Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.8    0Xl3.1-IMAGE:6949389.3                      13 END     5          20       38                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6946470.5                       6 PI      94         15      812                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012770593 Xl3.1-IMAGE:6949052.5 - 24 ESTs
                                                                       ...-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6949052.5              CTCCGGGATATCAGGGGGTAACCACACAAGCAGGTCCTCTTCCACAACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATTGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTTCCTGTCTACATTTACTTCAACACCTGGGTCACCTGCCAGTCCATCGCCTTCCCAGGGAAAACCACAACCAGCGTCAGTACCCTGTGTTCAGATGCTCGCATGTATGGTGTTCTGCCATGGAATGCCTTCCCAGGGAAAGTGTGCGGGACCAGCCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATGACATTTCACCTTTTTATTGCGGCATTTGTGGGTGCAGCTGCAACACTTGTGGCCCTGCTCACTTATATGGTAGGCGCATCATTCAACTATGCTGTGCTTCGAGTTACTGGCCGGAGCGATCGCTCAAAGTTTTAGACTTCGAGTCTGTGGTTGCTAAAAACAAAGCAGAATCCTGAATTCATGGTTTTATTTATATGATTATAATGTTCATGTTTTCCTTTTTGTTTTTGAATTCTTGTTTTTGTTTGTTTGCATTGGAATTTAGATAACATGGCTGGTGCTTTCCATGGAAAATCTGTATCTGCCCTTGGTTTCCCTAAACTCTTGGCTTAATCTAACAGAACAAGTAAGAACTGCCCTAAGGATACTAAGCTTGAAAACCAATCTCAGCCACTCATATCTGTGGACAGCAAATCTGCCCCCTATAATGTAGAAAATTAGACTCTATCACACATTTTCTACTTAGTCACCAATAGATTTACTCTTTAATAGGTGTCAGGAGCAAACAGTGATCATTTAAGGCTAGTTACTGGAAATAATTTCTGATTGGTTACTCATTCTTCTAGTACTATAATACAACAG
                                                  Xl3.1-CHK-1012688992                    GATATCAGGGGGTAACCACACAAGCAGGTCCTCTTCCACAACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATTGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTTCCTGTCTACATTTACTTCAACACCTGGGTCACCTGCCAGTCCATCGCCTTCCCAGGGAAAACCACAACCAGCGTCAGTACCCTGTGTTCAGATGCTCGCATGTATGGTGTTCTGCCATGGAATGCCTTCCCAGGGAAAGTGTGCGGGACCAGCCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATGACATTTCACCTTTTTATTGCGGCATTTGTGGGTGCAGCTGCAACACTTGTGGCCCTGCTCACTTATATGGTAGGCGCATCATTCAACTATGCTGTGCTTCGAGTTACTGGCCGGAGCGATCGCTCAAAGTTTTAGACTTCGAGTCTGTGGTTGCTAAAAACAAAGCAGAATCCTGAATTCATGGTTTTATTTATATGATTATAATGTTCATGTTTTCCTTTTTGTTTTTGAATTCTTGTTTTTGTTTGTTTGCATTGGAATTTAGATAACATGGCTGGTGCTTTCCATGGAAAATCTGTATCTGCCCTTGGTTTCCCTAAACTCTTGGCTTAATCTAACAGAACAAGTAAGAACTGCCCTAAGGATACTAAGCTTGAAAACCAATCTCAGCCACTCATATCTGTGGACAGCAAATCTGCCCCCTATAATGTAGAAAATTAGACTCTATCACACATTTTCTACTTAGTCACCAATAGATTTACTCTTTAATAGGTGTCAGGAGCAAACAGTGATCATTTAAGGCTAGTTACTGGAAATAATTTCTGATTGGTTACTCATTCTTCTAGTACTATAATACAACAGAGTACT
                                                      consensus depths                   3     8     6    10    11    15    13    16    16    17    16    18    17    18    17    18    18    18    17    18    18    18    18    18    18    18    18    19    18    19    17    19    17    19    19    19    18    19    19    20    19    20    20    20    20    20    20    20    20    20    20    20    20    20    17    20    18    20    16    19    16    18    16    17    16    17    16    17    16    17    16    17    16    17    14    17    14    18    13    18    13    18    14    18    13    18    13    19    13    19    13    19    