Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6874909.5                       4 PI      79       1883     2265                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012770527 Xl3.1-IMAGE:6317111.5 - 50 ESTs
                                                                       ........-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6317111.5                                                                                                                       GGCTCAGCGAGTAACAAATCTTCCTGGGACCGCCGAACTCCAAAGAGCAGTAGGGGAACAAACCATTCTCGTCCTTGTGGGAATACGAATACCAGGCAGTGGCCCGACCTGAATGGTGACAATGGATGGCTCCGTCTGTGCTCTTCCTACACTTGTTACTTTCACCCTCCTGACTTCCGGGCTGGGGCTGGCTCTGGCAGGGGAACTTTGTGGAAAAACCCCATGCCTTAATGGAGGAACCTGTCTAAAAGATGCACCTGACAATCCTTTCTGCCTTTGCCCAGTTGGTTTAACTGGAATTGATTGCAGCATTACTGAAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAGAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGTGCCAATGCATTGGGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTACCACGGCTTCCTTGGTTTACAGCGCTGGGGGCCGAACTTGGCCAGGCTCAACAATAAGGGTATGGTAAATGCTTGGACAGCAAACAGCCTTGACCAGCATCCATGGATACAGGTCAATCTGCTAAGAGAAATGAGAGTGTCAGGCATCATCACCCAAGGAGCCAGCAGAATGGGCACTGCTGAATATGTCAAAGAGTTTAAGGTGGCATACAGTGTTGATGGGCATGAGTTCACTTTTTATAAAAGTGAAGGGAAGGACAAGCTGTTTCCTGCAAACATAGACAATGATGGAAGGAAGGCAAACCTGTTCAGCCCACCAATCTCTGCCCAGTTCATCCGTATATTCCCTGTGACATGCCGTGTTGCCTGTACTCTTCGCTTTGAGCTGTATGGCTGTGAAGCAAGTGTGTATTTCAACATGGTAGGTTGCTCTGACCCTCTCGGAATGAAAGCACACATGGTTTCTGATAAGCAAATAACAGCATCCAGTGTTTACCAGACCTGGGGTGTTGATGCCTTTACATGGTACCCACACTATGCCCGTTTGGACAAGATTGGCAAGACCAATGCTTGGACTGCACTTGAGAATAACCAGGAACAGTGGTTGCAGATTGACCTCCACATTCCTAAGAAGATCACTGGAATTATTACACAGGGTGCAAAGGACTTTGGAAGTATTCAGTATGTGGAGTCCTTCAAAGTGGCTTACAGCGACGATGGCAACACCTGGAAGATTTACAAAGATAGCAGGACAAAAGTAGATAAGATCTTCCTCGGAAACACTGACAACTACTCCCACAAAAAGAACCTCTTTGATGTGCCATTCTCCGCCCGTTTTGTGCGCGTGCTGCCACAGTCTTGGCACGAGCGTATCACACTACGAATGGAACTCTTGGGCTGTGATCATTAAAAAGTAGGCAAAGAGGTTGACTTCTGCAGTGTCCCCGAATCAAACTTTCTCTTATCATTGTCTCCTGTATTTGATACACCTGCTGACTACTAAAATGCCACTTAATTTTTACCTAAATCTGGGTTTCGGCGTGGGGGTGTCCTTTGCTGTCCTGTTGACCTGACCTGTAGTGGAGAAGTCATTTAGCCCTCAATAGAACAAAGTGTCTCAGCTGGAAAGGAGCCCCAAGCCAGAGTTGCTTCCTATCGATTGTTGTAGAGTAAAGACCCTTGCCTTAGTGGGGCCCTGTAGCCAAAATAATAGATTTTCTGTGTGTTTACATCAGGGGTGTCATTTTATGGCCCACTAGCCCACTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTTGTTGTAGTTGAACAACAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCTTATTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGGTAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCTGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGATTGACAATTAATATTGTAACCATTGGGTATAATAAGCTTTCCTAGTTGTGTTTGTATTTTTTTGAATCAAGTTTAATGTTGTTTTTGTTAACTTGCACAATTGTTTTGGCTTA
                                                  Xl3.1-CHK-1012686685                                                                                                                             GCGAGTAACAAATCTTCCTGGGACCGCCGAACTCCAAAGAGCAGTAGGGGAACAAACCATTCTCGTCCTTGTGGGAATACGAATACCAGGCAGTGGCCCGACCTGAATGGTGACAATGGATGGCTCCGTCTGTGCTCTTCCTACACTTGTTACTTTCACCCTCCTGACTTCCGGGCTGGGGCTGGCTCTGGCAGGGGAACTTTGTGGAAAAACCCCATGCCTTAATGGAGGAACCTGTCTAAAAGATGCACCTGACAATCCTTTCTGCCTTTGCCCAGTTGGTTTAACTGGAATTGATTGCAGCATTACTGAAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAGAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGTGCCAATGCATTGGGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTACCACGGCTTCCTTGGTTTACAGCGCTGGGGGCCGAACTTGGCCAGGCTCAACAATAAGGGTATGGTAAATGCTTGGACAGCAAACAGCCTTGACCAGCATCCATGGATACAGGTCAATCTGCTAAGAGAAATGAGAGTGTCAGGCATCATCACCCAAGGAGCCAGCAGAATGGGCACTGCTGAATATGTCAAAGAGTTTAAGGTGGCATACAGTGTTGATGGGCATGAGTTCACTTTTTATAAAAGTGAAGGGAAGGACAAGCTGTTTCCTGCAAACATAGACAATGATGGAAGGAAGGCAAACCTGTTCAGCCCACCAATCTCTGCCCAGTTCATCCGTATATTCCCTGTGACATGCCGTGTTGCCTGTACTCTTCGCTTTGAGCTGTATGGCTGTGAAGCAAGTGTGTATTTCAACATGGTAGGTTGCTCTGACCCTCTCGGAATGAAAGCACACATGGTTTCTGATAAGCAAATAACAGCATCCAGTGTTTACCAGACCTGGGGTGTTGATGCCTTTACATGGTACCCACACTATGCCCGTTTGGACAAGATTGGCAAGACCAATGCTTGGACTGCACTTGAGAATAACCAGGAACAGTGGTTGCAGATTGACCTCCACATTCCTAAGAAGATCACTGGAATTATTACACAGGGTGCAAAGGACTTTGGAAGTATTCAGTATGTGGAGTCCTTCAAAGTGGCTTACAGCGACGATGGCAACACCTGGAAGATTTACAAAGATAGCAGGACAAAAGTAGATAAGATCTTCCTCGGAAACACTGACAACTACTCCCACAAAAAGAACCTCTTTGATGTGCCATTCTCCGCCCGTTTTGTGCGCGTGCTGCCACAGTCTTGGCACGAGCGTATCACACTACGAATGGAACTCTTGGGCTGTGATCATTAAAAAGTAGGCAAAGAGGTTGACTTCTGCAGTGTCCCCGAATCAAACTTTCTCTTATCATTGTCTCCTGTATTTGATACACCTGCTGACTACTAAAATGCCACTTAATTTTTACCTAAATCTGGGTTTCGGCGTGGGGGTGTCCTTTGCTGTCCTGTTGACCTGACCTGTAGTGGAGAAGTCATTTAGCCCTCAATAGAACAAAGTGTCTCAGCTGGAAAGGAGCCCCAAGCCAGAGTTGCTTCCTATCGATTGTTGTAGAGTAAAGACCCTTGCCTTAGTGGGGCCCTGTAGCCAAAATAATAGATTTTCTGTGTGTTTACATCAGGGGTGTCATTTTATGGCCCACTAGCCCACTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTTGTTGTAGTTGAACAACAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCTTATTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGGTAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCTGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGATTGACAATTAATATTGTAACCATTGGGTATAATAAGCTTTCCTAGTTGTGTTTGTATTTTTTTGAATCAAGTTTAATGTTGTTTTTGTTAACTTGCACAATTGTTTTGGCTTATGATTT
