Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-Lens-N007.5                          21 END     1           4        4                hypothetical protein LOC398539 [Xenopus laevis]
     2   2.0    0Xl3.1-xlk114e17ex.3                        18 END     10         40       55                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012770564 Xl3.1-IMAGE:6317732.5 - 25 ESTs
                                                                       .........-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6317732.5                                                                                                                                                                                                                                                GGGGAGGAGAGAGCCACTGACTTGACCGCTGACCACTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGAAAAAAAAAAGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTATTTTTTTTACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGTGTTGCTCCGGGATCTGTGGCGCCATCCAGTGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTGCCTCGGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGGTGTGGGGACAACCTACATTACGGCCTTAACATGGGCTCTGCTTTTGTTGACGCTCCAATGAAGTCAAGCAAGTCTGCTGGGACCCAGGCCACTAAAATTATGAATCTACACAACAATGCAGTTGGCAGACAGGTACTGATGGACTCTTTGGAGACAAAATGCAAGTGCCACGGAGTGTCTGGATCTTGCTCCGTGAAGACCTGTTGGAAGGGCCTGCAGGATCTTCCCCATATTGCTAATGAGCTTAAATCCAAATACCTTGGTGCCACTAAAGTCATCCACAGACAGACCGGCACTCGGAGGCAGCTTGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCACAAAGAATCCC
                                                  Xl3.1-CHK-1012688814                                                                                                                                                                                                                                                      AxxAxAGCCACTGACTTGACCGCTGACCACTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGAAAAAAAAAAGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTATTTTTTTTACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGTGTTGCTCCGGGATCTGTGGCGCCATCCAGTGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTGCCTCGGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGGTGTGGGGACAACCTACATTACGGCCTTAACATGGGCTCTGCTTTTGTTGACGCTCCAATGAAGTCAAGCAAGTCTGCTGGGACCCAGGCCACTAAAATTATGAATCTACACAACAATGCAGTTGGCAGACAGGTACTGATGGACTCTTTGGAGACAAAATGCAAGTGCCACGGAGTGTCTGGATCTTGCTCCGTGAAGACCTGTTGGAAGGGCCTGCAGGATCTTCCCCATATTGCTAATGAGCTTAAATCCAAATACCTTGGTGCCACTAAAGTCATCCACAGACAGACCGGCACTCGGAGGCAGCTTGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCACAAAGAATCCCAAGTTT
                                                      consensus depths                                                                                                                                                                                                                                                     2     6     8    15     8    15     8    15     8    15     9    16     9    16     9    16    10    17     9    17     9    17     9    17     9    17     9    17     9    17     9    17    12    16    16    16    16    16    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    16    18    18    18    18    18    17    19    17    19    18    18    18    18    19    19    18    19    19    19    19    20    20    21    18    21    20    21    21    22    21    22    20    21    19    20    19    20    19    20    16    18    15    18    15    18    15    18    15    18    13    16    13    16    13    16    11    15    12    15    13    15    12    15    11    15     9    15    10    15    10    15     8    15    10    15    10    14     9    14     8    12     8    12     8    12     8    11     8    10     8     9     8     9     7     8     7     8     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     5     4     5     4     5     4     5     5     5     3     3
                                               BLH ATG     294     883                                                                                                                                                                                                                                                
                                               BLH MIN     294     134                                                                                                                                                                                                                                                
                                               BLH MPR     111     134                                                                                                                                                                                                                                                
                                               BLH OVR     294     100                                                                                                                                                                                                                                                