12    19    13    19    12    18    11    18    12    18    12    18    13    19    13    19    12    19    11    19    11    19    11    19    11    19    11    19    10    19     9    19     9    18     9    18     8    18     8    17     7    15     7    15     7    15     7    15     7    15     7    15     6    15     4    10     3     7     3     6     3     5     3     5     3     5     3     4     3     4     3     4     2     4     2     4     2     4     2     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     5     3     5     3     5     3     5     3     5     2     5     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4
                                                                   SNP                          CA----------
                                                                   SNP                                                                                                                                                                                                                          --C---------
                                               BLH ATG      66     872              
                                               BLH MIN      66     107              
                                               BLH MPR      66     107              
                                               BLH OVR      66      44              
                                               CDS MIN      66      51              
                                               EST CLI     -13      51              
                                               ORF LNG      66       3              
                                                                                                                                                      PROTEIN === Dr ==== 8e-074     NP_783166.1 proteolipid protein 1a [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PROTEIN === Bt ==== 2e-121     NP_776574.2 proteolipid protein 1 [Bos taurus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PROTEIN === Cf ==== 1e-121     NP_001013856.1 proteolipid protein 1 [Canis familiaris] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PROTEIN === Mm ==== 1e-121     NP_035253.1 proteolipid protein (myelin); myelin proteolipid protein; rump shaker; myelinsynthesis deficiency [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PROTEIN === Hs ==== 1e-121     NP_001122306.1 proteolipid protein 1 isoform 1 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PROTEIN === Gg ==== 1e-122     NP_990608.1 myelin proteolipid protein [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PREDICTED = Xt ==== 3e-162     NP_001027507.1 hypothetical protein LOC613099 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PROTEIN === Xl ==== 2e-165     NP_001082268.1 myelin proteolipid protein (PLP) [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6949052.5                                TAA---------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------TAG---------------------------------------------ATG------------TGA---TAA------------------------TGA---------------------------------------ATG---------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------TAG---------------------------------------------TAATAG---------------------------------------------------TGA
