Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-PBX0039H06.5                          3 END     1           2       33                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012770637 Xl3.1-IMAGE:6317695.5 - 41 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                       3     3     3     4     3     4     4     5     4     5     4     7     4     9     6    11     7    12     7    12     8    13    13    14    12    13    14    15    13    15    14    15    14    15    14    15    14    15    14    15    13    15    14    15    14    15    13    15    15    17    14    17    15    17    15    17    15    17    15    18    16    18    18    19    19    20    19    20    17    20    19    20    19    20    19    20    19    20    19    20    19    20    19    20    18    19    18    19    17    19    18    19    18    19    15    19    15    18    14    17    14    17    13    16    12    16    12    16    11    15    11    15    12    16    11    15    10    15    10    15    10    15    10    14    10    14    11    15    13    15    11    14    11    14    11    14    11    14    11    14    11    14     9    13     8    11     6    11     6    10     6    10     5    10     6    10     6     9     6     9     6     9     6     8     6     8     5     8     5     8     5     8     5     6     7     8     7     9     7     9     8    10     8    11    10    12    12    13    12    13    14    16    15    16    16    16    16    16    14    16    15    16    15    16    15    16    16    17    16    17    16    17    16    17    14    17    15    17    15    17    14    17    15    16    14    16    15    16    15    16    16    17    15    16    15    16    15    16    15    16    15    17    16    17    16    17    15    17    16    17    15    17    15    17    16    17    15    16    15    16    14    16    15    16    15    16    15    16    15    17    14    15    14    15    13    15    14    15    14    15    13    15    12    13     9    10     9    10     5     7     2     4     2     4
                                                                   VAR                                                                                                          TGAAGAGACGGA
                                                                   VAR                                                                                                                      CAGCAGGGCATTTGCTGTGTCACCACAGAGCTACACCAGTGCCAAAAA
