACTGAGATTGTCCCCGTGGGGGAGGCACTGCTAGAGAACCCAAAGATGGAACTTCACATCCCACAGAAACGTAGGACTTCCATGTCTGAAGGCATCCGGCAACTGCTGAAAGACATGCTGGCTGCGAATCCACAGGATCGACCCGATGCGTTTGAGCTGGAGACTCGAATGGACCCAGTTACATGCGCCTGCTGAAGCTGTGATACAGGTTTGACATGAATTCTGCAGTCTTTCACTTCAAGTTTGTGGATCCCCTGTTGGCACCCCTTCCCTTCCACCCCTCTTCaaaaaaaaaTTCTTTACCC
  5   1   2       bld Ga18      in                      xlk164m18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGGGTGAGCGAANTTTTGGGNATATTCTGAAGNAGCTTGNTACCTATGGTTCGNAATNNAGNTCTGCGAGGNCGGNGATCTTAATCAGTATGTNCTGTNCAGACGACCAGANCCTGCTATNAACAAGAGCTTTATGCTGCAGNTGANCAGTGCTATAGCATTCCTGCACAAGAACCAGATTGTTCACCGTGATCTGAAACCGGACAATATACTCATTACCGAGCGCTCAGGGGTCCCTGTGCTCAAAGTGGCTGANNNNNNNTTAGNAAAGTG
  3   1   2       bld Te2  5g3  in                    IMAGE:7391550.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGCGAGGGCGTGATATTATCAGTATTCCTGCCAGACGACCAGACTTGCTATAAACAAGAGCTTTTGCTGCAGCTGTCCAGTGCTATAGCATTCCTGCACAAGAACCAGATTGTTCACCGTGATCTGAAACCGGACAATATACTCATTACCGAGCGCTCAGGGGTCCCTGTGCTCAAAGTGGCTGACTTTGGCCTTAGTAAAGTGTGCGCTGGCCTAACACCCCGCGGGAAGGAGACCACCGGTGTTGGCACCAATGAAAACAGGACTGTGAATGTGAATAAATACTGGCTGTCATCAGCGTGTGGCTCAGACTTCTATATGGCTCCAGAGGTGTGGGAGGGTCACTACACTGCCAAGGCTGACATATTTGCCCTGGGCATAATAATCTGGGCCATGATCGAACGAATTACATTTGTGGATGCAGAGACCAAGAGGGAGCTGCTCGGGACCTACATAAAGCAGGGCACTGAGATTGTCCCCGTGGGGGAGGCACTGCTAGAGAACCCAAAGATGGAACTTCACATCCCACAGAAACGTAGGACTTCCATGTCTGAAGGCATCCGGCAACTGCTGAAAGACATGCTGGCTGCGAATCCACAGGATCGACCCGATGCGTTTGAGCTGGAGACTCGAATGGACCAAGTTACATGCGCTGCTTGAAGCTGTGATACAGGTTTGACATGAATTCTGCAGTCTTACACTCCAGTTGTGGATCCCCTGTGGCACCACTTCCTTCAGCCCTCTCAGAGAAATCTCTACAGCTTGGACTCTCAAAGCATCTATACCCTCCCCTAAAAA
  3   1   2       bld Te2  5g3  in                    IMAGE:7391549.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTATTGTGTTTTATCCTTTTTTCCTGATAATAAATTTAATTATAACTCTGTAAGGGTGAATAGCTCAATTCGACATCATCACATGGGTTCCTAACCGCCTATAAGATTTCTTTATATTTGACGGATGTACTGCTACCATTCTCAGTTATAATTGCCGAAATCAGGCGGAAGGAATCTCAGCGGAAAGTCGCTAAATATCATATCACTCATGAGAAATGTGCTTCTTCTCTCTTTCGAGAAAACACAATTTTGATATATCTGAAGAGTTGCGGGAGGGTCTTCACTCATCCAAGGCTCTCATATTTGCCCTGGGCATAATCTTTTGGGCCACAATTGTAGGGATCACTTTTGTGGATGCAGAGACCAAGTGTGTGCTCCTCGGGACCTACATAAAGCAGGGCAATGAGATTGTCCCCGTGGGGGAGGCACTGCTTGAGAACCCAAAGATGGAACTTCACATCCCACAGAAACGTAGGACTTCCATGTCTGAAGGCATCCGGCAACTGCTGAAAGACATGCTGGCTGCGAATCCACAGGATCGACCCGATGCGTTTGAGCTGGAGACTCGAATGGACCAAGTTACATGCGCTGCTTGAAGCTGTGATACAGGTTTGACATGAATTCTGCAGTCTTACACTCCAGTTGTGGATCCCCTGTGGCACCACTTCCTTCAGCCCTCTCAGAGAAATCTCTACAGCTTGGACTCTCAAAGCATCTAAACACTCCC
  5   1   2       bld Lu1       in                    IMAGE:4633282.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACGCGTGGGCCGTGATCTGAAACCGGACAATATACTCATTACCGAGCGCTCAGGGGTCCCTGTGCTCAAAGTGGCTGACTTTGGCCTTAGTAAAGTGTGCGCTGGCCTAACACCCCGCGGGAAGGAGACCACCGGTGTTGGCACCAATGAAAACAGGACTGTGAATGTGAATAAATACTGGCTGTCATCAGCGTGTGGCTCAGACTTCTATATGGCTCCAGAGGTGTGGGAGGGTCACTACACTGCCAAGGCTGACATATTTGCCCTGGGCATAATAATCTGGGCCATGATCGAACGAATTACATTTGTGGATGCAGAGACCAAGAGGGAGCTGCTCGGGACCTACATAAAGCAGGGCACTGAGATTGTCCCCGTGGGGGAGGCACTGCTAGAGAACCCAAAGATGGAACTTCACATCCCACAGAAACGTAGGACTTCCATGTCTGAAGGCATCCGGCAACTGCTGAAAGACATGCTGGCTGCGAATCCACAGGATCGACCCGATGCGTT
