Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL495f17ex.5                        117 PI      82         35      570                (no blast hit)

 This cluster: approximate FL confidence score = 85%

 1012770607 Xl3.1-XL422o14ex.5 - 26 ESTs
                                                                       -20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL422o14ex.5                     GTAACACTTCCGTGCCGGTCTTTCTTTCGCATTCACGAGGCTGCAGAGATGGCGTACCGCGGACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCGACCGCTGTTCCCAAACATCTGCATCTGTGAAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCCTAATGCCTGCATGGATTACGCTGAAACTTTTTTTTTTATATATATATTTTTTAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACTTTTTTTTCCCCCCAAAGAGAGTAACTTTTTGATACTGAATTCAAATAAATCAAAATGTTTTGAAATGGTTTTGTGGTTAAATAAATCTTACAAAATGTACAATTTAAAAAAAAA
                                                  Xl3.1-CHK-1012688588                           CTTCCGxxxCxGTCTTTCTTTCGCATTCACGAGGCTGCAGAGATGGCGTACCGCGGACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCGACCGCTGTTCCCAAACATCTGCATCTGTGAAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCCTAATGCCTGCATGGATTACGCTGAAACTTTTTTTTTTATATATATATTTTTTAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACTTTTTTTTCCCCCCAAAGAGAGTAACTTTTTGATACTGAATTCAAATAAATCAAAxxxTTTTGAAATGGTTTTGTGGTTAAATAAATCTTAxAxAAxGTACAATTTAAA
                                                      consensus depths                          2     3     3     7     4     8     5     9     8    13    15    16    19    19    19    19    19    19    19    20    19    20    22    22    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    22    23    22    23    23    23    23    23    23    23    22    23    23    23    23    23    20    23    22    23    20    23    23    23    23    23    22    23    23    23    23    23    22    23    23    23    23    23    20    23    20    24    19    23    19    23    19    23    19    23    20    25    21    25    21    25    23    25    11    25    10    23    12    22    11    20     5    14     4     9     4     9     3     8     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                 ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                     C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                             ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -A----T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------C--
                                               BLH ATG      48     218                     
                                               BLH MIN      48      55                     
                                               BLH MPR      48      55                     
                                               BLH OVR      48     240                     
                                               EST CLI      35       9                     
  5   1   2       bld Egg1 5g3  in                    IMAGE:4783854.5p GGTTAGACGCATCACGCGCGTAACACTTCCGGTGCCGGTCTTTCTTTCGCATTCACGAGGCTGCAGAGATGGCGTACCGCGGACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCGACCGCTGTTCCCAAACATCTGCATCTGTGAAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCCTAATGCCTGCATGGATTACGCTGAAACttttttttttatatatatattttttAAAATCATCTGA
  3   1   2       bld Ga18 5g3  in                       xlk70i22ex.3p         CGCATCACGCGCGTAACACTTCCGGTGCCGGTCTTTCTTTCGCATTCACGAGGCTGCAGAGANNNNTNCCGCGGACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCACGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCCACCGCTGTTCCCAAACATCTGCATCTGTGGAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCATAATTCCTGCATGGATTACGCTGAAACTTTTTTTTATATATATATATTTTTTAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACTTTTTTTTTCCCCCAAAGAGAGTAACTTTTTGATACTGAACTCAAATAAATCAAATGTTTTGAAATG
  5   1   2       bld Ga18 5g3  in                       xlk70i22ex.5p          CNNNCACGCGCGTAACACTTCCGGTGCCGGTCTTTCTTTCGCATTCACGAGGCTGCAGAGATGGCGTANNNNNACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCACGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCCACCGCTGTTCCCAAACATCTGCATCTGTGGAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCATAATTCCTGCATGGATTACGCTGAAACttttttttatatatatatatTTTTTAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGNTGTGTACAAAATGTTAAAACtttttttttCCCCCAAAGAGAGTAANTTTTTGATACTGAACTCAAATAAATCAAATGTTTTGAAATGGTTTTNTGGTTAAATAAATCTTAAACAAAACATA