                                                                   SNP                                                                                                                                                                      G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------A---
                                               BLH ATG      38     576                                  
                                               BLH MIN      35     326                                  
                                               BLH OVR     110     155                                  
                                               ORF LNG     110      49                                  
  5   1   2       bld Ga12      in                         XL189i06.5p                                                                                                                                                                                                                                                                                                                                                                                                                    TGGAATGAAGCCAAAGAGAATATTAGAGCAGCAGTGTCTGTGGGCTGTANGCAGATGCAAGATATGGAGATTGCTCAGGTAGAAGTGGACCCATGTGGAGATGCACAGGCTGCTGCTGAANGAGCTGTCCTTGGACTGTTTGAATATGATGAACTGAANAAGAAAAAGAAGAAAGCAGTTACCACTCNTCTTCATGGAAGTGAGCACAAG
  5   1   2       bld Ga15                               XL509p04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAATTTGCAGAGATATTTGAACAGAAGTTGGCAAGTATGGACAGCAGTGTTAAGGTGTTTACCAGATCAAAACCATGGATTGAAGAACAACAAATGGGGGCATTCCTAAGTGTGGCCAAAGGATCTGAAGAGCCACCGATCTTCCTGGAAATTCATTACAGCGGTAGCTCTGATGCAAGCCAGCCTCCTCTAGTATTTGTTGGAAAAGGAGTCACATTTGACAGTGGTGGAATTTCACTGAAACCTTCTTCGGGCATGGATGCAATGAGAGCTGATATGGGTGGAGCTGCTACTATTTGTTCTGCCATCATGATTGCTGCAAAGCTTAAGTTACCTATCAATATTATCGGTCTGGCTCCTCTGTGTGAAAATATGCCAAGTGGAGGAGCAAATAAACCTGGAGATGTGGTCAAGGCTAAGAATGGGAAGACCATTCAGGTTGACAATACTGATGCAGAAGGAAGACTCATTTTAGCTGATGCTCTCTGTTATGCACACAGTTTTAATCCAAGAGCGATTGTTAATGCTGCAACATTAACAGGTGCAATGGATGTGGCGTTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCANGAGGCCANTGTTATTACCGGGGACCGTGTATGGANAATGCCNCTATTTGANCACTACNNCAAACAAGTCACTGAATCNGCTCTTGCANACCTGAACAATATTNG
  5   1   2       bld Tbd7      in                         XL067i10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGATTGAAGAACAACAAATGGGGGCATTCCTAAGTGTGGCCAAAGGATCTGAAGAGCCACCGATCTTCCTGGAAATTCATTACAGCGGTAGCTCTGATGCAAGCCAGCCTCCTCTAGTATTTGTTGGAAAAGGAGTCACATTTGACAGTGGTGGAATTTCACTGAAACCTTCTTCGGGCATGGATGCAATGAGAGCTGATATGGGTGGAGCTGCTACTATTTGTTCTGCCATCATGATTGCTGCAAAGCTTAAGTTACCTATCAATATTATCGGTCTGGCTCCTCTGTGTGAAAATATGCCAAGTGGAGGAGCAAATAAACCTGGAGATGTGGTCAAGGCTAAGAATGGGAAGACCATTCAGGTTGACAATACTGATGCAGAAGGAAGACTCATTTTAGCTGATGCTCTCTGTTATGCACACAGTTT