                                                                   ORF                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   2       chi Tad1      in                    IMAGE:6878317.5p GGGGAGTCAGTCAGCAGAGAAGAATCAGGGGTAACCACACAAGCAGGTCCTCTTCCACAACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACATATAAGTTGATTGAGACATATTTTTCCAAAAACTACCACGAATATGAATACCTCATTCACGTGATTAATGCCTTTCACTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGATGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAGACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCGAGGGAAAGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGAGCCTGATCTTTGCCTGCTCTGCTGTTCCTGCCTACCTTTGCTTCAAAACCTGGGTCACCTGCCCAGCCCTTGGCCTTTCGCGTGGAAAAACCTCAACCAAGCGGCCACTTACCCTGTTGTGTCAAAAGCCTCGGATTGGTTTGGGTGGTTCCTGGCCATGGGCAAAGGCCTGTTCCCAGGGGGAAAAATTGCGGCCGGGAACCCAGGCCCCGGGGTTTGGCCCCTTCCCAACACGAGAA
  5   1   2       bld Eye1 5g                         IMAGE:6957660.5p  GGCTGGACCGGTCCGGATTCTCGGGATGGGGTAACCACACAAGCAGGTCCTCTTCCACACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATTGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTTCCTGTCTACATTTACTTCAACACCTGGGTCACCTGCCAGTCCATCGCCTTCCCAGGGAAAACCACAACCAGCGTCAGTACCCTGTGTTCAGATGCTCGCATGTATGGTGTTCTGCCATGGAATGCCTTCCCAGGGAAAGTGTGCGGGACCAGCCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATGACATTTCACCTTTTTATTGCGGCATTTGTGGGTGCAGCTGCAACACTTGTGGCCCTGCTCACTTATATGGTAGGCGCATCATTCAACTATGCTGTGCCTTCGAGTTACTGGGCCGGAGCGA
  5   1   2       bld Eye1 5g                         IMAGE:6949052.5p   GTCCCGGAATTCTCCGGGATATCAGGGGGTAACCACACAAGCAGGTCCTCTTCCACAACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATTGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTTCCTGTCTACATTTACTTCAACACCTGGGTCACCTGCCAGTCCATCGCCTTCCCAGGGAAAACCACAACCAGCGTCAGTACCCTGTGTTCAGATGCTCGCATGTATGGTGTTCTGCCATGGAATGCCTTCCCAGGGAAAGTGTGCGGGACCAGCCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATGACATTTCACCTTTTTATTGCGGCATTTGTGGGTGCAGCTGCAACACTTGTGGCCCTGCTCACTTATATGGGTAGCGCATCATTCAACTATGCTGTGCTTCGAGTTAC
  5   1   2       bld Eye1      out                   IMAGE:6948107.5p   GTCCGGGAATTCTCCCGGATATGAGGGGGTAACCACACAAGCTGGTCCTCTTCCACAACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATTGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTTCCTGTCTACATTTTCTTCAACACCTGGGTCACCTGCCAGTCCATCGCCTTCCCAGGGGAAAACCACAACCCAGCGTCAGTACCCTGTGTTTCCGATGCTCGCATGTATGGTTGTTCTGCCATGGAATGCCCTTCCCCAGGGAAAAGTGTGGGGGGAACCGCCCGGCTTGGCCATCCTGCAAGACCCGGTGAGGTTCCGAAAAGGAAAATTTTCACCTTTTTTTATTGGCGGGCATTTGTTGGGTGGCACCCTTGCCACACCTTGGTGGGGCCCCGGCCTCCCCTTATAATGGG
  5   1   2       bld Eye1 5g3  out                   IMAGE:6949389.5p    GTCCGGAATTCTCCGGGATATCAGGGGGTAACCACACAAGCAGGTCCTCTTCCACAACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATTGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTTCCTGTCTACATTTACTTCAACACCTGGGTCACCTGCCAGTCCATCGCCTTCCCAGGGAAAACCACAACCAGCGTCAGTACCCTGTGTTCAGATGCTCGCATGTATGGTGTTCTGCCATGGAATGCCTTCCCAGGGAAAGTGTGCGGGGACCGCCTGCTTGCCATCTGCAAGACCAGTGAGTTTCAAGATGACATTTCACCTTTTTTATGCCGCATTTGTGGGGTGCAGCTGCAACAACTGTGGGCCCTGCTCACTTATTATGGTAGGGCGCATCATTTCAACTATGCTTGTGCTTCCAGT
