Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8070322.3                      13 END     8          53       61                MGC82128 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl291l02.5.5                         28 PI      90         32      741                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012770701 Xl3.1-xl225l09.5 - 15 ESTs
                                                                       .......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl225l09.5                                                GGTAACGGCGCTTGATCTGTTGCGTTGGTCGTGGCTGCTGTTGCTGATTTCCTATTTGCTTCTAAAGCGTCTGACCTAATTGAGGCCACTGAGCGTGCGTCTGTCTGGCTTCTTCTGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACCAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACGCAAGAAGTGGAAAAGACACAGAGTACAGTGAAAGAATCAGCTGCTGAAGAGAAACTGACCCCGGTTGCATTGGCCAAACAAGTAGCTTCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAATTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGCGGCCAAAACTAGAAAAAAT
                                                  Xl3.1-CHK-1012691766                                                      GGCGCTTGATCTGTTGCGTTGGTCGTGGCTGCTGTTGCTGATTTCCTATTTGCTTCTAAAGCGTCTGACCTAATTGAGGCCACTGAGCGTGCGTCTGTCTGGCTTCTTCTGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACCAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACGCAAGAAGTGGAAAAGACACAGAGTACAGTGAAAGAATCAGCTGCTGAAGAGAAACTGACCCCGGTTGCATTGGCCAAACAAGTAGCTTCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAATTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGCGGCCAAAACTAGAAAAAATCAGAAA
                                                      consensus depths                                                     2     3     3     5     3     7     6    11     9    12    10    13    10    13    11    14    11    14    11    14    12    15    12    15    12    15    12    15    12    15    12    15    12    15    12    15    12    15    12    15    12    15    12    15    12    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    13    12    13    12    13    12    13    12    13    11    12    11    12    10    11    10    11    10    11     9    11     8    10     6     8
                                                                   SNP                                                                                                                                                                                                                                                                                                --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                    --G-T-------
                                               BLH ATG     177     502                                                
                                               BLH MIN     177      88                                                
                                               BLH MPR     165      88                                                
                                               BLH OVR     177     749                                                
                                               CDS MIN     177      88                                                
                                               EST CLI       8       2                                                
                                               ORF LNG     177      19                                                
  5   1   2       bld Brn1 5g3  out                   IMAGE:4740460.5p CGCTTGAGTCTCGCGAGGTTTCTATTATTGCCGGTTTTGTCACATTCGGTAACGGCGCTTGATCTGTTGCGTTGGTCGTGGCTGCTGTTGCTGATTTCCTATTTGCTTCTAAAGCGTCTGACCTAATTGAGGCCACTGAGCGTGCGTCTGTCTGGCTTCTTCTGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACCAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGGAGCTGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAG
  5   1   2       bld Tbd7      ?                          XL069e04.5p                        GTNACATTCGGTAACGGCGCTTGATCTGTTGCGTTGGTCGTGGCTGCTGTTGCTGATTTCCTATTTGCTTCTAAAGCGTCTGACCTAATTGAAGCCACTGAGAGTGCGTCTGTCTGGCTTCTTCTGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACCAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGTTTGCACAAGAGCTGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACGCAAGAAGTGGAAAAGACACAGAGTACAGTGAAAGAATCAGCTGCTGAAGAGAAACTGACCCCGGTTGCATTGGCCAAACAAGTAGCTTCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTGCTGG
  5   1   2       bld FaBN 5g                         IMAGE:8077856.5p                                              TCGGTAACGGCGCTTGATCTGTTGCGTTGGTCGTGGCTGCTGTTGCTGATTTCCTATTTGCTTCTAAAGCGTCTGACCTAATTGAGGCCACTGAGCGTGCGTCTGTCTGGCTTCTTCTGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACCAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACGCAAGAAGTGGAAAAGACACAGAGTACAGTGAAAGAATCAGCTGCTGAAGAGAAACTGACCCCGGTTGCATTGGCCAACAAGTAGCTTCTTTAAAACAGCATTTAGTGTCACTCATTATAGAAATGCTGGGCCCAGAGCTGCATCATTTGATGACCAAATGTGCCCTGCAAACATTGCTATTATTGGATGCGCAAACTAAAAAACCAAAGAAAACCCTCAAGGGCTTGCCA
  5   1   2       bld Te2N                            IMAGE:7204683.5p                                                   GCTTGATCTGTTGCGTTGGTCGTGGCTGCTGTTGCTGATTTCCTATTTGCTTCTAAAGCGTCTGACCTAATTGAGGCCACTGAGCGTGCGTCTGTCTGGCTTCTTCTGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGGAGCTGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACGCAAGAAGTGGAAAAGACACAGAGTACAGTGAAAGAATCAGCTGCTGAAGAGAAACTGACCCCGGTTGCATTGGCCAAACAAGTAGCTTCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAATTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGCGGCCAAAACTAGAAAAAATCAGAAAGAAAAGCCCTGCAAAGGGTCTGGGCCAAAACTGAGAACTTGNTGACGTAGAATTAACATGTCGTCCGTGAGCAAACAAGTCTCTCAAGCTGCAAAGATGCTGAACTAAGAAAGGCTGGGGGGGAAGCTGCAAGGTGGGCGAGGGGTT
  5   1   2       bld Kid  5g                         IMAGE:7012124.5p                                                        CGCTTGATCTGTTGCGTTGGTCGTGGCTGCTGTTGCTGATTTCCTATTTGCTTCTAAAGCGTCTGACCTAATTGAGGCCACTGAGCGTGCGTCTGTCTGGCTTCTTCTGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACGCAAGAAGTGGAAAAGACACAGAGTACAGTGAAAGAATCAGCTGCTGAAGAGAAACTGACCCCGGTTGCATTGGCCAAACAAGTAGCTTCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAATTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGNTGGATGCGGCCAANACTAG
  5   1   2       bld Ga12 5g3  out                        XL145k14.5p                                                                    CTGCAGGNAATTCGGCACGAGGCCTGATTTCCTATTTGCTTCTAAAGCGTCTGACCTAATTGAGGCCACTGAGCGTGCGTCTGTCTGGCTTCTTCTGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACCAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACGCAAGAAGTGGAAAAGACACAAAGTACAGTGAAAGAATCAGCTGCTGAAGAGAAACTGACCCCGGTTGCATTGGCCAAACAAGTAGCTTCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAATTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTG
  3  -1   2       bld Tbd4                            IMAGE:4060589.3p                                                                     TTGCAGATCTGAATTCCCCGGGCTGATTTCCTATTTGCTTCTAAAGCGTCTGACCTAATTGAGGCCACTGAGCGTGCGTCTGTCTGGCTTCTTCTGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACGCAAGAAGTGGAAAAGACACAGAGTACAGTGAAAGAATCAGCTGCTGAAGAGAAACTGACCCCGGTTGCATTGGCC
  5   1   2       bld FaB       out                   IMAGE:8070322.5p                                                                          GGCTGCTGTTGCTGATTTCCTATTTGCTTCTAAAGCGTCTGACCTAATTGAGGCCACTGAGCGTGCGTCTGTCTGGCTTCTTCTGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGGAGCTGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACGCAAGAAGTGGAAAAGACACAGAGTACAGTGAAAGAATCAGCTGCTGAAGAGAAACTGACCCCGGTTGCATTGGCCAAACAAGTAGCTTCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAATTTGACTGACCCAGATGGTGCCCTGACAAAGCGTTTGCTGACTCAGTTGGATGCGGCCAAAACTAGAAAAATCCAGAAGGAAAAGGCCTGCAAAGGGTC