  5   1   2       bld Tad2                            IMAGE:6935290.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGGGCATTCCTAAGTGTGGCCAAAGGATCTGAAGAGCCACCGATCTTCCTGGAAATTCATTACAGCGGTAGCTCTGATGCAAGCCAGCCTCCTCTAGTATTTGTTGGAAAAGGAGTCACATTTGACAGTGGTGGAATTTCACTGAAACCTTCTTCGGGCATGGATGCAATGAGAGCTGATATGGGTGGAGCTGCTACTATTTGTTCTGCCATCATGATTGCTGCAAAGCTTAAGTTACCTATCAATATTATCCGTCTGGCTCCTCTGTGTGAAAATATGCCAAGTGGAGGAGCAAATAAACCTGGAGACGTGGTCAAGGCTACGAATGGGAAGACCATTCAGGTTGACAATACTGATGCAGAAGGAAGACTCATTTTAGCTGATGCTCTCTGTTATGCACACAGTTTTAATCCAAGAGCGATTGTTAATGCCGCAACATTAACAGGTGCAATGGATGTGGCGTTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAGGCCCAGTGTATTACCGGGGGACCGTGTATGGAAGAATGCCGCTATTTTGAGCACTACCGCAAACAAGGTCACTGGAATCGGGCTCTTTGCCAGACCCGAAACAATATTGGGAAAAATACAGAATCTGGGAAGAAGCTTGCAACAGCCCCCTGCCCTTTCCCTGAAAGGAGTTTTGGTCACCTGCCTCCCCTCACCGGGGGCTTCCATCCTGGGAATATTTGCCCTGGCGCTTGAATTGTCCAATAAAAGGGAC
  3   1   2       bld Tad1      out                   IMAGE:6878096.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTTAATGTTTTTGTTACCTTTTTAATTCCGTGTTTTTTTGTGTAAGGGTTTCTGTACATATCACTGAAAAAATGTAAAACATTCATGGTGCATAAATCAAGGGTAAGCTTTTGTTTCAGAGCTGCTACTATTTGTTCTGCCATCATGATTGCTGCAAAGCTTAAGTTACCTATCAATATTATCGGTCTGGCTCCTCTGTGTGAAAATATGCCAAGTGGAGGAGCAAATAAACCTGGAGATGTGGTCAAGGCTAAGAATGGGAAGACCATTCAGGTTGACAATACTGATGCAGAAGGAAGACTCATTTTAGCTGATGCTCTCTGTTATGCACACAGTTTTAATCCAAGAGCGATTGTTAATGCTGCAACATTAACAGGTGCAATGGATGTGGCGTTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAGGCCAGTGTTATTACCGGGGACCGTGTATGGAGAATGCCGCTATTTGAGCACTACAGCAAACAAGTCACTGAATCGGCTCTTGCAGACCTGAACAATATTGGAAAATACAGATCTGGAGGAGCCTGCACAGCCGCTGCCTTCCTGAAAGAGTTTGTCACTGCTCCTCACTGGGCTCATCTGGATATTGCTGGCGTGATGTCAAATAAGGACGAGGTTCCGTACCTTCGCAAAGGCATGTCAGGCCGCCCCACAAGGACATTGATAGAATTTGCTACTCGTCTTAGTGAAGACAATCAGACTGTTTAATTAACACACAGCATTCTTGTACCTACATTTGACTGAAAGCCTAAATGAAACTAAATCAACATAATGTTATGGTGCTATTTGTTTTTTCACAGAACAAATTTGCAAT
  3   1   2       bld Ga15      in                       XL437g07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGAAAATATGCCAAGTGGAGGAGCAAATAAACCTGGAGATGTGGTCAAGGCTAAGAATGGGAAGACCATTCAGGTTGACAATACTGATGCAGAAGGAAGACTCATTTTAGCTGATGCTCTCTGTTATGCACACAGTTTTAATCCAAGAGCGATTGTTAATGCTGCAACATTAACAGGTGCAATGGATGTGGCGTTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAGGCCAGTGTTATTACCGGGGACCGTGTATGGAGAATGCCGCTATTTGAGCACTACAGCAAACAAGTCACTGAATCGGCTCTTGCAGACCTGAACAATATTGGAAAATACAGATNTGGAGGAGCCTGCACAGCCGCTGCCTTCCTGAAAGAGTTTGTCACTGCTCCTCACTGGGCTCATCTGGATATTGCTGGCGTGATGTCAAATAAGGACGAGGTTCCGTACCTTCGCAAAGGCATGTCAGGCCGCCCCACAAGGACATTGATAGAATTTGCTACTCGTCTTAGTGAAGACAATCAGACTGTTTAATTAACACACAGCATTCTTGTACCTACATTTGACTGAAAGCCTAAATGAAACTAAATCAACATAATGTTATGGTGCTATTTGTATTTTTCACAGAACAAATTTTGCATATATCTAAT