  3   1   2       bld Em10 5g3  in                    IMAGE:7983071.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCAGNGGTGCTCAGACTCTATAGGCTCAGAGGTGTGGGAGAGCACTACACTGCCAGGCTGACATATTGCCCTGGGCATAATAATCTGGGCCATGATCGAACGAATTACATTTGTGGATGCAGAGACCAAGAGGGAGCTGCTCGGGACCTACATAAAGCAGGGCACTGAGATTGTCCCCGTGGGGGAGGCACTGCTAGAGAACCCAAAGATGGAACTTCACATCCCACAGAAACGTAGGACTTCCATGTCTGAAGGCATCCGGCAACTGCTGAAAGACATGCTGGCTGCGAATCCACAGGATCGACCCGATGCGTTTGAGCTGGAGACTCGAATGGACCAAGTTACATGCGCTGCTTGAAGCTGTGATACAGGTTTGACATGAATTCTGCAGTCTTACACTCCAGTTGTGGATCCCCTGTGGCACCACTTCCTTCAGCCCTCTCAGAGAAATCTCTACAGCTTGGGACTCTCATAAGCAGTCTAATAAACACTTGTAGCATCCTGCATTTTTGTGTACCTGCTGCTGGTGTCCCAGTTTGCCCAGTGTACCAAATGACTTGGTGGGACTGGTGTTGCCTCACCTGGATGTGGGCATCAAATGCCAGTGCATGGACTACGGTGTGGCAATGTCTCAAAACACTGATCTCTCTGAGCTCATCTCGCTACACAAAGGGAGACCTGAGGGCCTGAATGCTGTGGGAATGTCAGTTTTGCTGCTCTTTGTGGGAGGGTGGGGTGTCTCTTTGTGTAGGTGGCTACATCTGTGTATAAATGTAGCCATAACT
  5   1   2       bld Tbd7      in                         XL087l18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTTCTATATGGCTCCAGNAGTGTGGGAGGGTCACTACACTGCCAAGGCTGACATATTTGCCCTGGGCATAATAATCTGGGCCATGATCGAACGAATTACATTTGTGGATGCAGAGACCAAGAGGGAGCTGCTCGGGACCTACATAAAGCAGGGCACTGAGATTGTCCCCGTGGGGGAGGCACTGCTAGAGAACCCAAAGATGGAACTTCACATCCCACAGAAACGTAGGACTTCCATGTCTGAAGGCATCCGGCAACTGCTGAAAGACATGCTGGCTGCGAATCCACAGGATCGACCCGATGCGTTTGAGCTGGAGACTCGAATGGACCAAGTTACATGCGCTGCTTGAAGCTGTGATACAGGTTTGACATGAATTCTGCAGTCTTACACTCCAGTTGTGGATCCCCTGTGGCACCACTTCCTTCAGCCCTCTCAGAGAAATCTCTACAGCTTGGGACTCTCATAAGCAGTCTAATAAACACTTGTAGCATCCTGCATTTTTGTGTACCTGCTGCTGGTGTCCCAGTTTGCCCAGTGTACCAAATGACTTGGTGGGACTGGTGTTGCCTCACCTGGATGTGGGCATCAAATGCCAGTGCATGGACTACGGTGTGGCAATGTCTCAAAACACTGATCTCTCTGAGCTCATCTCGCTACACAAA
  5   1   2       bld FaBN                            IMAGE:8077869.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAACGTCGGTGTCTCGGACCCCGATACAGTCTCTTGACATATTTGCCCTGGGCATAATAATCTGGGCCATGATCGAACGAATTACATTTGTGGATGCAGAGACCAAGAGGGAGCTGCTCGGGACCTACATAAAGCAGGGCACTGAGATTGTCCCCGTGGGGGAGGCACTGCTAGAGAACCCAAAGATGGAACTTCACATCCCACAGAAACGTAGGACTTCCATGTCTGAAGGCATCCGGCAACTGCTGAAAGACATGCTGGCTGCGAATCCACAGGATCGACCCGATGCGTTTGAGCTGGAGACTCGAATGGACCAAGTTACATGCGCTGCTTGAAGCTGTGATACAGGTTTGACATGAATTCTGCAGTCTTACACTCCAGTTGTGGATCCCCTGTGGCACCACTTCCTTCAGCCCTCTCAGAGAAATCTCTACAGCTTGGGACTCTCATAAGCAGTCTAATAAACACTTGTAGCATCCTGCATTTTTGTGTACCTGCTGCTGGTGTCCCAGTTTGCCCAGTGTACCAAATGACTTGGTGGGACTGGTGTTGCCTCACCTGGATGTGGGCATCAAATGCCAGTGCATGGACTACGGTGTGGCAATGTCTCAAAACACTGATCTCTCTGAGCTCATCTCGCTACACAAGGGAGACCTGAGGGCCTGAATGCTGTGGGAATGTCAGTTTTGCTGCTCTTGTGGGAGGGTGGGTGTCTCTTGTGTAGGTGCTACATCTGTGTATAATGTAGCATAACTTGTCTATCAGTTTTCAACATGCTGCAG
  5   1   2       bld Ov1                             IMAGE:8332758.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTTGAAGCTGTGATACAGGTTTGACATGAATTCTGCAGTCTTACACTCCAGTTGTGGATCCCCTGTGGCACCACTTCCTTCAGCCCTCTCAGAGAAATCTCTACAGCTTGGGACTCTCATAAGCAGTCTAATAAACACTTGTAGCATCCTGCATTTTTGTGTACCTGCTGCTGGTGTCCCAGTTTGCCCAGTGTACCAAATGACTTGGTGGGACTGGTGTTGCCTCACCTGGATGTGGGCATCAAATGCCAGTGCATGGACTACGGTGTGGCAATGTCTCAAAACACTGATCTCTCTGAGCTCATCTCGCTACACAAAGGGAGACCTGAGGGCCTGAATGCTGTGGGAATGTCAGTTTTGCTGCTCTTTGTGGGAGGGTGGGGTGTCTCTTTGTGTAGGTGGCTACATCTGTGTATAAATGGTAGCCATAAACTTGTTCTATCAGTTTTTCAGACATTGCTGCCATGGCTATAGCTCTGCAAAAGTTGGTGTCTTAGTACTGCCAGCTGTGTGCCATGTTACATGTCTCAGGGATCTGGCATCTTCTACATCGATTATATTAttttttttCCCCCTCTGCTCTAGACTTTGGGAGAGGGTTGTCACACACTACCCCCCGTGCCTCCTCACTCTGCACCTTAATGGTTTCCTTCCTATGCATGAACAGAAATAGATCCTTGTGTGCCCTTTGTAGCTACCAA