                                                      consensus depths                                                                                                                            2     3     3     4     3     4     5     6     5     6     8    10     9    11    11    12    12    12    12    12    12    12    13    13    13    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    15    14    16    16    16    16    16    16    16    16    16    16    16    15    16    16    16    16    16    16    16    16    17    16    17    16    17    16    17    16    17    17    17    17    18    18    18    18    19    18    19    17    18    15    17    16    17    16    17    16    17    16    17    16    17    15    17    14    17    14    17    13    17    13    17    13    17    13    17    11    17    11    17    10    17    11    17     9    15     8    14     9    16    10    16     9    16     9    15     8    15     8    15     8    15     8    15     7    12     7    11     7    11     7    10     6     8     5     6     5     6     5     6     5     7     5     7     5     7     5     7     4     8     3     8     4     8     5     8     5     8     5     7     5     7     5     7     5     7     4     7     4     7     4     7     4     8     4     8     4     8     5     9     6    10     6    10     7    10     7    10     7    10     7    10     7    10     7    10     7    11     7    11     7    11     7    11     8    11     8     9     8     9     8     9     8     9     8     9     7     8     7     8     7     8     6     8     6     7     6     7     6     8     6     8     7     8     7     8     7     7     7     7     7     7     7     7     7     7     7     9     6     8     6     8     5     9     5    10     5    10     5    10     6    11     6    11     5    11     5     9     6    10     6    10     5     9     6    11     7    11     6    11     8    12     8    12     9    12     8    12    10    13    11    13    11    13    14    15    14    15    14    15    14    15    13    15    13    15    16    17    16    17    17    17    15    17    16    17    17    18    19    20    19    20    19    20    19    21    19    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    20    20    20    20    20    20    20    20    20    20    20    19    20    20    21    21    21    21    21    20    21    20    21    20    21    17    21    17    21    15    21    12    21    12    19    11    18    11    18    11    18    11    18    11    17     9    17     8    17     8    17     6    16     2     9
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   C-----------
                                               BLH ATG     121    1290                                                                                                                       
                                               BLH MIN     121     183                                                                                                                       
                                               BLH OVR     112     547                                                                                                                       
                                               CDS MIN     112       1                                                                                                                       
                                               EST CLI      33       1                                                                                                                       
                                               ORF LNG     112      99                                                                                                                       
  5   1   2       bld Ga12 5g3  in                         XL186c10.5p AAATCCCCCCACCGGTGTCCCTCCCTGTTCTGTATCCAAAGCACAGCTGACTTTGCCTCCTCTTCTCTTCCCATTGGCGGAGCTGCGGAGTCACGTGCTCGGGTAATCTGCATTCACAGGCTCAGCGAGTAACAAATCTTCCTGGGACCGCCGAACTCCAAAGAGCAGTAGGGGAACAAACCATTCTCGTCCTTGTGGGAATACGAATACCAGGCAGTGGCCCGACCTGAATGGTGACAATGGATGGCTCCGTCTGTGCTCTTCCTACACTTGTTACTTTCACCCTCCTGACTTCCGGGCTGGGGCTGGCTCTGGCAGGGGAACTTTGTGGAAAAACCCCATGCCTTAATGGAGGAACCTGTCTAAAAGATGCACCTGACAATCCTTTCTGCCTTTGCCCAGTTGGTTTAACTGGAATTGATTGCAGCATTACTGAAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAGAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGT
  5   1   2       bld Neu7 5g3  in                         XL016n12.5p                                                                                                           GCTGCATTCACAGGCTCAGCGAGTAACAAATCTTCCTGGGACCGCCGAACTCCAAAGAGCAGTAGGGGAACAAACCATTCTCGTCCTTGTGGGAATACGAATACCAGGCAGTGGCCCGACCTGAATGGTGACAATGGATGGCTCCGTCTGTGCTCTTCCTACACTTGTTACTTTCACCCTCCTGACTTCCGGGCTGGGGCTGGCTCTGGCAGGGGAACTTTGTGGAAAAACCCCATGCCTTAATGGAGGAACCTGTCTAAAAGATGCACCTGACAATCCTTTCTGCCTTTGCCCAGTTGGTTTAACTGGAATTGATTGCAGCATTACTGAAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAGAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCA
  5   1   2       bld Brn1 5x                         IMAGE:6954022.5p                                                                                                                       ACCGCCCCACCCAGCCCAACCCCTTCAAGAAAGAGGCTGGTCCGGTCCGGAATTTGCAAAATAATGTCTCGTCCTTGTGGGATTTCCAATACCAGGCAGTGGCCCGACCTGAATGGTGACAATGGATGGCTCCGTCTGTGCTCTTCCTACACTTGTTACTTTCACCCTCCTGACTTCCGGGCTGGGGCTGGCTCTGGCAGGGGAACTTTGTGGAAAAACCCCATGCCTTAATGGAGGAACCTGTCTAAAAGATGCACCTGACAATCCTTTCTGCCTTTGCCCAGTTGGTTTAACTGGAATTGATTGCAGCATTACTGAAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAGAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCGGTTGTGCCAATGCATTGGGAATGGAAGGCCAGGTCAATTTTAGATGCCCAGATAATATCCGTCCTCTCCTGTACCACGGCCTTTCCTTGGGTTTTACAGCCGCTTGGGGGGCCGAAACTTTGGCCCGGTCTCCAAACAATAAAGGGCTAATGGCTAAAATGCCTTGGGCACAAGCAAAAAACAGCCCTTTACCCATTCAATCCCCTTGTGAACTACCAGGCTCAAATTCTTGCCTTTAACAAAAAAATTCCAAAATCTGGTCCAGGGCCACTCATTCCACTCCCAAGGGNGATCCCACCCCATCAAATGGGGGNCCCCTCCCTTTAACTCTTCCTCAAAAAGAATGTTTAAAggggggggNATCAACAAATGGTTCTGAAAGGGGGCCAATGGAACTGTAAACCTTCTCTAACTACGAACTGTGTAAGGGGCAACAGAACAACCCCTGCGTTTCCCCCGCCCACAAGCACAAGTAACTAAGGTTTTCGGAAAGGAAAAGGGCACCAACCTTGTGTTCTCACGCCCACACA
  5   1   2       bld Neu7 5g3  in                         XL024j10.5p                                                                                                                             GCGAGTAACAAATCTTCCTNGGACCGCCGAACTCCAAAGAGCAGTNGGGGAACAAACCATTCTCGTCCTTGTGGGAATACGAATACCAGGCAGTGGCCCGACCTGAATGGTGACA