  5   1   2       chi Lmb2                            IMAGE:8639294.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGAAAATATGCCAAGTGGAGGAGCAAATAAACCTGGAGATGTGGTCAAGGCTAAGAATGGGAAGACCATTCAGGTTGACAATACTGATGCAGAAGGAAGACTCATTTTAGCTGATGCTCTCTGTTATGCACACAGTTTTAATCCAAGAGCGATTGTTAATGCTGCAACATTAACAGGTGCAATGGATGTGGCGTTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAGGCCAGTGTTATTACCGGGGACCGTGTATGGAGAATGCCGCTATTTGAGCACTACAGCAAACAAGTCACTGAATCGGCTCTTGCAGACCTGAACAATATTGGAAAATACAGATCTGGAGGAGCCTGCACAGCCGCTGCCTTCCTGAAAGAGTTTGTCACTGCTCCTCACTGGGCTCATCTGGATATTGCTGGCGTGATGTCAAATAAGGACGAGGTTCCGTACCTTCGCTCAGGCATGTCGCGCCTCCCGACCAGGATCTTGTTTTAATTATCTACTCTTCTTTCTGAAACAATCCAACTGTTTGATTCTTCTTTCTATTCATTTATCTACTTTTTCTGATAACAATTGTATCATTCAAAATATACTCATTTCTATCATTTCTCCCCTGCCTGTTCCCCTTTCGGATTCTTTCTTCTCCTCTTGattttatctttacctttttattctttttatttttgctttctcatttaTCAGCATTACTATTTATCTTTACGTTCTANCTGATAGTTTATCATTAATTATCtttttttttctctcttttttttttt
  3   1   2       bld Gas6      in                    IMAGE:3473447.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGAGATCCAAATGACCTGGATATGTGGTGAGGGCTAAGAAGGCGACACCCTTCAGGGTTGTCAATACTGATACAGAAGGACGACTCATGTAGCCTGATGCTTTCTGTTATGCACACAGTTTTAATCCAAGAGCGATTGTTAATGCTGCAACATTAACAGGTGCAATGGATGTGGCGTTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAGGCCAGTGTTATTACCGGGGACCGTGTATGGAGAATGCCGCTATTTGAGCACTACAGCAAACAAGTCACTGAATCGGCTCTTGCAGACCTGAACAATATTGGAAAATACAGATNTGGAGGAGCCTGCACAGCCGCTGCCTTCCTGAAAGAGTTTGTCACTGCTCCTCACTGGGCTCATCTGGATATTGCTGGCGTGATGTCAAATAAGGACGAGGTTCCGTACCTTCGCAAAGGCATGTCAGGCCGCCCCACAAGGACATTGATAGAATTTGCTACTCGTCTTAGTGAAGACAATCAGACTGTTTAATTAACACACAGCATTCTTGTACCTACATTTGACTGAAAGCCTAAATGAAACTAAATCAACATAATGTTATGGTGCTATTTGTATTTTTCACAGAACAAATTTTGCAAA
  3   1   2       bld Neu7      in                         XL036l03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAGGCTAAGAATGGGAAGACCATTCAGGTTGACAATACTGATGCAGAAGGAAGACTCATTTTAGCTGATGCTCTCTGTTATGCACACAGTTTTAATCCAAGAGCGATTGTTAATGCTGCAACATTAACAGGTGCAATGGATGTGGCGTTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAGGCCAGTGTTATTACCGGGGACCGTGTATGGAGAATGCCGCTATTTGAGCACTACAGCAAACAAGTCACTGAATCGGCTCTTGCAGACCTGAACAATATTGGAAAATACAGATCTGGAGGAGCCTGCACAGCCGCTGCCTTCCTGAAAGAGTTTGTCACTGCTCCTCACTGGGCTCATCTGGATATTGCTGGCGTGATGTCAAATAAGGACGAGGTTCCGTACCTTCGCAAAGGCATGTCAGGCCGCCCCACAAGGACATTGATAGAATTTGCTACTCGTCTTAGTGAAGACAATCAGACTGTTTAATTAACACACAGCATTCTTGTACCTACATTTGACTGAAAGCCTAAATGAAACTAAATCAACATAATGTTATGGTGCTATTTGTATTTTTCACAGAACAAATTTTGCATATATCCAATTACATGTACTAGATTTAACAAATAAAAAAAAAA