  5   1   2       bld Neu7                                 XL028m21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTCTCAGNANAAATCTCTACAGCTTGGGACTCTCATAAGCAGTCTAATAAACACTTGTAGCATCCTGCATTTTTGTGTACCTGCTGCTGGTGTCCCAGTTTGCCCAGTGTACCAAATGACTTGGTGGGACTGGTGTTGCCTCACCTGGATGTGGGCATCAAATGCCAGTGCATGGACTACGGTGTGGCAATGTCTCAAAACACTGATCTCTCTGAGCTCATCTCGCTACACAAAGGGAGACCTGAGGGCCTGAATGCTGTGGGAATGTCAGTTTTGCTGCTCTTTGTGGGAGGGTGGGGTGTCTCTTTGTGTAGGTGGCTACATCTGTGTATAAATGGTAGCCATAAACTTGTTCTATCAAGTTTTCAGACATTGCTGCCATGGCTATAGCTCTGCAAAAGTTGGTGTCTTAGTACTGCCAGCTGTGTGCCATGTTACATGTCTCANGGATCTGGCATCTTCTACATCGATTATATTATTTTTTTCCCCCCTCTGCTC
  3   1   2       bld Ga12 5g3  in                         XL151b12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGGTGGGGTGTCTCTTTGTGTAGGTGGCTACATCTGTGTATAAATGGTAGCCATAAACTTGTTCTATCAGTTTTTCAGACATTGCTGCCATGGCTATAGCTCTGCAAAAGTTGGTGTCTTAGTACTGCCAGCTGTGTGCCATGTTACATGTCTCAGGGATCTGGCATCTTCTACATCGATTATATTATTTTTTTTCCCCCTCTGCTCTAGACTTTGGGAGAGGGTTGTCACACACTACCCCCCGTGCCTCCTCACTCTGCACCTTAATGGTTTCCTTCCTATGCATGAACAGAAATAGATCCTTGTGTGCCCTTTGTAGCTACCACAGTGCCTACTTCCAGCACATCAACCCTGGCATGCACGACTGTGCGAATGCTGCTTACCCACTTCTTGCGCTCACTACCCTTTAGTAAGTTGTGCCTTATTTCACCTTCCCTCCTTTGGAACTGTGGAACCTTCTTCCAGCCTGAAGCAGGGCTCTGCTTAGTAGTTTGTCCTTCACTGTCATGTGTTGTGTAAGGGTTAATAAGCAATAATGGGAGGGCAGTTATAAATCTGTAGATGAGACATCCTTTACGNGAAAACTATAATACTAGAAAAC
  5   1   2       bld Thy       in                    IMAGE:8546563.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTGTGTAGGTGGCTACATCTGTGTATAAATGGTAGCCATAAACTTGTTCTATCAGTTTTTCAGACATTGCTGCCATGGCTATAGCTCTGCAAAAGTTAAACTTAGTACTGCCAGCTGTGTGCCATGTTACATGTCTCAGGGATCTGGCATCTTCTACATCGATTATATTAttttttttCCCCCTCTGCTCTAGACTTTGGGAGAGGGTTGTCGCACACTACCCCCCGTGCCTCCTCACTCTGCACCTTAATGGTTTCCTTCCTATGCATGAACAGAAATAGATCCTTGTGTGCCCTTTGTAGCTACCACAGTGCCTACTTCCAGCACATCAACCCTGGCATGCACGACTGTGCGAATGCTGCTTACCCACTTCTTGCGCTCACTACCCTTTAGTAAGTTGTGCCTTATTTCACCTTCCCTCCTTTGGAACTGTGGAACCTTCTTCCAGCCTGAAGCAGGGCTCTGCTTAGTAGTTTGTCCTTCACTGTCATGTGTTGTGTAAGGGTTAATAAGCAATAATGGGAGGGCAGTTATAAATCTGTAGATGAGACATCCTTTACGTGGAAAACTATAATACTAGAAAACTTGTTTTCATTACCCTCTGTCGTTTTGGCAGCTTTGCTTCGTTATTTATGCAAGTGTGAATTTCCAATGAGCATACTGCCTGCTTTCTGCTCCCTTTACTTCTTACTTGGTGCCCCAAGCACACATACAATCACCTGAGCCAGTGCCATGAGCATGCAGTTTGATCTGGTGAGTCTCATACGGTCAGGATTGCAAGAGCACATTTGGAAATGTATGCAATGCAAACTGGGGCACATGATGCGACGTGTGCCTGGCTCTGTGCGAGCATGCAACTAACTGCAGTGGCCTGAAGTATGAGGAAGTGTGTTTGGAGTTGGCTGCCTCCTAAACG
  5   1   2       bld Ga15      in                       XL443d11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTACATCTGTGTATAAATGGTAGCCATAAACTTGTTCTATCAGTTTTTCAGACATTGCTGCCATGGCTATAGCTCTGCAAAAGTTGGTGTCTTAGTACTGCCAGCTGTGTGCCATGTTACATGTCTCAGGGATCTGGCATCTTCTACATCGATTATATTAttttttttCCCCCTCTGCTCTAGACTTTGGGAGAGGGTTGTCACACACTACCCCCCGTGCCTCCTCACTCTGCACCTTAATGGTTTCCTTCCTATGCATGAACAGAAATAGATCCTTGTGTGCCCTTTGTAGCTACCACAGTGCCTACTTCCAGCACATCAACCCTGGCATGCACGACTGTGCGAATGCTGCTTACCCACTTCTTGCGCTCACTACCCTTTAGTAAGTTGTGCCTTATTTCACCTTCCCTCCTTTGGAACTGTGGAACCTTCTTCCAGCCTGAAGCAGGGCTCTGCTTAGTAGTTTGTCCTTCACTGTCATGTGTTGTGTAAGGGTTAATAAGCAATAATGGGAGGGCAGTTATAAATCTGTAGATGAGACATCCTTTACGTGGAAAACTATAATACTAGAAAACTTGTTTTCATTACCCTCTGTCGTTTTGGCAGCTTTGCTTCGTTATTTATGCAAGTGTGAATTTCCAATGAGCATACTGCCTGCTTTCTGCTCCCTTTACTTCTTACTTGGTGCCCCAAGCACACATACAATCACCTGAGCCAGTGCCATGAGCATGCAGTTTGATCTGGTGAGTCTT
  5   1   2       bld Emb4                            IMAGE:4959171.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTACATCTGTGTATAAATGGTAGCCATAAACTTGTTCTATCAGTTTTTCAGACATTGCTGCCATGGCTATAGCTCTGCAAAAGTTGGTGTCTTAGTACTGCCAGCTGTGTGCCATGTTACATGTCTCAGGGATCTGGCATCTTCTACATCGATTATATTAttttttttCCCCCTCTGCTCTAGACTTTGGGAGAGGGTTGTCACACACTACCCCCCGTGCCTCCTCACTCTGCACCTTAATGGTTTCCTTCCTATGCATGAACAGAAATAGATCCTTGTGTGCCCTTTGTAGCTACCACAGTGCCTACTTCCAGCACATCAACCCTGGCATGCACGACTGTGCGAATGCTGCTTACCCACTTCTTGCGCTCACTACCCTTTAGTAAGTTGTGCCTTATTTCACCTTCCCTCCTTTGGAACTGTGGAACCTTCTTCCAGCCTGAAGCAGGGCTCTGCTTAGTAGTTTGTCCTTCACTGTCATGTGTTGTGTAAGGGTTAATAAGCAATAATGGGAGGGCAGTTATAAATCTGTAGAT