                                               CDS MIN     294     134                                                                                                                                                                                                                                                
                                               EST CLI       5      36                                                                                                                                                                                                                                                
                                               ORF LNG     294       4                                                                                                                                                                                                                                                
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 2e-036     NP_476810.1 Wnt oncogene analog 2 CG1916-PA [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 1e-043     NP_001022247.1 C. elegans WNT family member (cwn-1) [Caenorhabditis elegans] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ag ---- 1e-045     XP_557821.3 AGAP008678-PA [Anopheles gambiae str. PEST] ---------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ci ---- 2e-046     NP_001027951.1 Wnt signaling ligand [Ciona intestinalis] -----------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Sp ---- 4e-047     XP_001176135.1 PREDICTED: similar to cell signaling molecule Wnt-5 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Bt ---- 5e-098     NP_001075925.1 wingless-type MMTV integration site family, member 11 [Bos taurus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Cf ---- 9e-099     XP_542301.2 PREDICTED: similar to wingless-type MMTV integration site family, member 11 precursor [Canis familiaris] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Hs ---- 2e-099     NP_004617.2 wingless-type MMTV integration site family, member 11 precursor [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Mm ---- 2e-100     NP_033545.1 wingless-related MMTV integration site 11 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Gg ---- 2e-104     NP_990115.1 Wnt-11 protein [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- ?? ---- 5e-106     NP_001124216.1 wingless-type MMTV integration site family, member 11b [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dr ---- 6e-116     NP_571031.2 wingless-type MMTV integration site family, member 11 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 2e-160     CAJ82831.1 wingless-type MMTV integration site family, member 11 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 2e-170     NP_001084327.1 maternal protein [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6317732.5                                                                                                                                                                                                                                                                                                                  TAG------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------ATG------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
  3   1   2       bld Gas8      out                   IMAGE:3516885.3p AAAGAATGATAAAATGAAGACAAATGAAAGAAAGGGAAAAGATCACAATGACTCCAGTAAGGAAAGTAAGGAGAAAAACCATGAGAAGAGACAGAATAACAAGAATGGATGGCTAAAGGACTCATCTGAAGAAAACGACAGTGCATCCAAAGAAAAGAAGGATCATGACAAGAACATCAAAGTAAGGACAAATCAAAACAAGGGCAATGATCACGATCACTCCAGCAAAGAATGCGGAGGAGGAGAGAAAAGCCACTGACTTGACCGCTGACCACTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGAAAAAAAAAAAAAA
  5   1   2       bld Egg3 5x                         IMAGE:6870301.5p                                                                                                                                                                        GATTCCCCGGGCCAGTGACGTCAGCTGCGGGTTTAAATGGCAGCGGCAGCGAGAACAAGGGCAGAATGCGGAGGAGGAGAGAAAAGCCACTGACTTGACCGCTGACCACTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGaaaaaaaaaGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGTGTTGCTCCGGGATCTGTGGCGCCATCCAGTGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTGCCTCGGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCACCTGAAGGTGCCCGGAACAAGCTTCCNAATTGGGGAAGGGTGTGGGGAACAACCCTACATTTACGGGGCTTTAACATGGGGCCTCTGGCTTTTTGTGGGACGGCCTCCCAGGAAAGGTCCAACGCAA
  5   1   2       bld Egg3 5x                         IMAGE:6325143.5p                                                                                                                                                                                                                                        GATTCCCGGGGGAGGAGAGAAAGCCCTGACTTGACCGCTGACCACTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGaaaaaaaaaGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGTGTTGCTCCGGGATCTGTGGCGCCATCCAGTGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCNAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTGCCTCGGGGGAGCTGCCCACATGGCTTTTGTGGTGCCACCCCAGCTGAGGTGCCCCGGAACAGGGCTTCCNATGGGGNAGGGGTGTTGGGGGAACAACCTACAATTACGGGCCTTTAAACATGGGGGCTCNTGCCTTTTTTGGTTGGACCGCCTCCCAAATGGAAGTTCCAAGGCAAAGGTCTGGCCTGGGGGGACCCCAAGGGCCCCACTTTAAAAATTTTATTGGAAATCCTTTACCCCCCAAACCAAATGGCCAGTTTTTGTGGCCAAAAAAACCGGGGGTACACTT