  5   1   2       bld Eye1 5x                         IMAGE:6949007.5p     ACCGGTCCGGAATTTCCGGGATGGNGGGGTACCACACGAGTGCGTCCTCTTCCCAACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACACAGAAGTTGATTGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGTAAGGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTTCCTGTCTACATTTACTTCAACACCTGGGGTCACCTGCCAGTCCATCGCCTTCCCAGGGAAAACCACCACCAGCGTCCGTAACCCTGTGTCCAGATGCTCGAATGTATGGTGGTTCTGCCCTGGGAATGCCCCTCCCTTGGGAAAAGTGTGCCGGGACCAGCCCTGCTTTGCCTTCTGCGAGACCAGTGAACTTCCAAATGAAGTTTTCCCCTTTTTATTGCGCGCAATTTGTGGGGTGCAGCTGGCAACAACTTGTGGGCCCTGGCTCAATTAAATAGGGTGGGGGGCCTTCCATTCAAACTTTGGCCGGGGC
  5   1   2       chi Tad1                            IMAGE:6937263.5p      GGGCAGTCAGAGAGAAGAATCAGGGGTAACCACACAAGCAGGTCCTCTTCCACAACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATTGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGAAAAGTTTGTCGGTGTCACTTATATTATCACTATTTTTGGGGGATCCTGGATCTTTGCCCTGCCTCTGCTGGTTCCTGTCCACCCTTTACCTTCAACACCCTGGGGTCACCCCTGCCCGTTCCAATCGGCCCTTTCCCAGGGGGAAAAAACCATCAAACCCAGCCGGTCAGGTTACCCCCCGGTTGGTTTCCAGAAATGGCCTTCCGCCAAGGGGAttgggggtgggtttcctggggccacatgggggaaaagggggcccttttctcaccatgggggTGAC
  5   1   2       bld Brn1 5g                         IMAGE:6952134.5p            CTGGACCGGTCCGGAATTTTCCGGATCAGGAAGCAGGTCCTCTTCCACACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATTGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACCATAAAACTCATCTGTCGCTGCTTGGGAAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGATCCTGGACTTTGCCTGGCTCTGACTGTTCCTGTCCACATTTTACTTCAACCCCTGGGGTCACCTGGCCAGTCTCAACGGCCTTCCCGGGGGACAACCACAACCAAGGTTCGAAAACCCTGGCGATTCCAAATGGCCCCCCATTGTATGGGTGATCCGGCCACCGAAAATGCCCTTCCCCAGGGGAAAACGGTGGTGAGAACCCCCCTCGGTCTTGTCAACCCGCAAGCAACCCAGTGGCGTCTCCCACTATGGAACCATTCCACCTTCTTTATTTTGCAGACCATTTCGGGAGGGTGGCTATCCTGGCAATACACTTTGGGGAGCCCCCTGCCCCCT
  5   1   2       bld Tad2 5g                         IMAGE:6934279.5p                GGGGAAGAATCAAGGGTAACCACACAAGCAGGTCCTCTTCCACAACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATTGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGTGAAGGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCGCCTATTATATCATCACTATTGTGTGGATCCTGATCTTTTGCCTGGCTCTGCCGTTCCCTGTCTACATTTACTTTCACCACCTGGGTCACCTGCCAAATCCATCGCCTTTCCCCGGGGGAAACCACAAACCAGCGTTCGTTACCCCTGTGTTTCACATGCGCTCGCATGGTTTGGGTGTTCCTTGCATGGGAAAGGCCTTTCCCGGGGGAAAAG
  5   1   2       bld Eye1 5g                IMAGE:4743374-IMAGp.IMAGp                          CAGGGGTAACCACACAAGCAGGTCCTCTTCCACAACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATTGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTTCCTGTCTACATTTACTTCAACACCTGGGTCACCTGCCAGTCCATCGCCTTCCCAGGGAAAACCACAACCAGCGTCAGTACCCTGTGTTCAGATGCTCGCATGTATGGTGTTCTGCCATGGAATGCCTTCCCAGGGAAAAGTGTGCGGGGACCAGCCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATGACATT
  5   1   2       bld Eye1 5g                         IMAGE:6944741.5p                            GGGGTAACCACACAAGCAGGTCCTCTTCCACAACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATTGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTTCCTGTCTACATTTACTTCAACACCTGGGTCACCTGCCAGTCCATCGCCTTCCCAGGGAAAACCACAACCAGCGTCAGTACCCTGTGTTCAGATGCTCGCATGTATGGTGTTCTGCCATGGAATGCCTTCCCAGGGAAAGTGTGCGGGGACCAGCCTGCTTGCCATCTGCAAAAACCCGTGAGTTTCCAGATGACATTTCACCTTTTTATTTGCGGCATTTGTTGGGTGCAACTGCAACACCTTGTTGGCCCTGCTCACTTTATATGGTAAAGCGCCATCAATTCACCTATGGCTGTGG