  5   1   2       bld FaBN 5g3  in                    IMAGE:8075836.5p                                                                                                                                                     CGCCGAACTCCAAAGAGCAGTAGGGGAACAAACCATTCTCGTCCTTGTGGGAATACGAATACCAGGCAGTGGCCCGACCTGAATGGTGACAATGGATGGCTCCGTCTGTGCTCTTCCTACACTTGTTACTTTCACCCTCCTGACTTCCGGGCTGGGGCTGGCTCTGGCAGGGGAACTTTGTGGAAAAACCCCATGCCTTAATGGAGGAACCTGTCTAAAAGATGCACCTGACAATCCTTTCTGCCTTTGCCCAGTTGGTTTAACTGGAATTGATTGCAGCATTACTGAAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAGAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGTGCCAATGCATTGGGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTAACACGGCTTCCTTGGTATACAGCGCTGGGGGCCGAACTTGGCCAGGCTCAACAATAAGGGTATGGTAAATGCTTGGACAGCAACCACCTTTAACTACCATCCTGGATACAGGTCATTTTGCTaaaaaaaaTAAAGTGTCATGCTCATCC
  5   1   2       bld Ov1  5g                         IMAGE:6317111.5p                                                                                                                                                        CGAACTCCAAAGAGCAGTAGGGGAACAAACCATTCTCGTCCTTGTGGGAATACGAATACCAGGCAGTGGCCCGACCTGAATGGTGACAATGGATGGCTCCGTCTGTGCTCTTCCTACACTTGTTACTTTCACCCTCCTGACTTCCGGGCTGGGGCTGGCTCTGGCAGGGGAACTTTGTGGAAAAACCCCATGCCTTAATGGAGGAACCTGTCTAAAAGATGCACCTGACAATCCTTTCTGCCTTTGCCCAGTTGGTTTAACTGGAATTGATTGCAGCATTACTGAAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAGAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGTGCCAATGCATTGGGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTACCACGGCTTCCTTGGTTTACAGCGCTGGGGGCCGAACTTGGCCAGGCTCAACAATAAGGGTATGGTAAATGCTTGGACAGCAAACAGCCTTGACCAGCATCCATGGATACAGGTCAATCTGCTAAGAGAAATGAGAGTGTCAGGCATCATCACCCAAGGAGCCAGCAGAATGGGCACTGCTGAATATGTCAAAGAAGTTTAAGTGCCATACCAGTGTTGAATGGGCATGAAGTTCACTTTTTATAAAAGTGAAAGGGAAGGAACAAGCTGTTTCCTGCAAACATAGACCATGNATGGAAAGGGAAGGCAAAACCTTGTT
  5   1   2       bld Ov1  5g                         IMAGE:6316460.5p                                                                                                                                                                        GTAGGGGAACAAACCATTCTCGTCCTTGTGGGAATACGAATACCAGGCAGTGGCCCGACCTGAATGGTGACAATGGATGGCTCCGTCTGTGCTCTTCCTACACTTGTTACTTTCACCCTCCTGACTTCCGGGCTGGGGCTGGCTCTGGCAGGGGAACTTTGTGGAAAAACCCCATGCCTTAATGGAGGAACCTGTCTAAAAGATGCACCTGACAATCCTTTCTGCCTTTGCCCAGTTGGTTTAACTGGAATTGATTGCAGCATTACTGAAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAGAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGTGCCAATGCATTGGGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTACCACGGCTTCCTTGGTTTACAGCGCTGGGGGGCCGAACTTGGCCAGGCTCAACAATAAAGGGTATGGTAAATGCTTGGACAGCAAACAGCCTTGACCAGCATCCATGGATACAGGGCAATCTGCTAAGAGAAATGAGAGTGTCAGGCATCATCACCCCAGGGAGCCACCAGAAGGGGCACTGCTGGAAATGTCAAGAGTTTAAGGGGGCATACCGTGTTGATGGGCATGAATTCACTTTTTATAAAAGGGAC
  5   1   2       bld Kid  5g                         IMAGE:4032391.5p                                                                                                                                                                          AGGGGAACAAACCATTCTCGTCCTTGTGGGAATACGAATACCAGGCAGTGGCCCGACCTGAATGGTGACAATGGATGGCTCCGTCTGTGCTCTTCCTACACTTGTTACTTTCACCCTCCTGACTTCCGGGCTGGGGCTGGCTCTGGCAGGGGAACTTTGTGGAAAAACCCCATGCCTTAATGGAGGAACCTGTCTAAAAGATGCACCTGACAATCCTTTCTGCCTTTGCCCAGTTGGTTTAACTGGAATTGATTGCAGCATTACTGAAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAGAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGTGCCAATGCATTGGGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTACCCACGGCTTCCCTTGGTTTACAGGGGCTGGGGGGCCCGAAACTTGGGCCCAGGCTTCCAACAATAAAGGGGTATGGGTAAAATGGCTTGGGACAAGCAAAACAACCCTTTGACCCAGCAATTCCAGGGGAATAAACGGGGGCCAATTCTTGCCTTAAGaaaaaaaatggaaaaaGGGGTTCAAGGGGCAATCCTTTCCCCCGCCAAGGGGGAGCCCCCAGCCAGAAAAAGGGGGGCCAACCTTGGGCTTGGAAAAATAATTGGGCCCAAAAAGAAAGACTTTTAC
  5   1   2       bld Te2  5g                         IMAGE:7209403.5p                                                                                                                                                                           ATCATTCCCGATACGTCTGCGCTAGTTGGACTACCAATTCCAGGCAGTGGCCCCATCTGAATGCTGACAATGGATGGCTCCGTGCGAGCTCTTCACACACTTCTTCGTTTTACTCTGCTGACTTCCGGGCTGGTGCTGGCTGTACCAGGGGAACTTTGTGGAAAAACCCCATGCCTTAATGGAGGAACCTGTCTAAAAGATGCACCGGACAATCCTTTCTGCCTTTGCCCAGTTGGTTTTACTGGAATAGATTGCAACATAACTGAAAAGGGCCCTTGCGATCCTAATCCCTGCCAGAGCAATGGGGAATGCCAAGTACTGTCTGATTCTGGGAGAGGAGACACCTTTGTACAGTATTTCTGCAAGTGCCTGCCTGGATATGAAGGACAGAACTGTGAAATCAATAAGAACCAGTGCTACACAAACCCCTGCAAAAATGGGGGTATCTGCAAACACCTTGGTAATGACTTTTCATGCAAATGCGCTTCACCATTCATAGGGAAAGTATGCAACATCCGTTGTGCCAATGCATTGGGCATGGAAGGCAGGGCAATTGTAGATGCCCAGATAATATCTTCCTCTCTGTACCACGGCTTCCTTGGTTTACAGCGCTGGGGGCCGAACCTGGCCAGACTCAACAATAAGGCCATGGTAAATGCCTGGACAGCAAACGGCCTTGACCAGCATCCATGGATTCANGGTCATCTGCTAAGAGAAATGAAAGTG
  5   1   2      seed FaBN 5g                         IMAGE:8079038.5p                                                                                                                                                                              GAACAAACCATTCTCGTCCTTGTGGGAATACGAATACCAGGCAGTGGCCCGACCTGAATGGTGACAATGGATGGCTCCGTCTGTGCTCTTCCTACACTTGTTACTTTCACCCTCCTGACTTCCGGGCTGGGGCTGGCTCTGGCAGGGGAACTTTGTGGAAAAACCCCATGCCTTAATGGAGGAACCTGTCTAAAAGATGCACCTGACAATCCTTTCTGCCTTTGCCCAGTTGGTTTAACTGGAATTGATTGCAGCATTACTGAAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAGAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGTGCCAATGCATTGGGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTACCACGGCTTCCTTGGTTTACAGCGCTGGGGGCCGAACTTGGCCAGGCTCAACAATAAGGGTATGGTAAATGCTTGGACAGCAAACAGCCTTGACCAGCATCCATGGATACAGGTCAATCTGCTAAGAGAAATGA
  5   1   2       bld Emb9 5g3  in                    IMAGE:7976156.5p                                                                                                                                                                                      TCGGTCCGGATTCCCGGGATTACGAATACCAGGCAGTGGCCCGACCTGAATGGTGACAATGGATGGCTCCGTCTGTGCTCTTCCTACACTTGTTACTTTCACCCTCCTGACTTCCGGGCTGGGGCTGGCTCTGGCAGGGGAACTTTGTGGAAAAACCCCATGCCTTAATGGAGGAACCTGTCTAAAAGATGCACCTGACAATCCTTTCTGCCTTTGCCCAGTTGGTTTAACTGGAATTGATTGCAGCATTACTGAAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAGAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGTGCCAATGCATTGGGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTACCACGGCTTCCTTGTTTACAGCGCTGGGGGCCGAACTTGCCAGGCTAACATTAGGGTATGGTAATGCTTGGACAGCAAACAGCCTTAACAGCATCATGGATACAGTCATCTTCTACAGAATTAAATGTCGGCCTCTCCCCAGAGCAGCGATGGCACGCTGATATTCAAATTTAGTGCTCTTGTTATGGCTGATTCTTTTATAATAAGAAGAATCTTTCTTACTTAATAATGAGAGAAACTTCCCTCATTCCCTTC