  5   1   2       bld Em10 5g3  out                   IMAGE:7981162.5p                                                                                                                                                                                                                                        ATCCCGGGATGGAGAGAAAAGCCACTGACTTGACCGCTGACCACTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGaaaaaaaaaaGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGTGTTGCTCCGGGATCTGTGGCGCCATCCAGTGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTTGAGCAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACATTGCGCGGGCTGTGCTCGGGGGACTGCCACTGCTCTGTGTGCACCCAGCTAGTGCCGGAACAGCTCGATGGAGGTGTGGACACTACTACGCTTACTGGTCGCTTGTGCCTCATGATCAGCAGTGCGGACAGCACAATTGACCCAATGATGGCAG
  5   1   2       bld Tbd7 5g3  out                        XL069i12.5p                                                                                                                                                                                                                                          TGCAGGNAATTCTGCACGAGGGCCCTGACTTGACCGCTGACCCTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGaaaaaaaaaaGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGTGTTGCTCCGGGATCTGNGGCGCCATCCAGNGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTNTGCAAGAGGAATCTTGAACTGATGCAAAGNGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTAC
  5   1   2       bld Egg3 5g                         IMAGE:6871246.5p                                                                                                                                                                                                                                           TCCCGGGGGAGGAGAGAAATCCACTGACTTGACCGCTGACCCTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGaaaaaaaaaGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGTGTTGCTCCGGGATCTGTGGCGCCATCCAGTGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTGCCTCGGGGGAGCTGCCCACATGCTTTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGAGGGGGAGGGTGTGGGGACAACCTACATTACGGGCTTTACATGGGCTCTCGCTTTGGTGACGGCTCAATGAAGTCAAGCAAGTCTGCTGGGGACCCCAGGCCACTAAATTATGGAATCTACACAACAATGGCAGTTGGCCAG
  5   1   2       bld Ga15 5g                            XL474p19ex.5p                                                                                                                                                                                                                                                   GAGAGAAAAGCCACTGACTTGACCGCTGACCACTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGaaaaaaaaaaGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGNGTTGCTCCGGGATCTGTGGCGCCATCCAGNGGCTTGGGCTCACCGTAAATGGCAGCCGGGNGGCCTGGAATGANAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAANAGGAATCTTGAACTGATGCAAAGNGTCGTTAATGCTGCCAAACANACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCT
  5   1   2       bld Ga18 5g                           xlk157l13ex.5p                                                                                                                                                                                                                                                     AGAAAAGCCACTGACTTGACCGCTGACCACTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGaaaaaaaaaaaGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGTGTTGCTCCGGGATCTGTGGCGCCATCCAGTGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGNCTGGAATGAGAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGNCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTNCCTCGGGGGAGCTGCCCACATGCTCTTGTGGNGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGGTGTGGGGNNAACCTACATTACGGCCTTAACATGGGCTCNNNTTTTGTTGACGCTCCAATGAAGTCAAGCAAGNCTGCTGGGACCAGGCCACTAAAATTATGAATCTNCNCNANNATGCAGTTGGCAG
  5   1   2       bld DMZ  5g                              xl299j23.5p                                                                                                                                                                                                                                                     GAGAAAAGCCACTGACTTGACCGCTGACCACTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGaaaaaaaaaaGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCNACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGNGTTGCTCCGGGATCTGTGGCGCCNTCCAGTGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGC
  5   1   2       bld DMZ  5g3  out                        xl331b02.5p                                                                                                                                                                                                                                                     GAGAAAAGCCACTGACTTGACCGCTGACCACTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGaaaaaaaaaaGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCNACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGTGTTGCTCCGGGATCTGTGGCGCCNTCCAGTGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGANAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATACTCTGGCCTCTGCCACTCTCAGCCATACCATT