  3   1   2       bld DMZ       in                         xl251c04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACGAGGGGGAAGNCCNTTCAGGTTGACAATACTGATGCAGAAGGAAGACTCATTTTAGCTGATGCTCTCTGTTATGCACACAGTTTTAATCCAAGAGCGATTGTTAATGCNGCANCATTAACAGGTGCAATGGATGTGGCGTTAGGATCTGCNGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCNGGAGGCCAGTGTTATTNCCGGGGACCGTGTATGGAGAATGCCGCTATTTGAGCACTACAGCAAACAAGTCACTGAATCGGCTCTTGCAGACCTGAACAATATTGGAAAATACAGATCTGGAGGAGCCTGCACAGCCGCTGCCTTCCTGAAAGAGTTTGTCNCTGCTCCTCACTGGGCTCATCTGGATATNGCTGGCGTGATGTCAAATAAGGACGAGGTTCCGTACCTTNGCAAAGGCATGTCAGGCCGCCCCACAAGGACATTGATAGAATTTGCTACTCGTNTTAGTGAAGACAATCAGNCTGTTTAATTAACACNCAGCNTTCTTGTACCTACATTTGACTGAAAGCCTAAATGAANCTAAATCAACATAATGTTATGGTGCTATTTGTATTTTTCACAGAACNAATTT
  5   1   2      seed DMZ       in                         xl251c04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGAAGACCATTCAGGTTGACAATACTGATGCAGAAGGAAGACTCATTTTAGCTGATGCTCTCTGTTATGCACACAGTTTTAATCCAAGAGCGATTGTTAATGCTGCAACATTAACAGGTGCAATGGATGTGGCGTTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAGGCCAGTGTTATTACCGGGGACCGTGTATGGAGAATGCCGCTATTTGAGCACTACAGCAAACAAGTCACTGAATCGGCTCTTGCAGACCTGAACAATATTGGAAAATACAGATCTGGAGGAGCCTGCACAGCCGCTGCCTTCCTGAAAGAGTTTGTCACTGCTCCTCACTGGGCTCATCTGGATATTGCTGGCGTGATGTCAAATAAGGACGAGGTTCCGTACCTTCGCAAAGGCATGTCAGGCCGCCCCACAAGGACATTGATAGAATTTGCTACTCGTCTTAGTGAAGACAATCAGACTGTTTAATTAACACACAGCATTCTTGTACCTACATTTGACTGAAAGCCTAAATGAAACTAAATCAACATAATGTTATGGTGCTATTTGTATTTTTCACAGAACAAATTTTGCATATATCTAATTACATGTACTAGATTTAACAAATaaaaaaaaaattgcatttttgtggtaaaaaaattaaaaagaaacaaaaaaaaaa
  5   1   2       bld Egg1                               PBX0032D11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTGACAATACTGATGCAGAAGGAAGACTCATTTTAGCTGATGCTCTCTGTTATGCACACAGTTTTAATCCAAGAGCGATTGTTAATGCTGCAACATTAACAGGTGCAATGGATGTGGCGTTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAGGCCAGTGTTATTACCGGGGACCGTGTATGGAGAATGCCGCTATTTGAGCACTACAGCAAACAAGTCACTGAATCGGCTCTTGCAGACCTGAACAATATTGGAAAATACAGATCTGGAGGAGCCTGCACAGCCGCTGCCTTCCTGAAAGAGTTTGTCACTGCTCCTCACTGGGCTCATCTGGATATTGCTGGCGTGATGTCAAATAAGGACGAGGTTCCGTACCTTCGCAAAGGCATGTCAGGCCGCCCCACAAGGACATTGATAGAATTTGCTACTCGTCTTAGTGAAGACAATCAGACTGTTTAATTAACACACAGCATTCTTGTACCTA
