Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6932587.5                       9 PI      80        388     1163                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012770568 Xl3.1-IMAGE:8078174.5 - 26 ESTs
                                                                       -140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8078174.5                                                                                                                                             CTGGAACAAAGTTTGCTGAGCTGTAGGGCTTTACCCCCTCTTAAATGGGTTAAAACCAGTAGTTTGATCAATTAGTTTGAAATTTTGGAGAAGGCTGGTGTCGGTTATTAGAGGGGGAGGGAAAGGATGGTGCATGTGGCAAAATTACTTTCACTTTCTCTATGAGAGGAGAGGCAGACGAGAAAGGGACAGTGAGACTAAGGATTAACATAAGGAACAAAAACGCTGAAACATGTAAAGAAGTGTGGAAGAGGTATCTGTACATAGACAGCAACTATATTTGACACAACTAAATTTACAGCAGTTAAAGAATCCAAAGATCTGTGGGGAGAAAGACCAAAGCACTGCAGATACTGGCAAGTAAATATATATCCTGGTTAAACAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGTCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTACAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAATAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCTGCAGATTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTCGGCAGTATGATCTGTGGTTGGGATAAGAAGGGGCCTGGTCTATATTATGTGGATGACAATGGTACGAGGTTATGTGGTGACATCTTCTCTACGGGATCAGGAAATTCATATGCCTATGGTGTGATGGACAGTGGCTATCGTTTTGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGTAGAGCAATTAGCTATGCCACACACCGTGATGCCTACTCAGGAGGATGTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTGAAGATTGGACAGTTTGATGTGAGCGACTTACTGCACAAATTTAATGAGGAGAAGAACATGTGACTTAGAGGAAGCAGTGGAAGTTTCAATTAACTCCCAGCCTTTTGCATAATTCCTTCTGTGTGGTTTTGTCCTAAACCCATATTATATCCATTTCACACATGTTAAAACCAAATCAGGTATTTGGAAATTATTCGGAATAAAAATGGATTATTC
                                                  Xl3.1-CHK-1012688673                                                                                                                                                   CAAAGTTTGCTGAGCTGTAGGGCTTTACCCCCTCTTAAATGGGTTAAAACCAGTAGTTTGATCAATTAGTTTGAAATTTTGGAGAAGGCTGGTGTCGGTTATTAGAGGGGGAGGGAAAGGATGGTGCATGTGGCAAAATTACTTTCACTTTCTCTATGAGAGGAGAGGCAGACGAGAAAGGGACAGTGAGACTAAGGATTAACATAAGGAACAAAAACGCTGAAACATGTAAAGAAGTGTGGAAGAGGTATCTGTACATAGACAGCAACTATATTTGACACAACTAAATTTACAGCAGTTAAAGAATCCAAAGATCTGTGGGGAGAAAGACCAAAGCACTGCAGATACTGGCAAGTAAATATATATCCTGGTTAAACAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGTCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTACAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAATAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCTGCAGATTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTCGGCAGTATGATCTGTGGTTGGGATAAGAAGGGGCCTGGTCTATATTATGTGGATGACAATGGTACGAGGTTATGTGGTGACATCTTCTCTACGGGATCAGGAAATTCATATGCCTATGGTGTGATGGACAGTGGCTATCGTTTTGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGTAGAGCAATTAGCTATGCCACACACCGTGATGCCTACTCAGGAGGATGTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTGAAGATTGGACAGTTTGATGTGAGCGACTTACTGCACAAATTTAATGAGGAGAAGAACATGTGACTCAGAGGAAGCAGTGGAAGTTTCAATTAACTCCCAGCCTTTTGCATAATTCCTTCTGTGTGGTTTTGTCCTAAACCCATATTATATCCATTTCACACATGTTAAAACCAAATCAGGTATTTGGAAATTATTCGGAATAAAAATGGATTATTCAAAAAA