  5   1   2       bld Ga15 5g3  in                       XL422o14ex.5p                            TCCGGTGCCGGTCTTTCTTTCGCATTCACGAGGCTGCAGAGATGGCGTACCGCGGACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCGACCGCTGTTCCCAAACATCTGCATCTGTGAAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCCTAATGCCTGCATGGATTACGCTGAAACttttttttttatatatatattttttAAAATCATCTGAGTATAATTTCAGGNGTTGAAGGCAATTGCATANAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACttttttttCCCCCCNAANAGAGTAACTTTTTGATACTGAATTCAAATAAATCAAATGTTTTTaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL422o14ex.3p                            TCCGGTGCCGGTCTTTCTTTCGCATTCACGAGGCTGCAGAGATGGCGTNCCGCGGACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATNTACAAAATAGATCNCGGGTTCAAGNGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCNCTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCGNCCGCTGTTCCCAAACATCTGCATCTGNGAAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCCTAATGCCTGCATGGATTACGCTGAAACTTTTTTTTTTATATATATATTTTTTAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACTTTTTTTTCCCCCCAAAGAGAGT
  3   1   2       bld Ga18      in                      xlk111c23ex.3p                                ACGNCNNCCNNNNNCCGNCCACGCNTCCGGCTGCAGAGANNNNNNCCGCGGACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCGACCGCTGTTCCCAAACATCTGCATCTGTGAAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCCTAATGCCTGCATGGATTACGCTGAAACTTTTTTTTTTATATATATATTTTTTAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACTTTTTTTTCCCCCCAAAGAGAGTAACTTTTTGATACTGAATTCAAATAAATCAAATGTTNNTAAANNGTTTTGNG
  3   1   2       bld Ga18                              rxlk60j08ex.3p                                 CNNGGACGCGTGGGTTCGNATTCACGAGGCTGCAGAGANNNNTNCCGCGGACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCGACCGCTGTTCCCAAACATCTGCATCTGTGAAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCCTAATGCCTGCATGGATTACGCTGAAACTTTTTTTTTTATATATATATTTTTTAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACTTTTTTTTCCCCCCAAAGAGAGTAACTTTTTGATACTGAATTCAAATAANTCAAATG
  5   1   2       bld DMZ  5x3                             xl227b10.5p                                      GTCTTTCTTTCGCATTCACGAGGCTGCAGAGATGGCGTACCGCGGACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCACGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCCACCGCTGTTCCCAAACATCTGCATCTGTGGAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCATAATTCCTGCATGGATTACGCTGAAACttttttttatatatatatattttttAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACttttttttttCCCCCAAANAGAGTAACTTTTTGATNCTGAACTCAAATAAATCAAATGTTTTGAAATGG
  5   1   2       chi Emb4      in                    IMAGE:4959047.5p                                                        CGAGGCTGCAGAGATGGCGTACCGCGGACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAATACATAGTCACGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCCACCGCTGTTCCCAAACATCTGCATCTGTGGAGGAATTTATCAGGACTCCCCCCGTCTATGGACTTGTGGACTATTCTGCAGATTTGTAGCTATGTCATAATTCCCGCATGGATTACGCTGAAACttttttttatatatatatatTCTTTTAAACCCTCTGCGTATAATTGCAGGGGTTGAAAGCAATCGGCATAAAAACTGGATGTCCCTGCCAGGATAATTCCGGTGGGGACGAAATGCTAACATGGTTTGGTGTGCACCCAAAAGAGGAACTTTCTTGGAACTGGAA
  3   1   2       bld Ga15 5g3  in                       XL485n10ex.3p                                                           CCCNCGNGTCCGGGNGTNCCGCGGACNGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCNTCAATTTGATCTTCAGGTATNTACAAAATAGATCNCGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCNGAAGAAATCCNTNTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCNCTTTGCTACNGAGTGTCATGAATTAATCTGTTCCCGNCCGCTGTTCCCNAACATNTGCATCTGNGAAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGNGGACTATTCTGTAGATTTGTAGCTATGTCCTAATGCCTGCATGGATTACGCTGAAACTTTTTTTTTTATATATATATTTTTTAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACTTTTTTTTCCCCCCAAAGAGAGT