  5   1   2       bld FaBN 5g3  in                    IMAGE:8075925.5p                                                                                                                                                                                                   GTGGGAATACGAATACCAGGCAGTGGCCCGACCTGAATGGTGACAATGGATGGCTCCGTCTGTGCTCTTCCTACACTTGTTACTTTCACCCTCCTGACTTCCGGGCTGGGGCTGGCTCTGGCAGGGGAACTTTGTGGAAAAACCCCATGCCTTAATGGAGGAACCTGTCTAAAAGATGCACCTGACAATCCTTTCTGCCTTTGCCCAGTTGGTTTAACTGGAATTGATTGCAGCATTACTGAAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAGAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGTGCCAATGCATTGGGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTACCACGGCTTCCTTGGTTTACAGCGCTGGGGGCCGAACTTGGCCAGGCTCAACAATAAGGGTATGGTAAATGCTTGGACAGCAAACAGCTTGACCAGCATCATGGATACAGTCATCTGCTAAGAGAATGAGAGTGTCGGCATCTCACCCAAGAGCAGCAAATGGCACTGTGATATGTCAACATTTAAGTGCTAAAGG
  5   1   2       bld FaBN                            IMAGE:8078001.5p                                                                                                                                                                                                                                           GTGAAATGGATGGCTCCGTCTGTGCTCTTCCTACACTTGTTACTTTCACCCTCCTGACTTCCGGGCTGGGGCTGGCTCTGGCAGGGGAACTTTGTGGAAAAACCCCATGCCTTAATGGAGGAACCTGTCTAAAAGATGCACCTGACAATCCTTTCTGCCTTTGCCCAGTTGGTTTAACTGGAATTGATTGCAGCATTACTGAAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAGAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGTGCCAATGCATTGGGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTACCACGGCTTCCTTGGTTTACAGCGCTGGGGGCCGAACTTGGCCAGGCTCAACAATAAGGGTATGGTAAATGCTTGGACAGCAAACAGCCTTGACCAGCATCCATGGATACAGGTCAATCTGCTAAGAGAAATGAGAGTGTCGGCATCATCACCCANGAGCAGCAGAATGGCCTGCTGATATGTCAAGAGTTTAAGTGCATACATGTGATGGCATAGTCACTTTATAAGTGAAGGAGACACTGTTCTGCACTAACATGATGAGAAGCACT
  5   1   2       bld Te2       in                    IMAGE:7390460.5p                                                                                                                                                                                                                                                   GATGGCTCCGTCTGTGCTCTTCCTACACTTGTTACTTTCACCCTCCTGACTTCCGGGCTGGGGCTGGCTCTGGCAGGGGAACTTTGTGGAAAAACCCCATGCCTTAATGGAGGAACCTGTCTAAAAGATGCACCTGACAATCCTTTCTGCCTTTGCCCAGTTGGTTTAACTGGAATTGATTGCAGCATTACTGAAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAGAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGTGCCAATGCATTGGGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTACCACGGCTTCCTTGGTTTACAGCGCTGGGGGCCGAACTTGGCCAGGCTCAACAATAAGGGTATGGTAAATGCTTGGACAGCAAACAGCCTTGACCAGCATCCATGGATACAGGTCAATCTGCTAAGAGAAATGAGAGTGTCAGGCATCATCACCCAAGGAGCCAGCAGAATGGGCACTGCTGATATGTCAAGAGTTTAAGTGGCTACAGTGTGATGGCATGAGTCACTTTTATAAAGTGAGGAANGACAGCTGTTCTGCACATAACATGATGAAGAAGCAACTGTCAGCACATCCTGCAGTCTCGTAT
  5   1   2       bld Tbd7      in                         XL083p21.5p                                                                                                                                                                                                                                                                                                                                                                                                  TTTCTGCCTTTGCCCAGTTGGTTTAACTGGAATTGATTGCAGCATTACTGAAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAGAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGTGCCAATGCATTGGGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTACCACGGCTTCCTTGGTTTACAGCGCTGGGGGCCGAACTTGGCCAGGCTCAACAATAAGGGTATGGTAAATGCTTGGACAGCAAACAGCCTTGACCAGCATCCATGGATACAGGTCAATCTGCTAAGAGAAATGAGAGTGTCAGGCATCATCACCCAAGGAGCCAGCAGAATGGGCACTGCTGAATATGTCAAAGAGTTTAAGGTGGCATACAGTGTTGATGGGCATGAGTTCACTTTTTATAAAAGTGAAGGGA
  5   1   2       bld Tbd7      in                         XL098h20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                GNATTGATTGCAGCATTACTGAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAAAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGTGCCAATGCATTGGGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTACCACGGCTTCCTTGGTTTACAGCGCTGGGGGCCGAACTTGGCCAGGCTCAACAATAAGGGTATGGTAAATGCTTGGACAGCAAACAGCCTTGACCAGCATCCATGGATACAGGTCAATCTGCTAAGAGAAATGAGAGTGTCAGGCATCATCACCCAAGGAGCCAGCAGAATGGGCACTGCTGAATATGTCAAAGAGTTTAAGGTGGCATACAGTGTTGATGGGCATGAGTTCACTTTTTATAAAAGTGAAGGGAAGGACAAGCTGTTTCCTGCAAACATAGACAATGATGGAAGGAAGGCA
  5   1   2       bld Ov1                             IMAGE:8331075.5p                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCACGCGTCCGCTGAAAAGGGTCCTTGCGATCCTAATCCATGCAAGAGCAATGGGGAATGTCACGTACTGTCTGATTCGGGGAGAGGTGACACCTTTGTACAGTACTTCTGCAAGTGCTTGCCTGGATATGAAGGACAGAACTGCGAAATCAATAAGAACCAGTGCTATACAAACCCCTGCAAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGTGCCAATGCATTGGGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTACCACGGCTTCCTTGGTTTACAGCGCTGGGGGCCGAACTTGGCCAGGCTCAACAATAAGGGTATGGTAAATGCTTGGACAGCAAACAGCCTTGACCAGCATCCATGGATACAGGTCAATCTGCTAAGAGAAATGAGAGTGTCAGGCATCATCACCCAAGGAGCCAGCAGAATGGGCACTGCTGAATATGTCAAAGAGTTTAAGGTGGCATACAGTGTTGATGGGCATGAGTTCACTTTTTATAAAAGTGAAGGGAAGGACAAGCTGTTTCCTGCAAACATAGACAATGATGGAAGGAAGGCAAACCTGTTCAGCCCACAA