  5   1   2       bld Emb1                            IMAGE:6635878.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCTGTGTATAAATGGTAGCCATAAACTTGTTCTATCAGTTTTTCAGACATTGCTGCCATGGCTATAGCTCTGCAAAAGTTGGTGTCTTAGTACTGCCAGCTGTGTGCCATGTTACATTTCTCAGGGATCTGGCATCTTCTACATCGATTATATTAttttttttCCCCCTCTGCTCTAGACTTTGGGAGAGGGTTGTCACACACTACCCCCCGTGCCTCCTCACTCTGCACCTTAATGGTTTCCTTCCTATGCATGAACAGAAATAGATCCTTGTGTGCCCTTTGTAGCTACCACAGTGCCTACTTCCAGCACATCAACCCTGGCATGCACGACTGTGCGAATGCTGCTTACCCACTTCTTGCGCTCACTACCCTTTAGTAAGTTGTGCCTTATTTCACCTTCCCTCCTTTGGAACTGTGGAACCTTCTTCCAGCCTGAAGCAGGGCTCTGCTTAGTAGTTTGTCCTTCACTGTCATGTGTTGTGTAAGGGTTAATAAGCAATAATGGGAGGGCAGTTATAAATCTGTAGATGAGACATCCTTTACGTGGAAAACTATAATACTAGAAAACTTGTTTTCATTACCCTCTGTCGTTTTGGCAGCTTTGCTTCGTTATTTATGCAAGTGTGAATTTCCAATGAGCATACTGCCTGCTTTCTGCTCCCTTTACTTCTTACTTGGTGCCCCCAGCACACATACAATCACCTGAGCCAGTGCCATGAGCATGCAGTTTGATCTGGTGAGTCTTCATACGGTCAGGATTGCAAGAGCACAATTTGGAAATGTAATGCCAATGCAAAACTGGGGCACCATGAATGCGACC
  5   1   2       bld Ga15      in                       XL444a08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATAAACTTGTTCTATCAGTTTTTCAGACATTGCTGCCATGGCTATAGCTCTGCAAAAGTTGGTGTCTTAGTACTGCCAGCTGTGTGCCATGTTACATGTCTCAGGGATCTGGCATCTTCTACATCGATTATATTAttttttttCCCCCTCTGCTCTAGACTTTGGGAGAGGGTTGTCACACACTACCCCCCGTGCCTCCTCACTCTGCACCTTAATGGTTTCCTTCCTATGCATGAACAGAAATAGATCCTTGTGTGCCCTTTGTAGCTACCACAGTGCCTACTTCCAGCACATCAACCCTGGCATGCACGACTGTGCGAATGCTGCTTACCCACTTCTTGCGCTCACTACCCTTTAGTAAGTTGTGCCTTATTTCACCTTCCCTCCTTTGGAACTGTGGAACCTTCTTCCAGCCTGAAGCAGGGCTCTGCTTAGTAGTTTGTCCTTCACTGTCATGTGTTGTGTAAGGGTTAATAAGCAATAATGGGAGGGCAGTTATAAATCTGTAGATGAGACATCCTTTACGTGGAAAACTATAATACTAGAAAACTTGTTTTCATTACCCTCTGTCGTTTTGGCAGCTTTGCTTCGTTATTTATGCAAGTGTGAATTTCCAATGAGCATACTGCCTGCTTTCTGCTCCCTTTACTTCTTACTTGGTGCCCCAAGCACACATACAATCACCTGAGCCAGTGCCATGAGCATGCAGTTTGATCTGGTGAGTCTTCATACGGTCAGGATTGCAAGAGCACAATTTGGAAATGTAATGCNAAATGCAAAAACTGGGGCACCATGATGCGACGTGTG
  5   1   2       bld Ga12      in                         XL182o22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAACTTGTTCTATCAGTTTTTCAGACATTGCTGCCATGGCTATAGCTCTGCAAAAGTTGGTGTCTTAGTACTGCCAGCTGTGTGCCATGTTACATGTCTCAGGGATCTGGCATCTTCTACATCGATTATATTAttttttttCCCCCTCTGCTCTAGACTTTGGGAGAGGGTTGTCACACACTACCCCCCGTGCCTCCTCACTCTGCACCTTAATGGTTTCCTTCCTATGCATGAACAGAAATAGATCCTTGTGTGCCCTTTGTAGCTACCACAGTGCCTACTTCCAGCACATCAACCCTGGCATGCACGACTGTGCGAATGCTGCTTACCCACTTCTTGCGCTCACTACCCTTTAGTAAGTTGTGCCTTATTTCACCTTCCCTCCTTTGGAACTGTGGAACCTTCTTCCAGCCTGAAGCAGGGCTCTGCTTAGTAGTTTGTCCTTCACTGTCATGTGTTGTGTAAGGGTTAATAAGCAATAATGGGAGGGCAGTTATAAATCTGTAGATGAGACATCCTTTACGTGGAAAACTATAATACTAGAAAACTTGTTTTCATTACCCTCTGTCGTTTTGGCAGCTTTGCTTCGTTATTTATGCAAGTGTGAATTTCCAATGAGCATACTGCCTGCTTTCTGCTCCCTTTACTTCTTACTTG
  5   1   2       bld Ga12                                 XL218e24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCACGAGGAGACATTGCTGCCATGGCTATAGCTCTGCAAAAGTTGGTGTCTTAGTACTGCCAGCTGTGTGCCATGTTACATGTCTCAGGGATCTGGCATCTTCTACATCGATTATATTAttttttttCCCCCTCTGCTCTAGACTTTGGGAGAGGGTTGTCACACACTACCCCCCGTGCCTCCTCACTCTGCACCTTAATGGTTTCCTTCCTATGCATGAACAGAAATAGATCCTTGTGTGCCCTTTGTAGCTACCACAGTGCCTACTTCCAGCACATCAACCCTGGCATGCACGACTGTGCGAATGCTGCTTACCCACTTCTTGCGCTCACTACCCTTTAGTAAGTTGTGCCTTATTTCACCTTCCCTCCTTTGGAACTGTGGAACCTTCTTCCAGCCTGAAGCAGGGCTCTGCTTAGTAGTTTGTCCTTCACTGTCATGTGTTGTGTAAGGGTTAATAAGCAATAATGGGAGGGCAGTTATAAATCTGTAGATGAGACATCCTTTACGTGGAAAACTATAATACTAGAAAACTTGTTTTCATTACCCTCTGTCGTTTTGGCAGCTTTGCTTCGTTATTTATGCAAGTGTGAATTTCCAATGAGCATACTGCCTGCTTTCTGCTCCCTTTACTTCTTACTTGGTGCCCCAAGCACACATACAAT