  5   1   2       bld Ga15 5x3                           XL416j13ex.5p                                                           GGCTGCAGAGATGGCGTACCGCGGACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCACGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCCACCGCTGTTCCCAAACATCTGCATCTGTGGAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCATAATTCCTGCATGGATTACGCTGAAACttttttttatatatatatattttttAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACttttttttttCCCCCAAANANAGTAACTTTTTGATACTGAACTCAAATAAATCAAATGTTTTGAAATGGTTTTGTGGTTAAATAAATCTTAANCAAANCNTANNNAAAA
  5   1   2       bld Emb4 5x3               IMAGE:4959047-IMAGp.IMAGp                                                            GCTGCAGAGATGGCGTACCGCGGACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCACGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCCACCGCTGTTCCCAAACATCTGCATCTGTGGAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCATAATTCCTGCATGGATTACGCTGAAACttttttttatatatatatattttttAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACttttttttttCCCCCAAAGAGAGTAACTTTTTGATACTGAACTCAAATAAATCAAATGTTTTGAAATGGTTTTGTGGTTAAATAAATCTTAAACAAAACATACaaaaaaaaaaaaaaa
  3   1   2      seed Egg1 5g3  in                    IMAGE:4783854.3p                                                                     ATGGCGTACCGCGGACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCGACCGCTGTTCCCAAACATCTGCATCTGTGAAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCCTAATGCCTGCATGGATTACGCTGAAACTTTTTTTTTTATATATATATTTTTTAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACTTTTTTTTCCCCCCAAAGAGAGTAACTTTTTGATACTGAATTCAAATAAATCAAATGTTTTTAAAA
  5   1   2       bld Ga15 5g3  in                       XL485n10ex.5p                                                                       GGCGTACCGCGGACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCGACCGCTGTTCCCAAACATCTGCATCTGTGAAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCCTAATGCCTGCATGGATTACGCTGAAACttttttttttatatatatattttttAAAATCATCTGAGTATAATTTCAGGNGTTGAAGGCAATTGCATANAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACttttttttCCCCCCAAANANAGTAACTTTTTGATACTGAATTCAAATAAATCAAATGTTTTTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL412a22ex.3p                                                                           CCGCGCGGACAGGGGCAGAAAGTGCAGAAAGTGATGGNGCAGCCCATCAATTTGATNNTCAGGTATTTACAAAANAGATCACGGGTTCAAGNGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGANGATGCAGAAGAAATCCATCTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCNCTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCGNCCGCTGTTCCCAAACATCTGCATNTGTGAAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTANGTCCTAATGCCTGCATGGATTACGCTGAAACTTTTTTTTTTATATATATATTTTTTAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACTTTTTTTTCCCCCCAAAGAGAGTAACTTTTTGATACTGAACTCGAAATA
  5   1   2       bld Ga15      in                       XL412a22ex.5p                                                                              CGCGGACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCGACCGCTGTTCCCAAACATCTGCATCTGTGAAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCCTAATGCCTGCATGGATTACGCTGAAACttttttttttatatatatattttttAAAATCATCTGAGTATAATTTCAGGNGTTGAAGGCAATTGCATANAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACttttttttCCCCCCAAAGANAGTAACTTTTTGATACTGAACTCAAATAAATCAAATGTTTTGAAATGGTTTTGNGGTTAAATAAATCTTAAACAAAACATaaaaaaaaaa
  5   1   2       bld Ga18      in                      xlk111c23ex.5p                                                                                   ACAGGGGCAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCGACCGCTGTTCCCAAACATCTGCATCTGTGAAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCCTAATGCCTGCATGGATTACGCTGAAACttttttttttatatatatattttttAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTNCATAGAAACTGATGTCACTGCNAGGATTATTCGGTTGTGTNCAAAATGTTAAAACttttttttCCCCCCNAAGAGAGTANNTTTTTGATACTGAATTCAAATAAATCAAATGTTTTTAAATNGNTTTGTNGNTAAATAATCTTAAACAAAATGTACAATTTaaaaaaaaaa
  5   1   2       bld Ga12                                 XL155f08.5p                                                                                          GAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCGACCGCTGTTCCCAAACATCTGCATCTGTGAAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCCTAATGCCTGCATGGATTACGCTGAAACtttttttttatatatatattttttAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACttttttttCCCCCCAAAGAGAGTAACTTTTTGATACTGAACTCAAATAAATCAAATGTTTTGAAATGGTTTTGTGGTTAAATAAATCTTAAACAAAACATACaaaaaaaaaa