  5   1   2       bld Tail                            IMAGE:8544498.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATNNNNNCCAAAGTGNANAGAGGTACTAAATCTATTCGTCCCGCTATACAAACCCCTGCAAAATGGGGGCATCTGCAAACATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGTGCCAATGCATTGGGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTACCACGGCTTCCTTGGTTTACAGCGCTGGGGGCCGAACTTGGCCAGGCTCAACAATAAGGGTATGGTAAATGCTTGGACAGCAAACAGCCTTGACCAGCATCCATGGATACAGGTCAATCTGCTAAGAGAAATGAGAGTGTCAGGCATCATCACCCAAGGAGCCAGCAGAATGGGCACTGCTGAATATGTCAAAGAGTTTAAGGTGGCATACAGTGTTGATGGGCATGAGTTCACTTTTTATAAAAGTGAAGGGAAGGACAAGCTGTTTCCTGCAAACATAGACAATGATGGAAGGAAGGCAAACCTGTTCAGCCCACCAATCTCTGCCCAGTTCATCCGTATATTCCCTGTGACATGCCGTGTTGCCTGTACTCTTCGCTTTGAGCTGTATGGCTGTGAAGCAAGTGTGTATTTCAACATGGTAGGTTGCTCTGACCCTCTCGGAATGAAAGCACACATGGTTTCTGATAAGCAAATAACAGCATCCAGTGTTTACCAGACCTGGGGTGTTGATGCCTTTACATGGTACCCACACTATGCCCGTTTGGACAA
  5   1   2       bld Brn1                            IMAGE:7019331.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAATCTTGGTGACGACTTTTCATGCAAATGCGCTTCACCATATATAGGGAAAATATGCAACTTCCGTTGTGCCAATGCATTGGGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTACCACGGCTTCCTTGGTTTACAGCGCTGGGGGCCGAACTTGGCCAGGCTCAACAATAAGGGTATGGTAAATGCTTGGACAGCAAACAGCCTTGACCAGCATCCATGGATACAGGTCAATCTGCTAAGAGAAATGAGAGTGTCAGGCATCATCACCCAAGGAGCCAGCAGAATGGGCACTGCTGAATATGTCAAAGAGTTTAAGGTGGCATACAGTGTTGATGGGCATGAGTTCACTTTTTATAAAAGTGAAGGGAAGGACAAGCTGTTTCCTGCAAACATAGACAATGATGGAAGGAAGGCAAACCTGTTCAGCCCACCAATCTCTGCCCAGTTCATCCGTATATTCCCTGTGACATGCCGTGTTGCCTGTACTCTTCGCTTTGAGCTGTATGGCTGTGAAGCAAGTGTGTATTTCAACATGGTAGGTTGCTCTGACCCTCTCGGAATGAAAGCACACATGGTTTCTGATAAGCAAATAACAGCATCCAGTGTTTACCAGACCTNGGGGTGTTGATGCCTTTACATGGTACCCACACTATGCCCGTTTGGACAAGATTGGCAAGACCAATGCTTGGACTGCACTTGAGAATAACCAGGAACAGTGGTTGCAGATTGACCTCCACATTCCTAAGAAGATCACTGGGATTATTACACAGGGTGCAAAGGGACTTNTGGAAGTATTCAAGTATGTGGGAGTCCTTTCAAAAGTGGCTTTACAGCGGATGAATGGGCCAACACCCTT
  5   1   2       chi Eye1                            IMAGE:6949042.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTTTCTCCTCTCCCCTCCTTCTCACTCTCACATAGGCCGCAGGACCGGGCCGGAATTTCCCGAATGGAAGGCAGGGCAATTTTAGATGCCCAGATAATATCCTCTTCTCTGTACCACGGCTTCCTTGGTTTACAGCGCTGGGGGCCGAACTTGGCCAGGCTCAACAATAAGGGTATGGTAAATGCTTGGACAGCAAACAGCCTTGACCAGCATCCATGGATACAGGTCAATCTGCTAAGAGAAATGAGAGTGTCAGGCATCATCACCCAAGGAGCCAGCAGAATGGGCACTGCTGAATATGTCAAAGAGTTTAAGGTGGCATACAGTGTTGATGGGCATGAGTTCACTTTTTATAAAAGTGAACGGAAGGACAAGCTGTTTCCTGCAAACATACACAATGATGGAAGGAAGGCAAACCTGTTCAGCCCACCAATCTCTGCCCAGTTCATCCGTATATTCCCTGTGACATGCCGTGTTGCCTGTACTCTTCGCTTTGAGCTGTATGGGCTGTGAAGCAAGTGTCTATTTCAACATGGTAGGTTGCTCTGACCCTCCTCGGAATCAAAGCCCACATGGGTTTCTGATAAGCAAAATAACACCTCCCACTGTTTACCATACCTGGGGTGTTGCATGCCCCTTACATGGTCACTCACACTAGGCCCGTTTGGCACCAGATTGGGCACCACCAACTGCTTGGACCTGGACCTTTGAGCCAATCACCTGGAACAGCTGGTTGCACATTGACCCCTCCACTTCCTAAAAAAGATCACTGGGAATTTTTAACCCCGGGTGCCAAACGAACCTTTGGCAAGTCTCCCCTTTGTTTGCAGCTCCTTTCCTAATGGCCCTGTCCCGCGAATTATCGCCAACCACCCCGTCCAGAATTTCCCTAATCACTTCCCACGGCACACATAGATAAGAATAACATTTCTTTCTCCGGGAAAACCTTGGACAACCGTCTCCTCCATAAAAAAATAAACCCCTCTTCCAATGTGGCCAATTTCGcccccccccTTTTACGCGGCGCGCCTTTT
  5   1   2       bld Tbd7      in                         XL090g17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCAGGNAATTCGGCACGAGGGCAGAATGGGCACTGCTGAATATGTCAAAGAGTTTAAGGTGGCATACAGTGTTGATGGGCATGAGTTCACTTTTTATAAAAGTGAAGGGAAGGACAAGCTGTTTCCTGCAAACATAGACAATGATGGAAGGAAGGCAAACCTGTTCAGCCCACCAATCTCTGCCCAGTTCATCCGTATATTCCCTGTGACATGCCGTGTTGCCTGTACTCTTCGCTTTGAGCTGTATGGCTGTGAAGCAAGTGTCTATTTCAACATGGTAGGTTGCTCTGACCCTCTCGGAATGAAAGCACACATGGTTTCTGATAAGCAAATAACAGCATCCAGTGTTTACCAGACCTGGGGTGTTGATGCCTTTACATGGTACCCACACTATGCCCGTTTGGACAAGATTGGCAAGACCAATGCTTGGACTGCACTTGAGAATAACCAGGAACAGTGGTTGCAGATTGACCTCCACATTCCTAAGAAGATCACTGGAATTATTACACAGGGTGCAAAGGACTTTGGAAGTATTCAGTATGTGGAGTCCTTCAAAGTGGCTTACAGCGACGATGGCAACACCTGGAAGATTTACAAAGATAGCAGGACAAAAGTAGATAAGATCTTCCTCGGAAACACTGACAACTACTCCCACAAAA
  5   1   2       bld Emb9                            IMAGE:7978540.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCATCACCCAAGGAGCCAGCAGAATGGGCACTGCTGAATATGTCAAAGAGTTTAAGGTGGCATACAGTGTTGATGGGCATGAGTTCACTTTTTATAAAAGTGAAGGGAAGGACAAGCTGTTTCCTGCAAACATAGACAATGATGGAAGGAAGGCAAACCTGTTCAGCCCACCAATCTCTGCCCAGTTCATCCGTATATTCCCTGTGACATGCCGTGTTGCCTGTACTCTTCGCTTTGAGCTGTATGGCTGTGAAGCAAGTGGTTGCTCTGACCCTCTCGGAATGAAAGCACACATGGTTTCTGATAAGCAAATAACAGCATCCAGTGTTTACCAGACCTGGGGTGTTGATGCCTTTACATGGTACCCACACTATGCCCGTTTGGACAAGATTGGCAAGACCAATGCTTGGACTGCACTTGAGAATAACCAGGAACAGTGGTTGCAGATTGACCTCCACATTCCTAAGAAGATCACTGGAATTATTACACAGGGTGCAAAGGACTTTGGAAGTATTCAGTATGTGGAGTCCTTCAAAGTGGCTTACAGCGACGATGGCACACCTGGAAGATTTACAAAGAATAGCATGACAAAGTAGATAAG
  5   1   2       bld Ga18                               xlk59b02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCCAGTTCATCCGTATATTCCCTGTGACATGCCGTGTTGCCTGTACTCTTCGCTTTGAGCTGTATGGCTGTNANNNNGTGGTTGCTCTGACCCTCTCGGAATGAAAGCACACATGGTTTCTGATAAGCAAATAACAGCATCCAGTGTTTACCAGACCTGGGGTGTTGATGCCTTTACATGGTACCCACACTATGCCCGTTTGGACAAGATTGGCAAGACCAATGCTTGGACTGCACTTGAGAATAACCAGGAACAGTGGTTGCAGATTGACCTCCACATTCCTAAGAAGATCACTGGAATTATTACACAGGGTGCAAAGGACTTTGGAAGTATTCAGTATGTGGAGTCCTTCAAAGTGGCTTACAGCGACGATGGCAACACCTGGAAGATTTACAAAGATAGCAGGACAAAAGTAGATAAGATCTTCCTCGGAAACACTGACAACTACTCCCACAAAAAGAACCTCTTTGATGTGCCATTCTCCGCCCGTTTTGTGCGCGTNCTGCCACAGTCTTGGCACGAGCGTATCACACTACGAATGGAACTCTTGGGCTGTGATCATTAAAAAGTAGGCAAAGAGGTTGACTTCTGCAGTGTCCCCGAATCAAACTTTCTCTTATCATTGTCTCCTGTATTTGATACACCTGCTGACTACTAAAATGCCACTTAANTTTTTACCTAAATCTGGGNTTCGGCGTGGGGGTGTCCTTTGCTGTCCTGTTGACCTGACCTGTAGTGGAGAAGNCATTTAGCCCTCA
  5   1   2       bld Em10      in                    IMAGE:7980383.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAACTGCTGTGTTACAGTGTATTTCAACATGGTAGGTTGCTCTGACCCTCTCGGAATGAAAGCACACATGGTTTCTGATAAGCAAATAACAGCATCCAGTGTTTACCAGACCTGGGGTGTTGATGCCTTTACATGGTACCCACACTATGCCCGTTTGGACAAGATTGGCAAGACCAATGCTTGGACTGCACTTGAGAATAACCAGGAACAGTGGTTGCAGATTGACCTCCACATTCCTAAGAAGATCACTGGAATTATTACACAGGGTGCAAAGGACTTTGGAAGTATTCAGTATGTGGAGTCCTTCAAAGTGGCTTACAGCGACGATGGCAACACCTGGAAGATTTACAAAGATAGCAGGACAAAAGTAGATAAGATCTTCCTCGGAAACACTGACAACTACTCCCACAAAAAGAACCTCTTTGATGTGCCATTCTCCGCCCGTTTTGTGCGCGTGCTGCCACAGTCTTGGCACGAGCGTATCACACTACGAATGGAACTCTTGGGCTGTGATCATTAAAAAGTAGGCAAAGAGGTTGACTTCTGCAGTGTCCCCGAATCAAACTTTCTCTTATCATTGTCTCCTGTATTTGATACACCTGCTGACTACTAAAATGCCACTTAATTTTTACCTAAATCTGGGTTTCGGCGTGGGGGTGTCCTTTGCTGTCCTGTTGACCTGACCTGTAGTGGAGAAGTCATTTAGCCCTCAATAG