  5   1   2       bld Egg1                               PBX0029D11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGACTCATTTTAGCTGATGCTCTCTGTTATGCACACAGTTTTAATCCAAGAGCGATTGTTAATGCTGCAACATTAACAGGTGCAATGGATGTGGCGTTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAGGCCAGTGTTATTACCGGGGACCGTGTATGGAGAATGCCGCTATTTGAGCACTACAGCAAACAAGTCACTGAATCGGCTCTTGCAGACCTGAACAATATTGGAAAATACAGATCTGGAGGAGCCTGCACAGCCGCTGCCTTCCTGAAAGAGTTTGTCACTGCTCCTCACTGGGCTCATCTGGATATTGCTGGCGTGATGTCAAATAAGGACGAGGTTCCGTACCTTCGCAAAGGCATGTCAGGCCGCCCCACAAGGACATTGATAGAATTTGCTACTCGTCTTAGTGAAGACAATCAGACTGTTTAATTAACACACAGCATTCTTGTACCTACATTTGACTGAAAGCCTAAATGAAACTAAATCAACATAATGTTATGGTGCTATTTGTATTTTTCACAGAACAAATTTTGCATATATCTAATTACATGTACTAGATTTAACANATaaaaaaaaaattgcaaaaaaaaaaaaaaaa
  5   1   2       bld Egg1                               PBX0031C11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGACTCATTTTAGCTGATGCTCTCTGTTATGCACACAGTTTTAATCCAAGAGCGATTGTTAATGCTGCAACATTAACAGGTGCAATGGATGTGGCGTTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAGGCCAGTGTTATTACCGGGGACCGTGTATGGAGAATGCCGCTATTTGAGCACTACAGCAAACAAGTCACTGAATCGGCTCTTGCAGACCTGAACAATATTGGAAAATACAGATCTGGAGGAGCCTGCACAGCCGCTGCCTTCCTGAAAGAGTTTGTCACTGCTCCTCACTGGGCTCATCTGGATATTGCTGGCGTGATGTCAAATAAGGACGAGGTTCCGTACCTTCGCAAAGGCATGTCAGGCCGCCCCACATGGACATTGATAGAATTTGCTACTCGTCTTAGTGAAGACAATCAGACTGTTTAATTAACACACAGCATTCTTGTACCTACATTTGACTGAAAGCCTAAATGAAACTAAATCAACATAATGTTATGGTGCTATTTGTATTTTTCACAGAACAAATTTTGCATATATCTAATTACATGTACTAGATTTAA
  3   1   2       bld Egg2                            IMAGE:5279098.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCATTTTAGCTGATGCTCTCTGTTATGCACACAGTTTTAATCCAAGAGCGATTGTTAATGCTGCAACATTAACAGGTGCAATGGATGTGGCGTTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAGGCCAGTGTTATTACCGGGGACCGTGTATGGAGAATGCCGCTATTTGAGCACTACAGCAAACAAGTCACTGAATCGGCTCTTGCAGACCTGAACAATATTGGAAAATACAGATCTGGAGGAGCCTGCACAGCCGCTGCCTTCCTGAAAGAGTTTGTCACTGCTCCTCACTGGGCTCATCTGGATATTGCTGGCGTGATGTCAAATAAGGACGAGGTTCAGTACCTTCGCAAAGGCATGTCAGGCCGCCCCACAAGGACATTGATAGAATTTGCTACTCGTCTTAGTGAAGACAATCAGACTGTTTAATTAACACACAGCATTCTTGTACCTACATTTGACTGAAAGCCTAAATGAAACTAAATCAACATAATGTTATGGTGCTATTTGTATTTTTCACAGAACAAATTTTGCATATATCTAATTACATGTACTAGATTTAACAAATAAAAAAAAAATTGCGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg6      in                    IMAGE:4435959.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCTGTTATGCACACAGTTTTAATCCAAGAGCGATTGTTAATGCTGCAACATTAACAGGTGCAATGGATGTGGCGTTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAGGCCAGTGTTATTACCGGGGACCGTGTATGGAGAATGCCGCTATTTGAGCACTACAGCAAACAAGTCACTGAATCGGCTCTTGCAGACCTGAACAATATTGGAAAATACAGATCTGGAGGAGCCTGCACAGCCGCTGCCTTCCTGAAAGAGTTTGTCACTGCTCCTCACTGGGCTCATCTGGATATTGCTGGCGTGATGTCAAATAAGGACGAGGTTCCGTACCTTCGCAAAGGCATGTCAGGCCGCCCCACAAGGACATTGATAGAATTTGCTACTCGTCTTAGTGAAGACAATCAGACTGTTTAATTAACACACAGCATTCTTGTACCTACATTTGACTGAAAGCCTAAATGAAACTAAATCAACATAATGTTATGGTGCTATTTGTATTTTTCACAGAACAAATTTTGCATATATCTAAT