  5   1   2       bld Eye1      out                   IMAGE:6948993.5p                             GGGGAACCACATTCCCAAGTCCTCTTCCACAACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATTGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTTCCTACCATAGAGCCTCATCTGTCGCTGCTTGGGAAAGTGGCTTCGGACACACTGGATAAATTTTGGCGGGGTCACTTGATATTATCACCATTTTGGGGGATCCCGGATCTTTGGCCGGCCCCGGCTGGTTCCCGGTCCCCATTTACCTTTAACACCTTTGGGGCCCCCTGGCCAGATCAATCGCCCTTCCCCGGGGAAAACCCCCAGCCCGGCGCCGTAACCCCTGGGGTTCCAAAGGCCCCGCCAGTGAAAGGGGGGTCCCTGCCTCGGGGAATGGCCTTTCCCGGGGGAAAAGGGTGGCGGGGAACCCAGGTTTGCGTTGGCCCTTTTGTAATAAACCCCGTGTGGTTTCCAAAAGGCAATTTTTACCCCTTTCTTATggggggggatcttgtggggggggCGCCTCTCGAAAAATTTTGGTGGGCCCTGCGTTACCCTTTAATGAGGGAGAGGTGCTTTATTATGCACGAGGGCCGGGGGGCT
  5   1   2       bld Brn1 5g                IMAGE:4740139-IMAGp.IMAGp                             GGGTAACCACACAAGCAGGTCCTCTTCCACAACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATCGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCAAAAGTAGGATCCCaaaaaaaaaaaaaaa
  5   1   2       add Brn1      in                    IMAGE:4740164.5p                              GGTAACCACACAAGCAGGTCCTCTTCCACAACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTTTgggggggggggcatgaggttttttttGGAACAGAGAAGTTGATCGAGACATATTTTTCCAAAAACTACCAGGAATATGACTACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGNTGAAGGATTNTTCACCACAACTGCCAAAAGTAGGATCCCAGGAGAAAGGGGAGA
  5   1   2       bld Eye1      out                   IMAGE:6947910.5p                                     ACACAAGCAGGTCCTCTTCCACAACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATTGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTTCCTGTCTACATTTACTTCAACACCTGGGTCACCTGCCAGTCCATCGCCTTCCCAGGGAAAACCACAACCAGCGTCAGTACCCTGTGTTCAGATGCTCGCATGTATGGTGTTCTGCCATGGAATGCCTTCCCAGGGAAAGTGTGCGGGACCAGCCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATGACATTTCACCTTTTTATTGCGGCATTTGTGGGTGCAGCTGCCACACTTTGTGCCCTGCTCACTTATATGGTAGGCGCATCATTCAACTATGCTGTGCTTTCGAGTTAC
  5   1   2      seed Eye1 5g                         IMAGE:4743374.5p                                                TCCTCTTCCACAACAAGTCTATTCCTAGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATTGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCT
  5   1   2       chi Eye1                            IMAGE:7020322.5p                                                     CTTCCCTGACAAGTCCATTCCTATACAATGGGTTGTTGTGATAGTGGCTTTCACTGCATGGTGGGAGAACCAATCGCCCCACTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATCGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGATACTGATCTTTGCCTGCTCTGCTGTTCCTGTCTACATTTACTTCAACACCTGGGTCACCTGCCAGTCCATCGCCTTCCCAGGGAAAACCACAACCAGCGTCAGTACCCCTGTGTTCAGATGCTCGCATGTATGGTGTTCTGCCATGGAATGCCTTCCCCAGGAAAGTGTGCGGGACCAGCCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATTGACATTTCACCTTTTTTATTGCGGCAATTTTGTGGGTGGCAGCTTGCAACACCTTTGTGGGCCCCTGCCTCACTTTAATATGGGTTAGGGCCGCCATTCAATTTCAAACCTATATGCCTGGTGGCCCTTTCCAAGGGTTTTA