  5   1   2       bld Te2N                            IMAGE:7767396.5p                                                                                          CAGAAAGTGCAGAAAGTGATGGTGCAGCCCATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCCACCGCTGTTCCCAAACATCTGCATCTGTGGAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCATAATTCCTGCATGGATTACGCTGAAACttttttttatatatatatattttttAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACtttttttttCCTCCCAAAGAGAGTAACTTTTTGATACTGAACTCAAATAAATCAAATGTTTTGAAATGGTTTTGTGGTTAAATAAATCTTAAACAAAACATACCNNANANNaaaaaaaaaaaaaaaaaaaaaaGGG
  3   1   2       bld Egg6                            IMAGE:4434990.3p                                                                                                                        ATCAATTTGATCTTCAGGTATCTACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCACGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAGTCTGTTCCCCACCGCTGTTCCCAAACATCTGCATCTGTGGAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCATAATTCCTGCATGGATTACGCTGAAACTTTTTTTTATATATATATATTTTTTAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACTTTTTTTTTTCCCCCAAAGAGAGTAACTTTTTGATACTGAACTCAAATAAATCAAATGTTTT
  3   1   2       bld Ga18      in                      xlk123f01ex.3p                                                                                                                                               ACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCGACCGCTGTTCCCAAACATCTGCATCTGTGAAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCCTAATGCCTGCATGGATTACGCTGAAACTTTTTTTTTATATATATATTTTTTAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAANCTTTTTTTTCCCCCCAAAGAGAGTANNNNTTGATACTGA
  5   1   2       bld Ga18      in                      xlk123f01ex.5p                                                                                                                                               ACAAAATAGATCACGGGTTCAAGTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCAAGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCGACCGCTGTTCCCAAACATCTGCATCTGTGAAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGACTATTCTGTAGATTTGTAGCTATGTCCTAATGCCTGCATGGATTACGCTGAAACtttttttttatatatatattttttAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACttttttttCCCCCCAAAGAGAGTAACTTTTTGATACTGAATTCAAATAAATCAAATGTTTTT
  3   1   2       bld Emb4      in                    IMAGE:4959047.3p                                                                                                                                                                     GTGTGGTTGTATGAGCAAGTCAATATGCGTATTGAAGGCTGCATCATTGGCTTTGATGAGTACATGAATATAGTGCTGGATGATGCAGAAGAAATCCATCTCAAAACAAAGTCACGAAAACAGCTCGGGCGTATCATGTTGAAAGGCGATAACATCACTTTGCTACAGAGTGTCATGAATTAATCTGTTCCCCACCGCTGTTCCCAAACATCTGCATCTGTGGAGGAATTTATCAGTACTCCCCCCGTTTATGGACTTGTGGAATATTCTGTAGATTTGTAGCTATGTCATAATTCCTGCATGGATTACGCTGAAACTTTTTTTTATATATATATATTTTTTAAAATCATCTGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCATTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACTTTTTTTTTTCCCCCAAAGAGAGTAACTTTTTGATACTGAACTCAAATAAATCAAATGTTTTGAAATGGTTTTGTGGTTAAATAAATCTTAAACAAAACATTC
  3   1   2       bld Ga18                             rxlk116j22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTTNAAANCATCNGAGTATAATTTCAGGTGTTGAAGGCAATTGCATAGAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACTTTTTTTTTCCCCCCAAAGAGAGTAACTTTTTGATACTGAATTCAAATAANTCAAA
  3   1   2       bld Ga15      in                       XL468e05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACTTTTTTTTCCCCCCAAAGAGAGTAACTTTTTGATACTGAATTCAAATAAATCAAATGTTT
  5   1   2       bld Ga15      in                       XL468e05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAACTGATGTCACTGCAAGGATTATTCGGTTGTGTACAAAATGTTAAAACttttttttCCCCCCAAAGAGAGTAACTTTTTGATACTGAATTCAAATAAATCAAATGTTTTTAAATGGTTTTGTGGTTAAATAATCTTAAACAAAATGTACAATTTaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)