  5   1   2       bld Neu4      in                    IMAGE:3557693.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACACTATGCCCGTTTGGACAGATTGGCAAGACCAATGCTTGGACTGCACTTGAGAATAACCAGGAACAGTGGTTGCAGATTGACCTCCACATTCCTAAGAAGATCACTGGAATTATTACACAGGGTGCAATGGACTTTGGAAGTATTCATTGTGTGGAGTCCTTCAAAGttttttttATCGACGATGGCATCACCTGGAAGATTTACAAGGATGGCAGGACAAAAGTCGCTCAGATCTTCCTNGGAAACACTGACAACTTCTCCCACAAAAAGAACCTCTTTGATGTGCCATTCTCCGCCCGTTTTGTGCGCGTGCTTCCN
  5   1   2       bld Tbd7      in                         XL080f23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGTTGGACAAGNATTGGCAAGNACCAATGCTTGGACTGCACTTGAGNAATAACCAGGAACAGTGGTTGCAGATTGACCTCCACATTCCTAAGAAGATCACTGGAATTATTACACAGGGTGCAAAGGACTTTGGAAGTATTCAGTATGTGGAGTCCTTCAAAGTGGCTTACAGCGACGATGGCAACACCTGGAAGATTTACAAAGATAGCAGGACAAAAGTAGATAAGATCTTCCTCGGAAACACTGACAACTACTCCCACAAAAAGAACCTCTTTGATGTGCCATTCTCCGCCCGTTTTGTGCGCGTGCTGCCACAGTCTTGGCACGAGCGTATCACACTACGAATGGAACTCTTGGGCTGTGATCATTAAAAAGTAGGCAAAGAGGTTGACTTCTGCAGTGTCCCCGAATCAAACTTTCTCTTATCATTGTCTCCTGTATTTGATACACCTGCTGACTACTAAAATGCCACTTAATTTTTACCTAAATCTGGGTTTCGGCGTGGGGGTGTCCTTTGCTGTCCTGTTGACCTGACCTGTAGTGGAGAAGTCATTTAGCCCTCAATAGAACAAAGTGTCTCAGCTGGAAAGGAGCCCCAAGCCAG
  5   1   2       bld Neu4                   IMAGE:3557693-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGACTGCACTTGAGAATAACCAGGAACAGTGGTTGCAGATTGACCTCCACATTCCTAAGAAGATCACTGGAATTATTACCCAGGGTGCAAAGGACTTTGGAAGTATTCAGTATGTGGAGTCCTTCAAAGTGGCTTACAGCGACGATGGCAACACCTGGAAGATTTACAAAGATAGCAGGACAAAAGTAGATAAGATCTTCCTCGGAAACACTGACAACTACTCCCACAAAAAGAACCTCTTTGATGTGCCATTCTCCGCCCGTTTTGTGCGCGTGCTGCCACAGTCTTGGCACGAGCGTATCACACTACGAATGGAACTCTTGGGCTGTGATCATTAAAAAGTAAGCAAAGAGGTTGACTTCTGCAGTGTCCCCGAATCAAACTTTCTCTTATCATTGTCTCCTGTATTTGATACACCTGCTGACTACT
  5   1   2       bld Tbd7                                 XL076l23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATAACCAGGNAACAGTGGTTGCAGNATTGACCTCCACATTCCTAAGAAGATCACTGGAATTATTACACAGGGTGCAAAGGACTTTGGAAGTATTCAGTATGTGGAGTCCTTCAAAGTGGCTTACAGCGACGATGGCAACACCTGGAAGATTTACAAAGATAGCAGGACAAAAGTAGATAAGATCTTCCTCGGAAACACTGACAACTACTCCCACAAAAAGAACCTCTTTGATGTGCCATTCTCCGCCCGTTTTGTGCGCGTGCTGCCACAGTCTTGGCACGAGCGTATCACACTACGAATGGAACTCTTGGGCTGTGATCATTAAAAAGTAGGCAAAGAGGTTGACTTCTGCAGTGTCCCCGAATCAAACTTTCTCTTATCATTGTCTCCTGTATTTGATACACCTGCTGACTACTAAAATGCCACTTAATTTTTACCTAAATCTGGGTTTCGGCGTGGGGGTGTCCTTTGCTGTCCTGTTGACCTGACCTGTAGTGGAGAAGTCATTTAGCCCTCAATAGAACAAAGTGTCTCAGCTGGAAAGGAGCCCCAA
  5   1   2       bld Brn1      in                    IMAGE:6950991.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGTATGGTGGAGTCCTTCAAAGTGGCTTACAGCGACGATGNGCAACACCTGGAAGATTTACAAAGATAGCAGGACAAAAGTAGATAAGATCTTCCTCGGAAACACTGACAACTACTCCCACAAAAAGAACCTCTTTGATGTGCCATTCTCCGCCCGTTTTGTGCGCGTTCTGCCACAGTCTTGGCACGAGCGTATCACACTACGAATGGAACTCTTGGGCTGTGATCATTAAAAAGTAGGCAAAGAGGTTGACTTCTGCAGTGTCCCCGAATCAAACTTTCTCTTATCATTGTCTCCTGTATTTGATACACCTGCTGACTACTAAAATGCCACTTAATTTTTACCTAAATCTGGGTTTCGGCGTGGGGGTGTCCTTTTCTGTCCTGTTGACCTGACCTGTAGTGGAGAGCCCTCAATAGAACAAAGTGTCTCAGCTGGAAAGGAGCCCCAAGCCAGAGTTGCTTCCTATCGATTGTTGTAGAGTAAAGACCCTTGCCTTAGTGGGGCCCTGTAGCCAAAATAATAGATTTTCTGTGTGTTTACATCAGGGGTGTCATTTTATGGCCCACTAGCCCACTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTTGTTGTAGTTGAACAACAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCCTTTTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTTCCTATACTACCGAATGTCCACAGATTTAGAACTGGTGTAACTGCCCTTAACAGAAAGGTAATG
  5   1   2       bld Brn1      in                    IMAGE:6949709.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGAATTCCCGGGATGAACTCNTTGGGCTGTGATCATTAAAAAGTAGGCAAAGAGGTTGACTTCTGCAGTGTCCCCGAATCAAACTTTCTCTTATCATTGTCTCCTGTATTTGATACACCTGCTGACTACTAAAATGCCACTTAATTTTTACCTAAATCTGGGTTTCGGCGTGGGGGTGTCCTTTTCTGTCCTGTTGACCTGACCTGTAGTGGAGAAGTCATTTAGCCCTCAATAGAACAAAGTGTCTCAGCTGGAAAGGAGCCCCAAGCCAGAGTTGCTTCCTATCGATTGTTGTAGAGTAAAGACCCTTGCCTTAGTGGGGCCCTGTAGCCAAAATAATAGATTTTCTGTGTGTTTACATCAGGGGTGTCATTTTATGGCCCACTAGCCCACTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTTGTTGTAGTTGAACAACAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCCTTTTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGGTAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCTGGAAGTAACTAAACCAGTATTCCACTCCACACCCTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTTCTTTGGGAACCAATTTATCCCCTATGCACATTGttttttttCTCCCTTACCCATT
  3   1   2       bld Brn1      in                    IMAGE:6956854.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGGGGCGGGTAAACCCATTTTTTCCCCCCCGGGAAAACCGCTTTGGCCCCTTTGGGCCTTATTTAGGTGGCCATTTTAGAAACAAGGTTGTTCAAAAAAAGCCAGGGCTGGACCCGTTCCGGAATTTCCGGGGATCAAAGGTTTTCAGCTGGAAAGGAGGCCCCAAGCCAGAGGTGCTTCCTATCGATTGTTGTAGAGTAAAGACCCTTGCNTAGTGGGGCCCTGTAGCCAAATTAATAGATTTCTGNGTGTTACATCAGGGGGTGTCATTTATGGGCCCACTAGCCCACTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTGTGTAGNNNTGACACNNAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATCCCTTTNTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGGTAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCTGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGATTGACAATTAATATTGTAACCATTGGGTATAATAAGCTTTCCTAGTTGTGTTTGTATTTTTTTGAATCAAGTTTAATGTTGTTTTTGTTAACTTGCACAATTGTTTTGGCTTATGATTTCTTTGGCTAAACTCCTGACGC
  3   1   2       bld Brn1      in                    IMAGE:6949709.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGAGGCCCAATTTAAGTGGTTCCCAAAAATCTTGGGTTTTAGGGGGGGGGGGGGGTCCTTTTTTCTTGCCCGGGTGACCCTGCCCTGTAGGTGGGGAAGTCATTTAGCCCTCCAATAGGACCAAAAGTGTCTCAGGGTGGAAAGGGAGCCCCCAAGCCGGAGTTGCTTTCCAATCGATGGTTGTAGAGTTAAAGACCCCTTGCCTTAGTGGGGCCCCTGTAGCCAAAAATAATAGATTTTCTGTGTGTTTACATCAGGGGTGTCATTTTATGGCCCACTAGCCCACTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTTGTTGTAGTTGAACAACAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCCTTTTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGGTAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCTGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGATTGACAATTAATATTGTAACCATTGGGTATAATAAGCTTTCCTAGTTGTGTTTGnTATTTTTTTGAATCAAGTTTAATGTTGTTTTTGTTAACTTGCACAATTGTTTTGGCG