  5   1   2       bld Tbd7      in                         XL055c19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCTTAGTACTGCCGCTGTGTGCCATGTTACATGTCTCAGGGATCTGGCATCTTCTACATCGATTATATTAttttttttCCCCCTCTGCTCTAGACTTTGGGAGAGGGTTGTCACACACTACCCCCCGTGCCTCCTCACTCTGCACCTTAATGGTTTCCTTCCTATGCATGAACAGAAATAGATCCTTGTGTGCCCTTTGTAGCTACCACAGTGCCTACTTCCAGCACATCAACCCTGGCATGCACGACTGTGCGAATGCTGCTTACCCACTTCTTGCGCTCACTACCCTTTAGTAAGTTGTGCCTTATTTCACCTTCCCTCCTTTGGAACTGTGGAACCTTCTTCCAGCCTGAAGCAGGGCTCTGCTTAGTAGTTTGTCCTTCACTGTCATGTGTTG
  5   1   2       bld Ooc1                             Ooc1-db30g03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGTCGACCCACGCGTCCGCCTCACTCTGCACCTTAATGGTTTCCTTCCTATGCATGAACAGAAATAGATCCTTGTGTGCCCTTTGTAGCTACCACAGTGCCTACTTCCAGCACATCAACCCTGGCATGCACGACTGTGCGAATGCTGCTTACCCACTTCTTGCGCTCACTACCCTTTAGTAAGTTGTGCCTTATTTCACCTTCCCTCCTTTGGAACTGTGGAACCTTCTTCCAGCCTGAAGCAGGGCTCTGCTTAGTAGTTTGTCCTTCACTGTCATGTGTTGTGTAAGGGTTAATAAGCAATAATGGGAGGGCAGTTATAAATCTGTAGATGAGACATCCTTTACGTGGAAAACTATAATACTAGAAAACTTGTTTTCATTACCCTCTGTCGTTTTGGCAGCTTTGCTTCGTTATTTATGCAAGTGTGAATTTCCAATGAGCATACTGCCTGCTTTCTGCTCCCTTTACTTCTTACT
  5   1   2       bld Tbd7      in                         XL077h23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTCCGCACATCAACCCTGGCATGCACGACTGTGCGAATGATGCTTACCCACTTCTTGCGCTCACTACCCTTTAGTAAGTTGTGCCTTATTTCACCTTCCCTCCTTTGGAACTGTGGAACCTTCTTCCAGCCTGAAGCAGGGCTCTGCTTAGTAGTTTGTCCTTCACTGTCATGTGTTGTGTAAGGGTTAATAAGCAATAATGGGAGGGCAGTTATAAATCTGTAGATGAGACATCCTTTACGTGGAAAACTATAATACTAGAAAACTTGTTTTCATTACCCTCTGTCGTTTTGGCAGCTTTGCTTCGTTATTTATGCAAGTGTGAATTTCCAATGAGCATACTGCCTGCTTTCTGCTCCCTTTACTTCTTACTTGGTGCCCCAAGCACACATACAATCACCTGAGCCAGTGCCATGAGCATGCAGTTTGATCTGGTGAGTCTTCATACGGTCAGGATTGCAAGAGCACAATTTGGAAATGTAATGCAAATGCAAAACTGGGGCACCATGATGCGACGTGTGCCTGGGCTCTGTGCCGGAAGCATGCAACTAAACTGCAGTGGCTGGAAGTATGAGGAGTGTGTTGAGTGGGCTGCTCCTTAATTGTG
  3   1   2       bld Ga18      in                      xlk164m18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTNCGTGGNAAACNNNNNNCTAGNAANCTNNTTTTCNTTNCCNTCTGTCGTTTTGGCANNTTTGCTTCGTNATTTATGCAAGTGTGAATTTCCAATGANNATACTGCCTNCTTTCTNCTCCNTTTNCTTCTTACTTGNNNNCCCAAGCACACATACAATCACCTGANNCAGTGCCATGAGCATGCAGTTTGATCTGGTGAGTCTTCATACGGTCAGGATTGCAAGAGCACAATTTGGAAATGTAATGNAAATGCAAAACTGGGGCACCATGATGCGACGTGTGCCTGGGCTCTGTGCCGGAAGCATGCAACTAAACTGCAGTGGCTGGAAGTATGAGGAGTGTGTTGAGTGGGCTGCTCCTTAATTGTGGGTAAGTTGAACGGGTAAAAGGTGGTTTGGGTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGTGTAGTACTGAGTGGTGAGTGGACTGCCTTTTCTCATTAGGGTAGTTGGGTGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACGGTACAGCTGGAGCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGCTGATTGGACGTTATGGACTGTATTTATATTTGCGGAAGCACTGTTCTCTTTTCCTCCCGTGTGATTGGCACAGATGGAAATGAGNT