                                                      consensus depths                                                                                                                                                  2     4     2     4     2     4     2     4     3     4     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     3     5     4     7     7     9     7    11     8    11     9    12     9    12     9    12     8    12     9    13     9    13    12    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    15    15    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    19    18    19    17    19    17    19    20    22    21    23    20    23    20    23    20    23    20    23    20    23    20    23    21    24    22    25    22    24    22    24    21    24    20    24    21    24    21    23    21    22    21    22    21    22    20    21    20    21    20    21    20    21    20    21    19    20    19    20    12    20    17    19    17    19    14    19    16    19    14    18    14    17    14    16    13    16    13    15    13    15    13    15    13    15    12    15    11    15    11    14    11    13    11    13    11    13    11    13    11    13    10    12    10    12    10    11    10    11    10    11    10    11     9    10     8     9     8     9     8     8     8     8     8     8     8     8     8     8     8     8     7     8     3     5     3     3     3     3     3     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGAGCAGCATT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T-------
                                               BLH ATG     387    1193                                                                                                                                             
                                               BLH MIN     387     134                                                                                                                                             
                                               BLH MPR     372     134                                                                                                                                             
                                               BLH OVR     387    1466                                                                                                                                             
                                               CDS MIN     387     134                                                                                                                                             
                                               ORF LNG     387      56                                                                                                                                             
  5   1   2       bld Int2 5g                         IMAGE:8528769.5p TGCGTGCCATCTTTTATGTCCCTCTTTTTGTTTAAAAATGTTGGGAGGTATATATCCGTTCAAGGCATTATAACCTGTAGTTGGAATTGTAACCCCGACACAGTGAGAGACCAAGCAGGAAACAGCAGCTTCATTTACACTGGAACAAAGTTTGCTGAGCTGTAGGGCTTTACCCCCTCTTAAATGGGTTAAAACCAGTAGTTTGATCAATTAGTTTGAAATTTTGGAGAAGGCTGGTGTCGGTTATTAGAGGGGGAGGGAAAGGATGGTGGATGTGGCAAAATTACTTTCACTTTCTCTATGAGAGGAGAGGCAGACGAGAAAGGGACAGTGAGACTAAGGATTAACATAAGGAACAAAAACGCTGAAACATGTAAAGAAGTGTGAAAGAGGTATCTGTACATAGACAGCAACTATATTTGACCACAACTAAATTTACAGCAGTTAAAGAATCCAAAGATCTGTGGGGAGAAAGACCAAAGCACTGCAGATACTGGCAAGTAAATATATATCCTGGTTAAACAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGTCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTGCACATCTGGAGGAAGTGTAGATGATGTGAGATTGAGCCTGGCATGGACTACACACTGCATTAATTCAGCATGAGTCTAGTAGCGTAGATCCGAGCTCGCTGATCTAATTCTCTATAGTTACAGTGAAGAATACCTACTGTGC