  3   1   2       bld Neu7                                 XL007h21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTTATGCACACAGTTTTAATCCAAGAGCGATTGTTAATGCTGCAACATTAACAGGTGCAATGGATGTGGCGTTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAGGCCAGTGTTATTACCGGGGACCGTGTATGGAGAATGCCGCTATTTGAGCACTACAGCAAACAAGTCACTGAATCGGCTCTTGCAGACCTGAACAATATTGGAAAATACAGATCTGGAGGAGCCTGCACAGCCGCTGCCTTCCTGAAAGAGTTTGTCACTGCTCCTCACTGGGCTCATCTGGATATTGCTGGCGTGATGTCAAATAAGGACGAGGTTCAGTACCTTCGCAAAGGCATGTCAGGCCGCCCCACAAGGACATTGATAGAATTTGCTACTCGTCTTAGTGAAGACAATCAGACTGTTTAATTAACACACAGCATTCTTGTACCTACATTTGACTGAAAGCCTAAATGAAACTAAATCAACATAATGTTATGGTGCTATTTGTATTTTTCACAGAACAAATTTTGCATATATCTAATTACATGTACTAGATTTAACAA
  3   1   2       bld Tbd7      in                         XL067i10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAGGCCAGTGTTATTACCGGGGACCGTGTATGGAGAATGCCGCTATTTGAGCACTACAGCAAACAAGTCACTGAATCGGCTCTTGCAGACCTGAACAATATTGGAAAATACAGATCTGGAGGAGCCTGCACAGCCGCTGCCTTCCTGAAAGAGTTTGTCACTGCTCCTCACTGGGCTCATCTGGATATTGCTGGCGTGATGTCAAATAAGGACGAGGTTCAGTACCTTCGCAAAGGCATGTCAGGCCGCCCCACAAGGACATTGATAGAATTTGCTACTCGTCTTAGTGAAGACAATCAGACTGTTTAATTAACACACAGCATTCTTGTACCTACATTTGACTGAAAGCCTAAATGAAACTAAATCAACATAATGTTATGGTGCTATTTGTATTTTTCACAGAACAAATTTTGCATATATCTAATTACATGTACTAGAATTTAACAAATAAAAAAAAAA
  3   1   2       bld Sp1       in                    IMAGE:4175162.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTGCAGACCTGAACAATATTGGAAAATACAGATCTGGAGGAGCCTGCACAGCCGCTGCCTTCCTGAAAGAGTTTGTCACTGCTCCTCACTGGGCTCATCTGGATATTGCTGGCGTGATGTCAAATAAGGACGAGGTTCCGTACCTTCGCAAAGGCATGTCAGGCCGCCCCACAAGGACATTGATAGAATTTGCTACTCGTCTTAGTGAAGACAATCAGACTGTTTAATTAACACACAGCATTCTTGTACCTACATTTGACTGAAAGCCTAAATGAAACTAAATCAACATAATGTTATGGTGCTATTTGTATTTTTCACAGAACAAATTTTGCATATATCTAATTACATGTACTAGATTTAACA
  3   1   2       bld Ga12      in                         XL189i06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CNTGAAAGAGTTTGTCACTGNTCCTCACTGGGCTCATCTGGATATTGCTGGCGTGANGTCAAATAAGGANGAGGTTCNGTACCTTCGCAAAGGCATGTCAGGCCGCCCCACAAGGACATTGATAGAATTTGNTACTCGTCTTAGTGAAGACAATCAGACTGTTTAATTAACACACAGCATTCTTGTACCTACATTTG
  3   1   2       bld Egg1                               PBX0004F06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACACAGCATTGTTGTACCTACATTTGTCTCAAAGCCTAAATGAAAGTAAACCAACATAATGTTATGGTGCTATTTGTATTTTTCCCAGATCAAATTTTGCATATATCTAATTACATGTACTAGATTTAACAAATAAAAAAAAAATTGCAAAAAAAAAAAAAAAAAAAGATTC

In case of problems mail me! (