  3   1   2       bld Thy       in                    IMAGE:8546563.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTATCGTGAGGCATCTTACGGGAACTTATCTAGAACTGTTCATACCTCGTCGTTGCAGCTTGCTCGTATTATGCAGTGGAATTCCATGAGCATACTGCTGCTTCTGCTCCCTTACTCTACTGGNTGCCCAAGCACACATACATCACCTGAGCCAGTGCCATGAGCATGCAGTTGNATCTGGTGAGTCTTCATACGGTCAGGATGNCAAGAGCACAATTTGGAAATGTAATGCAAATGCAAAACTGGGGCACCATGATGCGACGTGTGCCTGGGCTCTGTGCCGGAAGCATGCAACTAAACTGCAGTGGCTGGAAGTATGAGGAGTGTGTTGAGTGGGCTGCTCCTTAATTGTGGGTAAGTTGAACGGGTAAAAGGTGGTTTGGGTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGTGTAGTACTGAGTGGTGAGTGGACTGCCTTTTCTCATTAGGGTAGTTGGGTGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACGGTACAGCTGGAGCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGCTGATTGGACGTTATGGACTGTATTTATATTTGCGGAAGCACTGTTCTCTTTCCCTCCCGTG
  5   1   2       bld Emb3      in                    IMAGE:3399462.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAATGAGCATACTGCCTGCTTTCTGCTCCCTTTACTTCTTACTTGGTGCCCCAAGCACACATACAATCACCTGAGCCAGTGCCATGAGCATGCAGTTTGATCTGGTGAGTCTTCATACGGTCAGGATTGCAAGAGCACAATTTGGAAATGTAATGCAAATGCAAAACTGGGGCACCATGATGCGACGTGTGCCTGGGCTCTGTGCCGGAAGCATGCAACTAAACTGCAGTGGCTGGAAGTATGAGGAGTGTGTTGAGTGGGCTGCTCCTTAATTGTGGGTAAGTTGAACGGGTAAAAGGTGGTTTGGGTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGTGTAGTACTGAGTGGTGAGTGGACTGCCTTTTCTCATTAGGGTAGT
  3   1   2      seed Ga12                                 XL196l10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTGCTCCCTTTACTTCTTACTTGGTGCCCCAAGCACACATACAATCACCTGAGCCAGTGCCATGAGCATGCAGTTTGATCTGGTGAGTCTTCATACGGTCAGGATTGCAAGAGCACAATTTGGAAATGTAATGCAAATGCAAAACTGGGGCACCATGATGCGACGTGTGCCTGGGCTCTGTGCCGGAAGCATGCAACTAAACTGCAGTGGCTGGAAGTATGAGGAGTGTGTTGAGTGGGCTGCTCCTTAATTGTGGGTAAGTTGAACGGGTAAAAGGTGGTTTGGGTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGTGTAGTACTGAGTGGTGAGTGGACTGCCTTTTCTCATTAGGGTAGTTGGGTGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACGGTACAGCTGGAGCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGCTGATTGGACGTTATGGACTGTATTTATATTTGCGGAAGCACTGTTCTCTTTTCCTCCCGTGTGATTGGCACAGAT
  5   1   2       bld Ga15      in                       XL514g07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTTACTTCTTACTTGGTGCCCCAAGCACACATACAATCACCTGAGCCAGTGCCATGAGCATGCAGTTTGATCTGGTGAGTCTTCATACGGTCAGGATTGCAAGAGCACAATTTGGAAATGTAATGCAAATGCAAAACTGGGGCACCATGATGCGACGTGTGCCTGGGCTCTGTGCCGGAAGCATGCAACTAAACTGCAGTGGCTGGAAGTATGAGGAGTGTGTTGAGTGGGCTGCTCCTTAATTGTGGGTAAGTTGAACGGGTAAAAGGTGGTTTGGGTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGTGTAGTACTGAGTGGTGAGTGGACTGCCTTTTCTCATTAGGGTAGTTGGGTGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACAGTACAGCTGGAGCGGCTGANCCTTGANTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTANGGGCATGTGTAATANTTTGGTTAANTGCCTC
  3   1   2       bld Ga15      in                       XL514g07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTTACTTCTTACTTGGTGCCCCAAGCACACATACAATCACCTGAGCCAGTGCCATGAGCATGCAGTTTGATCTGGTGAGTCTTCATACGGTCAGGATTGCAAGAGCACAATTTGGAAATGTAATGCAAATGCAAAACTGGGGCACCATGATGCGACGTGTGCCTGGGCTCTGTGCCGGAAGCATGCAACTAAACTGCAGTGGCTGGAAGTATGAGGAGTGTGTTGAGTGGGCTGCTCCTTAATTGTGGGTAAGTTGAACGGGTAAAAGGTGGTTTGGGTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGTGTAGTACTGAGTGGTGAGTGGACTGCCTTTTCTCATTAGGGTAGTTGGGTGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACAGTACAGCTGGAGCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGCTGATTGGACGTTATGGACTGTATTTATATTTGCGGAAGCACTGTTCTCTTTTCCTCCCGTGTGATTGGCACCAGATGGAAATGA
  3   1   2       bld Tbd7      in                         XL087l18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTTGGTGCCCCAAGCACACATACAATCACNTGAGCCAGTGCCATGAGCATGCAGTTTGATCTGGTGAGTCTTCATACGGTCAAGGATTGCAAGAGCACAATTTGGAAATGTAATGCAAATGCAAAACTGGGGCACCATGATGCGACGTGTGCCTGGGCTCTGTGCCGGAAGCATGCAACTAAACTGCAAGTGGCTGGAAGTATGAGGAGTGTGTTGAGTGGGCTGCTCCTTAATTGTGGGTAAGTTGAACGGGTAAAAGGTGGTTTGGGTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGTGTAGTACTGAGTGGTGAGTGGACTGCCTTTTCTCATTAGGGTAGTTGGGTGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACGGTACAGCTGGAGCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGCTGATTGGACGTTATGGACTGTATTTATATTTGCGGAAGCACTGTTCTCTTTTCCTCCCGTGGATTGGCACAGAGGAAATAGATTTCTCTTATAAATAAAGG
  3   1   2       bld Ga15      in                       XL443d11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCCCCAAGCACACATACAATCACNTGAGGCCAGTGCCATGAGCATGCAGTTTGATCTGGTGAGTCTTCATACGGTCAGGATTGCAAGAGCACAATTTGGAAATGTAATGCAAATGCAAAACTGGGGCACCATGATGCGACGTGTGCCTGGGCTCTGTGCCGGAAGCATGCAACTAAACTGCAGTGGCTGGAAGTATGAGGAGTGTGTTGAGTGGGCTGCTCCTTAATTGTGGGTAAGTTGAACGGGTAAAAGGTGGTTTGGGTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGTGTAGTACTGAGTGGTGAGTGGACTGCCTTTTCTCATTAGGGTAGTTGGGTGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACGGTACAGCTGGAGCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGCTGATTGGACGTTATGGACTGTATTTATATTTGCGGAAGCACTGTTCTCTTTTCCTCCCGTGTGATTGGCACAGATG
  3   1   2       bld Ga12      out                        XL197l10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGTGCCATGAGCATGCAGTTTGATCTGGTGAGTCTTCATACGGTCAGGATTGCAAGAGCACAATTTGGAAATGTAATGCAAATGCAAAACTGGGGCACCATGATGCGACGTGTGCCCTGGGCTCTGTGCCGGAAGCATGCAACTAAACTGCAGTGGCTGGAAGTATGAGGAGTGTGTTGAGTGGGCTGCTCCTTAATTGTGGGTAAGTTGAACGGGTAAAAGGNGGTTNGGGTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGCGTAGTNCTGAGTGGTGAGTGGACTGCCTNTTCTCATTAGGGTAGTTGNGNGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCNGGGGGTGAGATGACCCGNGTGCTTGGAATTTGNGGGNGGATATGAG
  3   1   2       bld Tbd7      in                         XL077h23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCTTCATACGGTCAGGATTGCAAGAGCACAATTTGGAAATGTAATGCAAATGCAAAACTGGGGCACCATGATGCGACGTGTGCNTGGGCTCTGTGCCGGAAGCATGCAACTAAACTGCAGTGGCTGGAAGTATGAGGAGTGTGTTGAGTGGGCTGCTCCTTAATTGTGGGTAAGTTGAACGGGTAAAAGGTGGTTTGGGTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGTGTAGTACTGAGTGGTGAGTGGACTGCCTTTTCTCATTAGGGTAGTTGGGTGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACGGTACAGCTGNANCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGCTGATTGGACGTTATGGACTGTATTTATATTTGCGGAAGCAC
  3   1   2       bld Ga12      in                         XL182o22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTTCATACGGTCAGGATTGCAAGAGCACAATTTGGAAATGTAATGCAAATGCAAAACTGGGGCACCATGATGCGACGTGTGCCTGGGCTCTGTGCCGGAAGCATGCAACTAAACTGCAGTGGCTGGAAGTATGAGGAGTGTGTTGAGTGGGCTGCTCCTTAATTGTGGGTAAGTTGAACGGGTAAAAGGTGGTTTGGGTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGTGTAGTACTGAGTGGTGAGTGGACTGCCTTTTCTCATTAGGGTAGTTGGGTGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACGGTACAGCTGGAGCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGCTGATTGGACGTTATGGACTGTATTTATATTTGCGGAAGCACTGTTCTCTTTTCCTCCCGTGTGATTGGCACAGATGGAAA
  3   1   2       bld Ga15      in                       XL444a08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGTCAGGATTGCAAGAGCACAATTTGGAAATGTAATGCAAATGCAAAACTGGGGCACCATGATGCGACGTGTGCCTGGGCTCTGTGCCGGAAGCATGCAACTAAACTGCAGTGGCTGGAAGTATGAGGAGTGTGTTGAGTGGGCTGCTCCTTAATTGTGGGTAAGTTGAACGGGTAAAAGGTGGTTTGGGTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGTGTAGTACTGAGTGGTGAGTGGACTGCCTTTTCTCATTAGGGTAGTTGGGTGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACGGTACAGCTGGAGCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGCTGATTGGACGTTATGGACTGTATTTATATTTGCGGAAGCACTGTTCTCTTTTCCTCCCGTGTG