  5   1   2       bld Te2N 5g3  in                    IMAGE:7764044.5p                                                                                                                     CAGGAAACAGCAGCTTCATTTTCACTGGAACAAAGTTTGCTGAGCTGTAGGGCTTTACCCCCTCTTAAATGGGTTAAAACCAGTAGTTTGATCAATTAGTTTGAAATTTTGGAGAAGGCTGGTGTCGGTTATTAGAGGGGGAGGGAAAGGATGGTGCATGTGGCAAAATTACTTTCACTTTCTCTATGAGAGGAGAGGCAGACGAGAAAGGGACAGTGAGACTAAGGATTAACATAAGGAACAAAAACGCTGAAACATGTAAAGAAGTGTGGAAGAGGTATCTGTACATAGACAGCAACTATATTTGACACAACTAAATTTACAGCAGTTAAAGAATCCAAAGATCTGTGGGGAGAAAGACCAAAGCACTGCAGATACTGGCAAGTAAATATATATCCTGGTTAAACAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGCCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTACAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCCACTTGCATTTAATTCCAGCATGGATCATAGTACAGTAGATTCACGAGCATCACTGGATTTATTCTCTACTATAGTTAACAAGTGATAGAATTACCCTACTGCGGCACATGCTGGATGCGCAACTGCGTCTGGACGCTGCTGTAGATGAGTATCACTAGATACTAGATATGTCGCGCTAATAGGCATAT
  5   1   2       bld Thy  5g                         IMAGE:8547189.5p                                                                                                                            GCGGTCATAATTCTATTCGTCCGAACAAGTTTGCTGAGCTGTAGGGCTTTACCCCCTCTTAATGGGTTAAAACCAGTAGTTTGATCAATTAGTTTGAAATTTTGGAGAAGGCTGGTGTCGGTTATTAGAGGGGGAGGGAAAGGATGGTGCATGTGGCAAAATTACTTTCACTTTCTCTATGAGAGGAGAGGCAGACGAGAAAGGGACAGTGAGACTAAGGATTAACATAAGGAACAAAAACGCTGAAACATGTAAAGAAGTGTGGAAGAGGTATCTGTACATAGACAGCAACTATATTTGACACAACTAAATTTACAGCAGTTAAAGAATCCAAAGATCTGTGGGGAGAAAGACCAAAGCACTGCAGATACTGGCAAGTAAATATATATCCTGGTTAAACAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGCCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTACAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAACAAAGTGATAGAAATAACCCCTACCTGCTGGGCACATGTCTGGAGTGCGGCAGACTGCAGTACTGGAGCGAC
  5   1   2       bld FaBN 5g3  in                    IMAGE:8075108.5p                                                                                                                              GCAGCTTCATTTACACTGGAACAAAGTTTGCTGAGCTGTAGGGCTTTACCCCCTCTTAAATGGGTTAAAACCAGTAGTTTGATCAATTAGTTTGAAATTTTGGAGAAGGCTGGTGTCGGTTATTAGAGGGGGAGGGAAAGGATGGTGGATGTGGCAAAATTACTTTCACTTTCTCTATGAGAGGAGAGGCAGACGAGAAAGGGACAGTGAGACTAAGGATTAACATAAGGAACAAAAACGCTGAAACATGTAAAGAAGTGTGGAAGAGGTATCTGTACATAGACAGCAACTATATTTGACACAACTAAATTTACAGCAGTTAAAGAATCCAAAGATCTGTGGGGAGAAAGACCAAAGCACTGCAGATACTGGCAAGTAAATATATATCCTGGTTAAACAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGTCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTACAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAATAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCTGCAGATGC
  5   1   2       bld Ga15 5g                            XL510o12ex.5p                                                                                                                                                                                                                                      CAGGCTGGTGTCGGTTATTAGAGGGGGAGGGAAAGGATGGTGGATGTGGCAAAATTACTTTCACTTTCTCTATGAGAGGAGAGGCAGACGAGAAAGGGACAGTGAGACTAAGGATTAACATAAGGAACAAAAACGCTGAAACATGTAAAGAAGTGTGGAAGAGGTATCTGTACATAGACAGCAACTATATTTGACCACAACTAAATTTACAGCAGTTAAAGAATCCAAAGATCTGTGGGGAGAAAGACCAAAGCACTGCAGATACTGGCAAGTAAATATATATCCTGGTTAAACAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGTCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTACAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAACAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCTGCAGATTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCA
  5   1   2       bld FaBN 5g                         IMAGE:8077265.5p                                                                                                                                                                                                                                                                                                          TTCGGTCCGGATTCCCGGGATCGAGAAAGGGACAGTGAGACTAAGGATTAACATAAGGAACAAAAACGCTGAAACATGTAAAGAAGTGTGGAAGAGGTATCTGTACATAGACAGCAACTATATTTGACACAACTAAATTTACAGCAGTTAAAGAATCCAAAGATCTGTGGGGAGAAAGACCAAAGCACTGCAGATACTGGCAAGTAAATATATATCCTGGTTAAACAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGTCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTACAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAATAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCTGCAGATTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTAGGCAGTATGATCTGTGGTTGGGGATAGAAGGGGCCTGGTCTATATTATGTGAATGAACATGGTACGAGGT
  5   1   2       bld Sp1  5g                IMAGE:4173810-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                    GGAGAGGCAGACGAGAAAGGGACAGTGAGACTAAGGATTAACATAAGGAACAAAAACGCTGAAACATGTAAAGAAGTGTGGAAGAGGTATCTGTACATAGACAGCAACTATATTTGACACAACTAAATTTACAGCAGTTAAAGAATCCAAAGATCTGTGGGGAGAAAGACCAAAGCACTGCAGATACTGGCAAGTAAATATATATCCTGGTTAAACAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGCCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTACAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGGAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAACAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCGGCAGACTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAAACAGGCCTGTCTGTGGGCAGTATGATCTGTGGTTGGGATAAGAAGGGGCCTGGTCTATATTATGTGGATGACAAATGGGTACAAGGTTATGTGGTGACATCTTTCTCTACGGGATCAGGAAATTTCATATGCCTATGGGTGTGATGGACAGTGGCTATCGTTTTGATTTGAACCCCAAAAGAGGCCTATG
  5   1   2       bld Sp1  5g3  in                    IMAGE:4173810.5p                                                                                                                                                                                                                                                                                                                      AGAGGCAGACGAGAAAGGGACAGTGAGACTAAGGATTAACATAAGGAACAAAAACGCTGAAACATGTAAAGAAGTGTGGAAGAGGTATCTGTACATAGACAGCAACTATATTTGACACAACTAAATTTACAGCAGTTAAAGAATCCAAAGATCTGTGGGGAGAAAGACCAAAGCACTGCAGATACTGGCAAGTAAATATATATCCTGGTTAAACAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGCCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCANAGTTTCTACAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAACAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCGGCAGACTGCCAGTACTGNGAGCGACTGCTGGCTAAAGAGTGCAGTTATACCAGCTAAGAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGGCATATGATGTACAGTACAGAGGAACAGGCCTGTCTGTGGGCAGTATGATC
  5   1   2       bld FaBN 5g                         IMAGE:8078963.5p                                                                                                                                                                                                                                                                                                                             GACGAGAAAGGGACAGTGAGACTAAGGATTAACATAAGGAACAAAAACGCTGAAACATGTAAAGAAGTGTGGAAGAGGTATCTGTACATAGACAGCAACTATATTTGACACAACTAAATTTACAGCAGTTAAAGAATCCAAAGATCTGTGGGGAGAAAGACCAAAGCACTGCAGATACTGGCAAGTAAATATATATCCTGGTTAAACAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGTCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTACAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAATAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCTGCAGATTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGAA
  5   1   2       bld Sp1  5g                         IMAGE:5513290.5p                                                                                                                                                                                                                                                                                                                                   AAGGGACAGTGAGACTAAGGATTAACATAAGGAACAAAAACGCTGAAACATGTAAAGAAGTGTGGAAGAGGTATCTGTACATAGACAGCATAGACAGCAACTATATTTGACCACAACTAAATTTAAAGAATACAAAGATCTGTGGGGAGAAAGACCAAAGCACTGCAGATACTGGCAAGTAAATATATATCCTGGTTAAACAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGTCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTACAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAACAAAGTGATAGAAATTAACCCCTACCTGCTGGGTACCATGTCTGGAAGTGCTGCAGACTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTANGCAGTATGATCTGTGGTTGGGATAAGAAGGNGCCTGGTCTATATTATGTGGAATGACATGGTACANGGNTATGTGGTGACATCTTCTCTACGGNNATCAGA
  5   1   2       bld FaB  5g                         IMAGE:8072546.5p                                                                                                                                                                                                                                                                                                                                    GAAGGGACAGTGAGACTAAGGATTCCATAAGGAACAAAAACGCTGAAACATGTAAAGAAGTGTGGACCTTGTATCTGTACATAGACAGCAACTATATTTGACACAACTAAATTTACAGCAGTTAAAGAATCCAAAGATCTGTGGGGAGAAAGACCAAAGCACTGCAGATACTGGCAAGTAAATATATATCCTGGTTAAACAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGTCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTACAACATCTGGAGGAAGGTGTATATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAATAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCGTGTCTGGAAGTGCTGCAGATTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACACGCCTGTCTGTAGGCAGTATGATCTGTGGTTGGGATAAGAAAGGGCCTGGTCCAATTTTGTGAATGAAAAT
  5   1   2       bld FaBN 5g                         IMAGE:8078306.5p                                                                                                                                                                                                                                                                                                                                                                     ACAAAAACGCTGAAACATGTAAAGAAGTGTGGAAGAGATATCTGTACATAGACAGCAACTATATGTGACACAACTAAATTTACAGCAGTTAAAGAATCCAAAGATCTGTGGGGAGAAAGACCAAAGCACTGCAAATACTGGCAACTGCATATATATCCTGGTGAAACAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGCCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTGCAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGAACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAACAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCGGCAGATTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGGATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTANGCAGTATGATCTGTGGTTGGGATAATAAGGGGCCTGGTCTATATTATGTGAATGACAATGGTACAAGGTTATGTGGTG
  5   1   2       bld FaBN 5g                         IMAGE:8078174.5p                                                                                                                                                                                                                                                                                                                                                                                                                 GTACATAGACAGCAACTATATTTGACCATCTAAATTTACAGCAGTTAAAGAATCCAAAGATCTGTGGGGAGAAAGACCAAAGCACTGCAGATACTGGCAAGTAAATATATATCCTGGTTAAACAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGTCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTACAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAATAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCTGCAGATTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTAGGCAGTATGATCTGTGGTTGGGATAAGAAGGGGCCTGGTCTATATTATGTGAATGACAATGGTACGAGGTTATGTGGTGACATCTTCTCTACGGGATCAGGAAATTCATATGCCTATGGTGTGATGGACAGTGGCTATCGTTTTGTATGAACCCCGAAGAGGCCTATATCTGGGCCGTAGAGCAATAGCTA