  5   1   2       bld DMZ  5g                              xl328f03.5p                                                                                                                                                                                                                                                     GAGAAAAGCCACTGACTTGACCGCTGACCACTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGaaaaaaaaaaGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCNACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGTGTTGCTCCGGGATCTGTGGCGCCATCCAGTGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTGCCTCGGGGGAGCTGCCCACAT
  5   1   2       bld Emb1 5g3  out                   IMAGE:3401371.5p                                                                                                                                                                                                                                                       GAGAAAAGCCACTGACTTGACCGCTGACCACTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGaaaaaaaaGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGTGTTGCTCCGGGATCTGTGGCGCCATCCAGTGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGCT
  5   1   2       bld Emb1 5g                         IMAGE:6862720.5p                                                                                                                                                                                                                                                        GACAAGCCACTGACTTGACCGCTGACCACTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGaaaaaaaaaGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGTGTTGCTCCGGGATCTGTGGCGCCATCCAGTGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTGCCTCGGGGGAGCTGCCCACATGCTCTTGTGGTGCCCACCCAGCTGAGGTGCCCGGAAAAAGCTTTCCGATGGGGGAGGGTGTGGGGGACAAACCTACAATTACGGGCCTTTAACATGGGGCTCCTGGCTTTTTGTTTGACCGCTCCAAATGGAAATTCAAGCAAGGTCTTGGCCTGGGGACCCCAGGCCCCACCTTAAAATATTATGGAATCCCTCACCACAT
  5   1   2       bld Ov1  5g                         IMAGE:6317732.5p                                                                                                                                                                                                                                                         AAAGCCACTGACTTGACCGCTGACCACTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGaaaaaaaaaaGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGTGTTGCTCCGGGATCTGTGGCGCCATCCAGTGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTGCCTCGGGGGAGCTGCCCCCATGCTCTTGGGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGAtggggagggggtgggggACAACCTACATTACGGCCTTAACTGGGGCTCTGGCTTTTGTTGACGCCTCCATGAAGTCAAGGAAGTCTGCTGGGGAAC
  5   1   2       bld Ga12 5g3  out                        XL219n02.5p                                                                                                                                                                                                                                                            GAGGCTGACTTGACCGCTGACCACTGGCTGATCACTGACTGCCATCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGaaaaaaaaaaGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGNGTTGCTCCGGGATCTGNGGCGCCATCCAGNGGCTTGGGCTCACCGNAAATGGCAGCCGGGNGGCCTGGAATGANAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTC
  5   1   2       bld Neu7 5g3  out                        XL010a22.5p                                                                                                                                                                                                                                                                                                  GCTGCCTCTGCTGCACTAGCACCTCACACAGGACACTACATATACCGATCTCTGCCACCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGaaaaaaaaaaGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGTGTTGCTCCGGGATCTGTGGCGCCATCCAGNGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACAATGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTNTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAG
  5   1   2       bld Neu7 5g                              XL004d01.5p                                                                                                                                                                                                                                                                                                                                     CTACATATACCGATCTCTGCCCCAGTTCACTCGTCTAATCACAGGAATCTCTTTCGATCACATCGCACGACTTTTTACACTGCAGAGATCGCGATTACCATTTTAGGAGGaaaaaaaaaaaGGAAAACCCATCACAGGAATCCCGCACATCCCGAACCTTCACTTNTTAttttttttACACCGGACCCTTTTACCCCTNACCAGTNCCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTNTTGNGTTGCTCCGGGATCTGNGGCGCCATCCAGNGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTNTGCAAGAGGAATCTTGAACTGATGCAAAGGGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATNTGACATGCGCTGGAACTGC
  5   1   2       bld DMZ  5g3  out                        xl237a09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGTGTTGCTCCGGGATCTGTGGCGCCATCCAGTGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTGCCTCGGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGGTGTGGGGACAACCTACATTACGGCCTTAACATGGGCTCTGCTTTTGTTGACGCTCCAATGAAGTCAAGCAAGTCTGCTGGGACCCAGGCCACTAAAATTATGAATCTACACAACAATGCAGTTGGCAGACAGGTACTGATGGACTCTTTGGAGACAAAATGCAAGTGCC
  5   1   2      seed DMZ  5g3  out                        xl330b19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGAATCCCGCACATCCCGAACCTTCACTTCTTAttttttttACACCGGACCCTTTTACCCCTCACCAGTACCAATGGCTCCGACCCGTCACTGGGTTACCCCCCTGCTCCTCTTGTGTTGCTCCGGGATCTGTGGCGCCATCCAGTGGCTTGGGCTCACCGTAAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTGCCTCGGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGGTGTGGGGACAACCTACATTACGGCCTTAACATGGGCTCTGCTTTTGTTGACGCTCCAATGAAGTCAAGCAAGTCTGCTGGGACCCAGGCCACTAAAATTATGAATCTACACAACAATGCAGTTGGCAGACAGGTACTGATGGACTCTTTGGAGACAAAATGCAAGTGCCACGGAGTGTCTGGATCTTGCTCCG
  5   1   2       bld Oo1                    IMAGE:6637534-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTAACCCCGGGGGTCCCGGGGAAATTCCCGGGGATGCTTGCTGGACGGTCTAGTCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTGCCTCGGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGGTGTGGGGACAACCTACATTACGGCCTTAACATGGGCTCTGCTTTTGTTGACGCTCCAATGAAGTCAAGCAAGTCTGCTGGGACCCAGGCCACTAAAATTATGAATCTACACAACAATGCAGTTGGCAGACAGGTACTGATGGACTCTTTGGAGACAAAATGCAAGTGCCACGGAGTGTCTGGATCTTGCTCCGTGAAGACCTGTTGGAAGGGCCTGCAGGATCTTCCCCATATTGCTAATGAGCTTAAATCCAAATACCTTGGTGCCACTAAAGTCATCCACAGACAGACCGGCACTCGGAGGCAGCTTGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCACAAAGAATCC
  5   1   2       bld Ov1                             IMAGE:8330071.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCCTGACCAGTCGCAACTCTGCAAGAGGAATCTTGAACTGATGCAAAGTGTCGTTAATGCTGCCGAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTGCCTCGGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGGTGTGGGGACAACCTACATTACGGCCTTAACATGGGCTCTGCTTTTGTTGACGCTCCAATGAAGTCAAGCAAGTCTGCTGGGACCCAGGCCACTAAAATTATGAATCTACACAACAATGCAGTTGGCAGACAGGTACTGATGGACTCTTTGGAGACAAAATGCAAGTGCCACGGAGTGTCTGGATCTTGCTCCGTGAAGACCTGTTGGAAGGGCCTGCACGATCTTCCCCATATTGCTAATGAGCTTAAATCCAAATACCTTGGTGCCACTAAAGTCATCCACAGACAGACCGGCACTCGGAGGCAGCTTGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCACAAAGAATCGCAAGTTGGGTT
  5   1   2       bld Emb9                            IMAGE:7977018.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTGAACTGATGCAAAGTGTCGTTAATGCTGCCAAACAGACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTGCCTCGGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGGTGTGGGGACAACCTACATTACGGCCTTAACATGGGCTCTGCTTTTGTTGACGCTCCAATGAAGTCAAGCAAGTCTGCTGGGACCCAGGCCACTAAAATTATGAATCTACACAACAATGCAGTTGGCAGACAGGTACTGATGGACTCTTTGGAGACAAAATGCAAGTGCCACGGAGTGTCTGGATCTTGCTCCGTGAAGACCTGTTGGAAGGGCCTGCAGGATCTTCCCCATATTGCTAATGAGCTTAAATCCAAATACCTTGGTGCCACTAAAGTCATCCACAGACAGACCGGCACTCGGAGGCAGCTTGTTCCCAGGGAGCTAGACATCTGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTTCCCCTGACTACTGCACAAAGAATCCCAAGTTTGGGTTCATATGGGACACAAGACAGGCTGTGCAACAAGACCTCCGTTTGGTAGTGACAGCTGCAAACCTCATGTGCCTGTGGGGCGGGGATACAACCGCCTACACCCGATCCA
  5   1   2       bld Tbd7      out                        XL074k18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAAGTGTCGTTAATGCTGCCAAACAGNACCAAGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTGCCTCGGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGGTGTGGGGACAACCTACATTACGGCCTTAACATGGGCTCTGCTTTTGTTGACGCTCCAATGAAGTCAAGCAAGTCTGCTGGGACCCAGGCCACTAAAATTATGAATCTACACAACAATGCAGTTGGCAGACAGGTACTGATGGACTCTTTGGAGACAAAATGCAAGTGCCACGGAGTGTCTGGATCTTGCTCCGTGAAGACCTGTTGGAAGGGCCTGCAGGATCTTCCCCATATTGCTAATGAGCTTAAATCCAAATACCTTGGTGCCACTAAAGTCATCCACAGACAGACCGGCACTCGGAGGCAGCTTGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCACAAAG
  5   1   2       bld Tbd7                                 XL078n12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCTAACCTGCCAAATGACCTTATCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTGCCTCGGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGGTGTGGGGACAACCTACATTACGGCCTTAACATGGGCTCTGCTTTTGTTGACGCTCCAATGAAGTCAAGCAAGTCTGCTGGGACCCAGGCCACTAAAATTATGAATCTACACAACAATGCAGTTGGCAGACAGGTACTGATGGACTCTTTGGAGACAAAATGCAAGTGCCACGGAGTGTCTGGATCTTGCTCCGTGAAGACCTGTTGGAAGGGCCTGCAGGATCTTCCCCATATTGCTAATGAGCTTAAATCCAAATACCTTGGTGCCACTAAAGTCATCCACAGACAGACCGGCACTCGGAGGCAGCTTGTTCCCAGGGAGCTAGAC
  5   1   2       bld DMZ       out                        xl235c09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCTTCAGTAGAGAATGCACCAAGCTTCACCCCTGACTTGAGCAAAGGTACCAGGGAGTCTGCCTTTGTCTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCGCGTGCCTGTGCCTCGGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGGTGTGGGGACAACCTACATTACGGCCTTAACATGGGCTCTGCTTTTGTTGACGCTCCAATGAAGTCAAGCAAGTCTGCTGGGACCCAGGCCACTAAAATTATGAATCTACACAACAATGCAGTTGGCAGACAGGTACTGATGGACTCTTTGGAGACAAAATGCAAGTGCCACGGAGTGTCTGGATCTTGCTCCGTGAAGACCTGTTGGAAGGGCCTGCAGGATCTTCCCCATATTGCTAATGAGCTTAAATCCAAATACCTTGGTGCCACTAAAGTCATCCACAGACAGACCGGCACTCGGAGGCAGCTTGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCACAAAGAATCCCAAGTTGGGTTCATATGGGACACAGGACAGGCTGTGCAACAAGACCTCCGTTGGTAGTGACAGCTGCAACCTCATGTGCTGTGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)