  3   1   2       bld Tbd7                                 XL096b01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGAAGTATGAGGAGTGTGTTGAGTGGGCTGCTCCTTAATTGTGGGTAAGTTGAACGGGTAAAAGGTGGTTTGGGTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGTGTAGTACTGA
  3   1   2       bld Tbd7      in                         XL055c19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGTGGGTAAGTTGAACGGGTAAAAGGTGGTTTGGGTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGTGTAGTACTGAGTGGTGAGTGGACTGCCTTTTCTCATTAGGGTAGTTGGGTGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACGGTACAGCTGGAGCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGCTGATTGGACGTTATGGACTGTATTTATATTTGCGGAAGCACTGTTCTCTTTTCCTCCCGTGTGATGGCACAGA
  3   1   2       bld Lu1       in                    IMAGE:4633282.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGGGTGACATATTGTGGGGCAGCTGGAGCCTTTCCTTTGTGAGTGTAGTACTGAGTGGTGAGTGGACTGCCTTTTCTCATTAGGGTAGTTGGGTGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACGGTACAGCTGGAGCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGCTGATTGGACGTTATGGACTGTATTTATATTTGCGGAAGCACTGTTCTCTTTTCCTCCCGTGTGATTGGCACAGATGGAAATGAGATTTCTCTTATAAATAAAGTGGTTAAACTGCAAAAAAAAAAAAAAAA
  3   1   2       bld Ooc2      in                    IMAGE:3747121.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTGTAGTACTAAGTGGTGAGTGGACTGCCTTTTCTCATTAAGGTAGATGGGTGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACGGTACAGCTGGAGCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGAGTGATTGGACGTTATGGACTGTATTTATATTTGCGGAAGCACTGTTCTCTTTCCCTCCCGTGTGATTGGCACAGATGGAAATGAGATTTCTCTTATAAATAAAGTGGTAAAACTGCAAAA
  3   1   2       bld Ooc3 5g3  in                    IMAGE:3436500.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAGTGGTGAGTGGACTGCCTTTTCTCATTAGGGTAGTTGGGTGTGAGCTGTGTGCAGTGCTAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGTGGCACTGTTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACGGTACAGCTGGAGCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGCTGATTGGATGTTATGGACTGTATTTATATTTGCGGAAGCACTGTTCTCTTTCCCTCCCGTGTGATTGGCACAGATGGAAATGAGATTTCTCTTATAAATA
  3   1   2       bld Ga15 5g3  in                       XL402k17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCTGTGTGCAGTGNTAGATTGTTTTTCNGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGNTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACAGTACAGCTGGAGCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGGCTGATTGGACGTTATGGACTGTATTTATATTT
  3   1   2       bld Bla1                            IMAGE:3381623.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGATTGTTTTTCTGGGGGTGAGATGACCCGTGTGCTTGGAATTTGTGGGTGGATATGAGCTGCACTGTGACTGCTGTGCCCAATTCCAGGCTTGGAATTTGGGGCAGGGTAACGGTACAGCTGGAGCGGCTGAGCCTTGAGTGCAGTTCTGGGGCAGATTTCTTTTGTTTGTAGGGGCATGTGTAATAGTTTGGTTAAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGCTGATTGGACGTTATGGACTGTATTTATATTTGCGGAAGCACTGTTCTCTTTTCCTCCCGTGTGATTGGCACAGATGGAAATGAGATTTCTCTT
  3   1   2       bld Emb3      in                    IMAGE:3399462.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGTGCCTCAGATACGGTAGATGGAGCACATGCTATTGGTGGCTGGATCTGTCAGACCCCCTTCCCTTCTCGTTGCTGATTGGACGTTATGGACTGTATTTATATTTGCGGAAGCACTGTTCTCTTTTCCTCCCGTGTGATTGGCACAGATGGAAATGAGATTTCTCTTATAAATAAAGTGGTTAAACTGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)