  5   1   2       bld Skin 5g                         IMAGE:8644872.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAATCCAAGATCTGTGGGGAGAAAGACCAAAGCACTGCAAATACTGGCAACTGCATATATATCCTGGTGAAACAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGCCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTGCAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAACAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCTGCAGATTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGGATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTAGGCAGTATGATCTGTGGTTGGGATAATAAGGGGCCTGGTCTATATTATGTGAATGACAATGGTACAAGGTTATGTGGTGACATCTTCTCTACGGGATCAGGAAATTCATATGCCTATGGTGTGATGGACAGTGGCTATCGTTTTGATTTGACCCAGAAGAGGCTATGATCTGGGCGTAGAGCAATAGCTATGCACACACGTGATGCTACTCAGGAGGATGTGTACTATACACTGAAGAGATGCTGGTGAGATGNACAGTGATGTACAA
  5   1   2       bld Bone 5g3  in                    IMAGE:8740428.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAACATGGCGCTTCTCACAATGTGTGGACCTACTCAGAGCCACGACTGGCGAATGCCCCTCTACGGAGGTACCATCTCTCCAACAATTCCTTTCCGGGTCTGCAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTACAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAACAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCGGCAGACTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGCCTGTCTGTGGGCAGTATGATCTGTGGTTGGGATAAGAAAGGGCCTGGTCTATATTATGTGGATGACAATGGTACAAGTTATGTGGTGACATCTTCTCTACGGGATCAGGAAATTCATATGCCTATGGTGTGATGGACAGTGGCTATCGTTTTGATTTGACCCCAGAGAGCCTATGATCTGGGCCGTAGAGCATAGCTATGCACGCACCGTGATGCTACTCAGAAGATGTGTACCTATACACATGAAGACGATGGCTCGTGAATGCAAGCTCGAAGTGAACGACTACTGCAACTACTGAGACACGAACTGGACTCAGGACGCATGAGTCATACTCAGCCATTGCAGTCTCTCTGGTGGGT
  3   1   2       bld Bone 5g3  in                    IMAGE:8740428.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAATTCGAATTCGTTCCCCAAACATGCGCTTTCCACATGTTGACTATCAGAGCAGACTGCGATGCCTTACGAGTACATCTTTTCACAATCTTTCGGGTCTGCATACTGGAGCTGCAGTGCTCTGATATCAGCTGCAAAGTTCTACAAACATCTGGAGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAACAAAGTGATAGAAATTAACCCCTACTGCTGGGCACCATGTCTGGAAGTGCGGCAGACTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTGGGCAGTATGATCTGTGGTTGGGATAAGAAGGGGCCTGGTCTATATTATGTGGATGACAATGGTACAAGGTTATGTGGTGACATCTTCTCTACGGGATCAGGAAATTCATATGCCTATGGTGTGATGGACAGTGGCTATCGTTTTGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGTAGAGCAATTAGCTATGCCACGCACCGTGATGCCTACTCAGGAGGATGTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTGAAGATTGGACAGTTTGATGTGAGCGACTTACTGCACAAATTTACTGAGGAGAAGAACATGTGACTTAGAGGAAGCAGTGGAAGTTTCAATTAACTCCCAGCCTTTTGCATAATTCCTTCTGTGTGGTTTTGTCCTAAACCCATATTATATCCATTTCACACATGTTAAAACCAAAT
  5   1   2       bld DMZ       in                         xl259e13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGAATTTGAGCAGCATTCAGCCTGCAAAGTTTCTACAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAATAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCTGCAGATTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTCGGCAGTATGATCTGTGGTTGGGATAAGAAGGGGCCTGGTCTATATTATGTGGATGACAATGGTACGAGGTTATGTGGTGACATCTTCTCTACGGGATCAGGAAATTCATATGCCTATGGTGTGATGGACAGTGGCTATCGTTTTGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGTAGAGCAATTAGCTATGCCACACACCGTGATGCCTACTCANGAGGATGTGTTAACTTATACCACATGA