  5   1   2       bld DMZ  5g3  out                        xl225l09.5p                                                                             CGTGGCTGCTGTTGCTGATTTCCTATTTGCTTCTAAAGCGTCTGACCTAATTGAAGCCACTGAGAGTGCGTCTGTCTGGCTTCTTCTGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACCAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACGCAAGAAGTGGAAAAGACACAGAGTACAGTGAAAGAATCAGCTGCTGAAGAGAAACTGACCCCGGTTGCATTGGCCAAACAAGTAGCTTCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAATTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGCGGCCAAAACTAGAAAAAATCCNGAA
  5   1   2       bld DMZ  5g3  out                        xl314d13.5p                                                                                GGCTGCTGTTGCTGATTTCCTATTTGCTTCTAAAGCGTCTGACCTAATTGAAGCCACTGAGAGTGCGTCTGTCTGGCTTCTTCTGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACCAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACGCAAGAAGTGGAAAAGACACAGAGTACAGTGAAAGAATCAGCTGCTGAAGAGAAACTGACCCCGGTTGCATTGGCCAAACAAGTAGCTTCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAATTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGCGGCCAAA
  5   1   2      seed Ga15 5g3  out                      XL436h11ex.5p                                                                                 GCTGCTGTTGCTGATTTCCTATTTGCTTCTAAAGCGTCTGACCTAATTGAGGCCACTGAGCGTGCGTCTGTCTGGCTTCTTCTGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACGCAAGAAGTGGAAAAGACACAGAGTACAGTGAAAGAATCAGCTGCTGAAGAGAAACTGACCCCGGTTGCATTGGCCAAACAAGTAGCTTCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAATTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGCGGCCAAAACTAGAAAAAATCCA
  5   1   2       bld Ov1  5g                         IMAGE:8330123.5p                                                                                     CTGTTGCTGATTTCCTATTTGCTTCTAAAGCGTCTGACCTAATTGAGGCCACTGAGCGTGCGTCTGTCTGGCTTCTTCTGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACGCAAGAAGTGGAAAAGACACAGAGTACAGTGAAAGAATCAGCTGCTGAAGAGAAACTGACCCCGGTTGCATTGGCCAAACAAGTAGCTTCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAATTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGCGGCCAAAACTAGAAAAAATCC
  5   1   2       bld Ga12 5g3  out                        XL217a23.5p                                                                                                          CTTCTAAAGCGTCTGACCTAATTGAGGCCACTGAGCGTGCGTCTGTCTGGCTTCTTCTGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACCAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACGCAAGAAGTGGAAAAGACACAGAGTACAGTGAAAGAATCAGCTGCTGAAGAGAAACTGACCCCGGTTGCATTGGCCAAACAAGTAGCTTCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAATTTGACTGAC
  5   1   2       bld Egg5 5g                         IMAGE:3431269.5p                                                                                                                           CTAATTGAGGCCACTGAGCGTGCGTCTGTCTGGCTTCTTCTGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACGCAAGAAGTGGAAAAGACACAGAGTACAGTGAAAGAATCAGCTGCTGAAGAGAAACTGACCCCGGTTGCATTGGCCAAACAAGTAGCTTCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAATTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTTGATGCGGGCAAAACTAGAAAGAATCCAGATGGA
  5   1   2       bld Ga12 5g3  out                        XL202g20.5p                                                                                                                                                                GAGGGTCCTGTCTGCTGCCGCATTGAGCCGCGCCCCGGCCCCTCCTGTCATCGCTCTTATAAGACATGGCTGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGCGATTTGCCGGAGGATGATCAGGCTGAGTTTGATGCGGAGGAACTTACTAGCACTAGCGTAGAACATATTATTGTCAACCCCAATGCAGCGTACGACAAATTTAAGGACAAGAAAGTTGGCACCAGAAGTTTAGACTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCTGGGGAGTACGAAATTCTTGGAGAAGGCATAGGAATGAAAGAAACCCCACAGCAGAAGTATCAGCGGTTGCTGCATGAAGTCCAGGAACTGACGCAAGAAGTGGAAAAGACACAGAGTACAGTGAAAGAATCAGCTGCTGAAGAGAAACTGACCCCGGTTGCATTGGCCAAACAAGTAGCTTCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTGCTGGGCCCAGATGCTGCCATCAATTTGACTGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGCGGCCAAAACTAGAAAAAATCCAGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATACTGAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)