  5   1   2       bld Eye1 5g                         IMAGE:6945943.5p                                                                  TCTATTCCTAGAACATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCTGGAGTGGCCCTATTCTGCGGCTGTGGGCATGAGGCTTTGAGTGGAACAGAGAAGTTGATTGAGACATATTTTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTTCCTGTCTACATTTACTTCAACACCTGGGTCACCTGCCAGTCCATCGCCTTCCCAGGGAAAACCACAACCAGCGTCAGTACCCTGTGTTCAGATGCTCGCATGTATGGTGTTCTGCCATGGAATGCCTTCCCAGGGAAAGTGTGCGGGACCAGCCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATGACATTTCACCTTTTTATTGCGGCATTTGTGGGTGCAGCTGCAACACTTGTGGCCCTGCTCACTTATATGGTAGGCGCATCATTCAACTATGCTGTGCTTCGAGTTACTGGCCCGGAGCGATCGCTCAA
  3   1   2       add Brn1      in                    IMAGE:4740164.3p                                                                                                                                                                 GGAGTGGCCTTATTAGGCGGCNGGGGGCATNAGGCTTTNAGTGNANCANAGAAGTTGATCGAGACATATTTTTCGAAAGGGTGCCAGGAATATGAATGCCTCATTCACGTGATTAATGCCTTTCAGTATGTTATGTATGGAATTGCCATTTTGTTCTTTCTATTTGGGATCGTACTTTTGGGTGAGGGATTGTATGTTTCAACTG
  5   1   2       bld Eye1                            IMAGE:6946329.5p                                                                                                                                                                                                                                       TTTCCAAAAACTACCAGGAATATGAATACCTCATTCACGTGATTAATGCCTTTCAGTATGTTATCTATGGAATTGCCATTTTCTTCTTTCTATTTGGGATCCTACTTTTGGCTGAGGGATTCTACACCACAACTGCCATCAAGCACATCCTAGGAGAGTTCAAACCCCCAGCTATAAAGGGTGGGCTCATCTCTACAGTGACTGGAGGAACACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACCATAGAGCTCATCTGTCGCTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTTCCTGTCTACATTTACTTCAACACCTGGGTCACCTGCCAATCCATCGCCTTCCCAGGGAAAACCACAACCAGCGTCAGTACCCTGTGTTCAGATGCTCGCATGTATGGTGTTCTGCCATGGAATGCCTTCCCAGGGAAAGTGTGCGGGACCAGCCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATGACATTTCACCCTTTTTTATTGCGGCCATTTGTGGGGTGCCAGCTGCCAACACTTTGTGGGCCCTGGCTCACCTTATAATGGGTTAAGGGCGCATTCACTTACAACCTATGCCTTGTGGCCTTTCTGAGATTTACCTGGGGCCCGGAAAACCGAATTCCCTCTCAAAAAGTTTTTTAAAAAACTTTCCGAAATTCCCATCAGGGGTTTGGCCCTAAAAAACCCAAAGGCGCGAGAAATCCCCGGGAAAATTCAATGGGATCTTCTCAATTCTTAACAAGGGAATTACTTAAATGCCTTTCCAGGGTTTTTTCCCCATTTAATTGGGTTTCTTGGGAAAAATTCCTTTGGGTCATATGAGACTTAGGTTTCAGCCCTTTGGGGGAATTTTTTGAGAAATACACCTTGGGCCTGGGAGTGCCTTTTTCCCCATGGGGACAAAATACCCTGT
  5   1   2       bld Eye1                            IMAGE:6947631.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCAAAATAGAGTCCATACCATAGAGCTTTTCGTCACTGCTTGGGAAAGTGGCTCGGACACCCTGATAAGTTTGTCGGTGTCACTTATATTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTTCCTGTCTACATTTACTTCAACACCTGGGTCACCTGCCAGTCCATCGCCTTCCCAGGGAAAACCACAACCAGCGTCAGTACCCTGTGTTCAGATGCTCGCATGTATGGTGTTCTGCCATGGAATGCCTTCCCAGGGAAAGTGTGCGGGACCAGCCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATGACATTTCACCTTTTTATTGCGGCATTTGTGGGTGCAGCTGCAACACTTGTGGCCCTGCTCACTTATATGGTAGGCGCATCATTCAACTATGCTGTGCTTCGAGTTACTGGCCGGAGCGATCGCTCAAAGTTTTAGACTTCGAGTCTGTGGTTGCTAAAAACAAAGCAGAATCCTGAATTCATGGTTTTATTTATATGAATATAATGTTCAATGTATTCcctttttggtttttgaattccttgttttttgttattgtttgccattgggaattttAGAATAAACATTGGGCTGGGTTGACCTTTTCCAATGGGTAAAAAATCCTGGTTATTCCTGGCCCCACTTTTGGGCTTCTCCCCCCTAAAAAACATCCATTGGGAGCCTTTAAATTTCCCTAAAATCCACGAAAAACCAAACCGTTACAGCAAATCTTTTGCTCCTCCTTAAAGAGGATTATACCTCAAAAAGCCATAGGAAAAAAGACCCCTAAAATACCTTCCAGAGCGCACACAACCACAATTAATATTCTTGCTTTGGGGAAAACCGGCTAAATAATCCTCTGGCACCCCCCCTCTATTATAATTGGTTGCGATAAAAAAATTTTTATAAGAATTTCCTAATTTTACTAATACATTTGTTCTTTCTCTACCTTATTATGACTCAACCCCAAAAAACAAGAATTATTAAAACTCCTCTTTTATAAATAAGGGATGTGTCCCAGCGGGTAACCAATAAACACAGTTGGATTTTCCAATTTCTAAAGAGGCTATAAATTTATCCCACGTAAAA
  3   1   2       bld Tad1      in                    IMAGE:6878317.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAAGTTTGTCGGTGTCACTTATATATTCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTTCCTGTCTACATTTACTTCAACCACNTGGGTCACCTGCCAGTCCATCGCCTTCCCAGGGAAAACCACACCCAGCGTCAGTACCCTGTGTTCAGATGCTCGCATGTATGGTGTTCTGCCATGGAATGCCTTCCCAGGGAGAGTGTGCGGGACCAGCCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATGACATTTCACCTTTTTATTGCGGCATTTGTGGGTGCAGCTGCAACACTTGTGGCCCTGCTCACTTATATGGTAGGCGCATCATTCAACTATGCTGTGCTTCGAGTTACTGGCCGGAGCGATCGCTCAAAGTTTTAGACTTCGAGTCTGTGGTTGCTAAAAACAAAGCAGAATCCTGAATTCATGGTTTTATTTATATGATTATAATGTTCATGTTTTCCTTTTTGTTTTTGAATTCTTGTTTTTGTTTGTTTGCATTGGAATTTAGATAACATGGCTGGTGCTTTCCATGGAAAATCTGTATCTGCCCTTGGTTTCCCTAAACTCTTGGCTTAATCTAACAGAACAAGTAAGAACTGCCCTAAGGATACTAAGCTTGAAAACCAATCTCAGCCACTCATATCTGTGGACAGCAAATCTGCCCCCTATAATGTAGAAAATTAGACTCTATCACACATTTTCTACTTAGTCACCAATAGATTTACTCTTTAATAGGTGTCAGGAGCAAACAGTGATCATTTAAGGCTAGTTACTGGAAATAATTTCTGATTGGTTACTCATTCTTCTAGTACTATAATACAACAGAGTACGATAGG
  5   1   2       bld Eye1                            IMAGE:7019992.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCAGTCCATCGCCTTCCCAGGGAAAACCACAACCAGCGTCAGTACCCTGTGTTCAGATGCTCGCATGTATGGTGTTCTGCCATGGAATGCCTTCCCAGGGAAAGTGTGCGGGACCAGCCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATGACATTTCACCTTTTTATTGCGGCATTTGTGGGTGCAGCTGCAACACTTGTGGCCCTGCTCACTTATATGGTAGGCGCATCATTCAACTATGCTGTGCTTCGAGTTACTGGCCGGAGCGATCGCTCAAAGTTTTAGACTTCGAGTCTGTGGTTGCTAAAAACAAAGCAGAATCCTGAATTCatggttttatttatatgattataatgttcatgttttcctttttgtttttgaattcttgtttttgtttgtttgCATTGGAATTTAGATAACATGGCTGGTGCTTTCCATGGAAAATCTGTATCTGCCCTTGGTTTCCCTAAACTCTTGGGCTTATCTAACAGAACAAGTAAGAACTGCCCTAAGGATACTAAGCATNGAAAACAATCTCAGCCACTCATATCTGTGGACAGCAAATCTGCCCCCCTATAATGTAGAAAATTAGACTCTATCACACATTTTCTAACTAAGTCACAATAGATTTACTCCTTAAAAGGTGTCAAGAGCAAACAGTGATTCATTAAAGGTAGTTACTGGGAAATAAATTTCCGAATGGGTACTCATTCCTCCCAGGACTATAATACAAACCGAGTTCCTTATGGGTGGAAGGGGCCTGGAAGTTTAGGTTAAAGTTTAAAATTTGAGAATCTCCTCTGAAATCCCTCCTGGGaaaaaaaaaaaaaccgggtttttttttttgggggggaaaaaaccccaaaaaaTGGCCCGGCGCAAATAAACC
  5   1   1       add Eye1      out                   IMAGE:4743240.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTGCATTGGAATTTAGATAACATGGCTGGTGCTTTCCATGGAAAATCTGTATCTGCCCTTGGTTTCCCTAAACTCTTGGCTTAATCTAACAGAACAAGTAAGAACTGCCCTAAGGATACTAAGCATGAAAACCAATCTCAGCCACTCATATCTGTGGACAGCAAATCTGCCCCCTATAATGTAGAAAATTAGACTCTATCACACATTTTCTACTTAGTCACCAATAGATTTACTCTTTAATAGGTGTCAGGAGCAAACAGTGATCATTTAAGGCTAGTTACTGGAAATAATTTCTGATTGGTTACTCATTCTTCTAGTACTATAATACAACAGAGTACTATAGGATGGAGGGTCATGAAGTAGAGTAGAGTAGAAGTAGAGATCTCTAGAACTCATCATGGAGAAAAAAATACTGttttttttttGGGGGAAACAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)