  5   1   2      seed DMZ       in                         xl300f06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGAATTTGAGCAGCATTCAGCCTGCAAAGTTTCTACAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAATAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCTGCAGATTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTCGGCAGTATGATCTGTGGTTGGGATAAGAAGGGGCCTGGTCTATATTATGTGGATGACAATGGTACGAGGTTATGTGGTGACATCTTCTCTACGGGATCAGGAAATTCATATGCCTATGGTGTGATGGACAGTGGCTATCGTTTTGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGTAGAGCAATTAGCTATGCCACACACCGTGATGCCTACTCAGGAGGATGTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTGAAGATTGGACAGTTTGATGTGAGCGACTTACTGCACAAATTTAATGAGGAGAAGAACATGTGACTCAG
  5   1   2       bld DMZ       in                         xl284m05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGAATTTGAGCAGCATTCAGCCTGCAAAGTTTCTACAACATCTGGAGGAAGGTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAATAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCTGCAGATTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTCGGCAGTATGATCTGTGGTTGGGATAAGAAGGGGCCTGGTCTATATTATGTGGATGACAATGGTACGAGGTTATGTGGTGACATCTTCTCTACGGGATCAGGAAATTCATATGCCTATGGTGTGATGGACAGTGGCTATCGTTTTGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGTAGAGCAATTAGCTATGCCACACACCGTGATGCCTACTCAGGAGGATGTGTTAACTTATACCACATGAAAGANGATGGCTGGGTGAAGATTGGACAGTTTGATGTGAGCGACTTACTGCACAAATTTAATGAG
  3   1   2       bld DMZ       in                         xl284m05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAATAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCTGCAGATTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTCGGCAGTATGATCTGTGGTTGGGATAAGAAGGGGCCTGGTCTATATTATGTGGATGACAATGGTACGAGGTTATGTGGTGACATCTTCTCTACGGGATCAGGAAATTCATATGCCTATGGTGTGATGGACAGTGGCTATCGTTTTGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGTAGAGCAATTAGCTATGCCACACACCGTGATGCCTACTCAGGAGGATGTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTGAAGATTGGACAGTTTGATGTGAGCGACTTACTGCACAAATTTAATGAGGAGAAGAACATGTGACTCAGAGGAAGCAGTGGAAGTTTCAATTAACTCCCAGTCTTTTGCATAATTCCTTCTGTGTGGTTTTGTCCTAAACCCATATTATATCCATTTCACACATGTAAAACCAAATCTGGATTGAAAT
  3   1   2       bld DMZ       in                         xl300f06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGTAGATGATGTGAAGATTGAGCCTTGNCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAATAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCTGCAGATTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTCGGCAGTATGATCTGTGGTTGGGATAAGAAGGGGCCTGGTCTATATTATGTGGATGACAATGGTACGAGGTTATGTGGTGACATCTTCTCTACGGGATCAGGAAATTCATATGCCTATGGTGTGATGGACAGTGGCTATCGTTTTGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGTAGAGCAATTAGCTATGCCACACACCGTGATGCCTACTCAGGAGGATGTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTGAAGATTGGACAGTTTGATGTGAGCGACTTACTGCACAAATTTAATGAGGAGAAGAACATGTGACTCAGAGGAAGCAGTGGAAGTTTCAATTAACTCCCAGTCTTTTGCATAATTCCTTCTGTGTGGTTTTGTCCTAAACCCATATTATATCCATTTCACACATGTTAAAACCAAATCT
  3   1   2       bld DMZ       in                         xl259e13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGTAGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAATAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCTGCAGATTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAANATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTCGGCAGTATGATCTGTGGTTGGGATAAGAAGGGGCCTGGTCTATATTATGTGGATGACAATGGTACGAGGTTATGTGGTGACATCTTCTCTACGGGATCAGGAAATTCATATGCCTATGGTGTGATGGACAGTGGCTATCGTTTTGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGTAGAGCAATTAGCTATGCCACACACCGTGATGCCTACTCAGGAGGATGTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTGAAGATTGGACAGTTTGATGTGAGCGACTTACTGCACAAATTTAATGAGGAGAAGAACATGTGACTCAGAGGAAGCAGTGGAAGTTTCAATTAACTCCCAGTCTTTTGCATAATTCCTTCTGTGTGGTTTTGTCCTAAACCCATATTATATCCATTTCACACATGTAAAACCAAATCTGGTATTGAAAT