  3   1   2       bld Brn1      in                    IMAGE:6950991.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATGCCACTTAAATTTTTACCTAAATCTGGGTTTCGGGCGTGGGGGTGTCCTTTTCTGTCCTGTTGACCTGACCTGTAGTGGAGAGCCCTCAATAGAACAAAGTGTCTCAGCTGGAAAGGAGCCCCAAGCCAGAGTTGCTTCCTATCGATTGTTGTAGAGTAAAGACCCTTGCCTTAGTGGGGCCCTGTAGCCAAAATAATAGATTTTCTGTGTGTTTACATCAGGGGTGTCATTTTATGGCCCACTAGCCCACTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTTGTTGTAGTTGAACAACAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCCTTTTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGGTAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCTGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGATTGACAATTAATATTGTAACCATTGGGTATAATAAGCTTTCCTAGTTGTGTTTGTATTTTTTTGAATCAAGTTTAATGTTGTTTTTGTTAACTTGCACAATTGATTTGGCA
  3   1   2       bld Emb9 5g3  in                    IMAGE:7976156.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAATTTTTACCTAAATTCTGGTTCGGCGTGAGGGTGTCTTGCTGTCTGTGACTGACTGTAGTGGAGAGTCATTTAGCCCTCAATAGAACAAAGTGTCTCAGCTGAAAGGAGCCCCAAGCCAGAGTTGCTTCCTATCGATGTTGTAGAGTAAAGACCCTTGCCTTAGTGGGGCCCTGTAGCCAAAATAATAGATTTTCTGTGTGTTTACATCAGGGGTGTCATTTTATGGCCCACTAGCCCACTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTTGTTGTAGTTGAACAACAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCTTATTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGATAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCTGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGATTGACAATTAATATTGTAACCATTGGGTATAATAAGCTTTCCTAGTTGTGTTTGTATTTTTTTGAATCAAGTTTAATGTTGTTTTTGTTAACTTGCACAAGCCAAAACAATTGTGCAAGTAACTAAAAACAACATT
  3   1   2       bld Ga12 5g3  in                         XL186c10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGTTGACCTGACCTGTAGTGGAGAAGTCATTTAGCCCTCAATAGAACAAAGTGTCTCAGCTGGAAAGGAGCCCCAAGCCAGAGTTGCTTCCTATCGATTGTTGTAGAGTAAAGACCCTTGCCTTAGTGGGGCCCTGTAGCCAAAATAATAGATTTTCTGTGTGTTAACATCAGGGGTGTCATTTTATGGCCCACTAGCCCACTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTTGTTGTAGTTGAACAACAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCTTATTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGATAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCTGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGAT
  5   1   2       bld Brn1      in                    IMAGE:6956854.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGGATCAAAGTGTCTCAGCTGGAAAGGAGCCCCAAGCCAGAGTTGCTTCCTATCGATTGTTGTAGAGTAAAGACCCTTGCCTTAGTGGGGCCCTGTAGCCAAAATAATAGATTTTCTGTGTGTTTACATCAGGGGTGTCATTTTATGGCCCACTAGCCCACTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTTGTTGTAGTTGAACAACAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCCTTTTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGGTAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCTGAAGGTAACTAAAACAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGttttttttCTCCCCTAACCAATTTCAGTATTTTAAAAGATTGAACAATTTAAAATTGTAAACCAATTGGGGTAAAAATAAACCCTTTCCCAAAGTGGGGGTTTGGAAttttttttGAAAACAAAGTTTAAAAGGTGGGTTTTTTGGGTAAACCTGGCACAAAATGTGGTTTTGGCTTTTAAGAAGGGTTCCCTTTTGGGCCTATAAAAATATTAAAGGTATTGGCCCCCANAAAAAAGACGCAACTAAAAAAAAATAAAggggggggggccccccctctagaaaaaattcccccccggagggggccccaaaaattttacaccgcttaaccccggctttttttttGTGAAAA
  3   1   2       bld FaBN 5g3  in                    IMAGE:8075925.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCCCAAGCCAGAGTTGCTTCCTATCGATTGTTGTAGAGTAAAGACCCTGCCCCTAGTGGGGCCCTGTAGCCAAAATAATAGATTTTCTGTGTGTTANCATCAGGGGGGTCATTTTATGGCCCACTAGCCCACTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTTGTTGTAGTTGAACAACAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCTTATTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGGTAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCCGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTATTCATGCACATACCTTTTCCTTTTTTGTGATCCATTTTATCCCTATGCACATTTGTTTTTTTTTCCCTTACCAATTTCAGTATTTTAAAGATTGACAATTAATTATTGTAATCCATTGGGTATAATAAGCTTTTTCTAGTTGTGTTTGTATTTTTTTACATCACGTTTAATGTTGTGCTCGAAGACCGCACCAAGCGCAAAAGCANNGGGANGNNATACGTGTATGTATTTCGAATTT
  3   1   2       bld FaBN 5g3  in                    IMAGE:8075836.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGTGNAAGAGCCCAGCCAAGTGCTCTATCGATGTGTAGGTAAGACCTTGCCTAGTGGGCCCTGAGCCAAATAATAGATTTCTGTGTGTTACATCAGGGGTGTCATTTTATGGCCCACTAGCCCACTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTTGTTGTAGTTGAACAACAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCTTATTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGGTAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCCGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGATTGACAATTAATATTGTAACCATTGGGTATAATAAGCTTTCCTAGTTGTGTTTGTATTTTTTGAATCAAGTTTAATGTTGTTTTTGTTAACCGCACAATCTTTGCAATGACACTACAGTCACGTCTCATGG
  3   1   2       bld Te2       in                    IMAGE:7390460.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTTCCTATCGATTGTTGTAGAGTAAAGACCCTTGCNTTAGTGGGGCCCTGTAGCCAAAATAATAGATTTTCTGTGTGTTTACATCAGGGGTGTCATTTTATGGCCCACTAGCCCACTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTTGTTGTAGTTGAACAACAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCTTATTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGATAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCTGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGATTGACAATTAATATTGTAACCATTGGGTATAATAAGCTTTCCTAGTTGTGTTTGTATTTTTTTGAATCAAGTTTAATGTTGTTTTTGTAACTTGCACAATTGTTTGGCTTAGAGTCCATGGCAAAATAACAAACC
  3   1   2       bld Em10      in                    IMAGE:7980383.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGTGGGGCCCTGTAGCCAAAATAATAGATTTTCTGTGTGTTTACATCAGGGGTGTCATTTTATGGCCCACTAGCCCACTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTTGTTGTAGTTGAACAACAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCTTATTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGATAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCTGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGATTGACAATTAATATTGTAACCATTGGGTATAATAAGCTTTCCTAGTTGTGTTTGTATTTTTTTGAATCAAGTTTAATGTTGTTTTTGTTAACTTGCACAATTGTTTTGGCTTATGATGTGCTTGGCTCTCAATAACTA