  3   1   2       bld FaBN 5g3  in                    IMAGE:8075108.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAATTCCAGCATGGAGTCATAGTAGCAGTAGATTCACGAGCATCAGCTGGATCTTATATCTCTACTATTAAGTTTAATAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCTGCAGATTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTAGGCAGTATGATCTGTGGTTGGGATAAGAAGGGGCCTGGTCTATATTATGTGAATGACAATGGTACGAGGTTATGTGGTGACATCTTCTCTACGGGATCAGGAAATTCATATGCCTATGGTGTGATGGACAGTGGCTATCGTTTTGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGTAGAGCAATTAGCTATGCCACACACCGTGATGCCTACTCAGGAGGATGTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTGAAGATTGGACAGTTTGATGTGAGCGACTTACTGCACAAATTTAATGAGGAGAAGAACATGTGACTCAGAGGAAGCAGTGGAAGTTTCAATTAACTCCCAGTCTTTTGCATAATTCCTTCTGTGTGGTTTTGTCCTAAACCCATATTATATCCATTTCACACAGTTAAAACCAAA
  5   1   2       bld Te2N                            IMAGE:7768311.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGCATCAGCTGGATCTTATATCTCTCCTTTTAAGTTTAACAAAGTGATAGAAATTAACCCCTACCTCTTTAAAACCATGTCTGGATTTGCGGCAGACTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATTCTCGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTGGGCAGTATGATCTGTGGTTGGGATAAGAAGGGGCCTGGTCTATATTATGTGGATGACAATGGTACAAGGTTATGTGGTGACATCTTCTCTACGGGATCAGGAAATTCATATGCCTATGGTGTGATGGACAGTGGTTATCGTTTTGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGTAGAGCAATTAGCTATGCCACGCACCGTGATGCCTACTCAGGAGGATGTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTGAAGATTGGACAGTTTGATGTGAGCGACTTACTGCACAAATTTACTGAGGAGAAGAACATGTGACTTAGAGGAAGCAGTGGAAGTTTCAATTAACTCCCAGCCTTTTGCATAATTCCTTCTGTGTGGTTTTGTCCTAAACCCATATTATATCCATTTCACACATGTTAAAACCAAATCAGGTATTTGGAAATTATTCGGAATAAAAATGGATTATTCaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Te2N 5g3  in                    IMAGE:7764044.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATATCTCTACTATTAAGTTTAACAAAGTGATAGAAATTAACCCCTACCTGCTGGGCACCATGTCTGGAAGTGCGGCAGACTGCCAGTACTGGGAGCGACTGCTGGCTAAAGAGTGCAGGTTATACCAGCTAAGAAATAACTCAAGAATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTGGGCAGTATGATCTGTGGTTGGGATAAGAAGGGGCCTGGTCTATATTATGTGGATGACAATGGTACAAGGTTATGTGGTGACATCTTCTTTACGGGATCAGGAAATTCATATGCCTATGGTGTGATGGACAGTGGCTATCGTTTTGATTTGACCCCAGAAGAGGCCTATGATTTGGGCCGTAGAGCAATTAGCTATGCCACGCACCGTGATGCCTACTCAGGAGGATGTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTGAAGATTGGACAGTTTGATGTGAGCGACTTACTGCACAAATTTACTGAGGAGAAGAACATGTGACTTAGAGGAAGCAGTGGAAGTTTCAATTAACTCCCAGCCTTTTGCATAATTCCTTCTGTGTGGTTTTGTCCTAAACCCATATTATATCCATTTCACACATGTTAAAACCAAATCAGGTATTTGGAAATTATTCGGAATAAAAATGGATTTTTCAGAAAAAAAAAAAAAAA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4173810.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTGTATCTGCTGCTCCAAGACTAATGTGCAATATGATGTTACAGTACAGAGGAACAGGCCTGTCTGTGGGCAGTATGATCTGTGGTTGGGATAAGAAGGGGCCTGGTCTATATTATGTGGATGACAATGGTACAAGGTTATGTGGTGACATCTTCTCTACGGGATCAGGAAATTCATATGCCTATGGTGTGATGGACAGTGGCTATCGTTTTGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGTAGAGCAATTAGCTATGCCACGCACCGTGATGCCTACTCAGGAGGATGTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTGAAGATTGGACAGTTTGATGTGAGCGACTTACTGCACAAATTTACTGAGGAGAAGAACATGTGACTTAGAGGAAGCAGTGGAAGTTTCAATTAACTCCCAGCCTTTTGCATAATTCTTTCTGTGTGGTTTTGTCCTAAACCCATATTATATCCATTTCACACATGTTAAAACCAAATCAGGTATTTGGAAATTATTCGGAATAAAAATGGATTATTCAGTTTTTGCTTTGTTTTTACCGAAGACAACCTATTGTTTAAGGAGTATGTTGTCTACCCCAAATTATATATATAGAAGGAAACTACTATAAAAGAATCATTTGACTGGCAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)