  5   1   2       chi Lens                                Lens-N040.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACGCGTNNNGGTTTATGGCCCACTATTCCCANCTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTTGTTGTAGTTGAACAACAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCCTTTTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGGTAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCTGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACAAGAGATTATTATTACAAGTATGGGATCTATTTTCCAAAATGCGCAAGACCTGGAGTTTTGTGGATAAAGGATCTTTCCATAGCAAAAAATAATTTATCTCCATATATTGTCTACTAAAAATAATTTAAATATGAATTAAACTCAGTAGGTTGGTTTTAGgattaattatatcttagtttggatcaagtacaaggtactgttttattattacagagaaaaaggaaatcacttttaaaaatggaaattacttgattaaaatggagtatatgggagatAGCCTTCCAGTAGTTTGGAGCTTCATTCTGGATAATGGGTTTCCAGATGAGGAATCCCATACCTGTATTATTAATAACACATAATTATAAAATGCCATTATATCCTGCCATAAAAAGTTTTATCCATAAAGCATANAAACATACATACAAATATNCATTGGCCAGGAGGACCTGCTCAGGGCGAGGNTAGGGTAAAAAGATGTCAGTTTATTTCTGNTACATTCAGTTTTTATATAAATTATTTTATTCATTCGAAGGAGATAGTAGAAGTGCTCTCTAATATATCACTGTTTGCTCAGAAGTGGTGCGCATGGTTCCACATGGAAGATGAAAAGCAGGCTAGCGCCTCAGTGATCACAGGCAGAAAAATGGGTTATGGAGAATAAAATGCCATCCTTGGGCATAGGATAGTGCCCTAAGACAACCCTAGGCCTGAAAGGGATTTATTCACAAAAATACTAACCaaaaaaaaaGGGCCCTAAGGACAATAAAACGGGGAAGAAATTTTAAGCCAAATAATCGGCGGTTACCGAGGAACGGGGTCCTTATCTGACCCCTT
  3   1   2       bld Neu7                                 XL035n20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCACTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTTGTTGTAGTTGAACAACAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCTTATTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGATAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCTGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGTTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGATTGACAATTAATATTGTAACCATTGGGTATAATAAGCTTTCCTAGTTGTGTTTGTATTTTTTTGAATCAAGTTTAATGTTGTTTTTGTTAACTTGCACAATTGTTT
  3   1   2       bld Tbd7      in                         XL090g17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTTTTTGAACTACAACATCTAGCATTTACAACAGCAGGCTCTGTTGGACAGTGCTTGTTGTAGTTGAACAACAGCTGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCTTATTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGGTAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCCGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACNTTGTTTTTTTCTACCCTNNCCAATTCAGTATTTTAGANGNTTGACNNTNAATATTGNNANCANTGGAGTATAANAAGCTTT
  3   1   2       bld Tbd7      in                         XL083p21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCTTATTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGGTAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCCGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGATTGACAATTAATATTGTAACCATTGGGTATAATAAGCTTTCCTAGTTGTGTTTGTATTTTTTTGAATCAAGTTTAATGTTGTTTTTGTTAACTTGCACAAT
  3   1   2       bld Tbd7      in                         XL098h20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGGACAAATATTGCCCATCACTGATTTTCCTTTTATTCTTATTTGATGGCCATCCAGAAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGGTAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCCGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGATTGACAATTAATATTGTAACCATTGGGTATAATAAGCTTTCCTAGTTGTGTTTGTATTTTTTTAATCAAGTTTAATGTGTTTTTGTAACTGCACAAT
  3   1   2       bld Tbd7      in                         XL080f23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGCCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGATAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCTGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGTTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGATTGACAATTAATATTGTAACCATTGGGTATAATAAGCTTTCCTAGTTGTGTTTGTATTTTTTTGAATCAAGTTTAATGTTGTTTTTGTTAACTGCACAATGTTT
  3   1   2       bld Neu7 5g3  in                         XL016n12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAATTCCATACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGGTAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCCGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGATTGACAATTAATATTGTAACCATTGGGTATAATAAGCTTTCCTAGTTGTGTTTGTATTTTTTTGAATCAAGTTTAATGTTGTTTTTGTTAACTGCACAATTGTTT
  3   1   2       bld Neu7 5g3  in                         XL024j10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTGGTATTAGAATGTCCTTGTGTAATTATGGGGCTCCAACCTTGAATTATTGCCCAGGGCCCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGGTAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTAAATGCTACCTGCTGATTCCCGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATTGTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGATTGACAATTAATATTGTAACCATTGGGTATAATAAGCTTTCCTAGTTGTGTTTGTATTTTTTTGAATCAAGTTTAATGTTGTTTTTGTTAACTTGCACAATTGTT
  3   1   2       bld Neu4      in                    IMAGE:3557693.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCTTCCTATCGATTGTTGTAGAGTAAAGACCCTTTTTCCCTAACTGTTGCCCTGCTTCCTATACTACCGATGTCCACAGATTAGAACTGTGTAACTGCCTTAACAGAAGATAATGTAATAAATGGTGCAAAGCTTGCTCTGGTCTGGTTAACCACAGCAACCAGTATATGCTACCTGCTGATTCCTGAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCCTAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGAACCAATTTATCCCTATGCACATGTTTTTTTCTCCCTTACCAATTCAGTATTTTAAAGATTGACAATTAATATTGTAACCATTGGGTATAATAAGCTTTCCTAGTTGTGTTTGTATTTTTTGAATCAAGTTTAATGTTGTTTTTGTTAACTTGCACAATTGTTTTGGCTTATGATGTTNTTTGTGCTATAAATATAAAGTAATGNCCAAA
  3   1   2       bld Ga12                                 XL189d11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGGTAACTAAACCAGTATCACACTCCACACCTTTTATCTCATCACCCATAATCACATGTACTCATGCACATACCTTTTCCTCTTTGTGATCCATTTTATCCCTATGCACATNGTTTTTTTCTCCCTNNCCAATTCAGTAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)