Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xl289l22.5                            3 PI      81        246      843                t2, brachyury homolog (mouse) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012770741 Xl3.1-IMAGE:7299677.5 - 60 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                        3     3     3     3     3     3     3     3     3     3     6     7     6     9     6    11     6    12     6    12     6    12     6    12     7    12     6    11     6    11     6    11    11    11    11    11    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    12    12    12    12    12    12    11    11    11    11    11    11    10    11    10    11     7     7     5     5     5     5     4     4     5     5     6     7     6     7     7     7     7     7     7     7     7     7     6     8     7     8     7     8     7     8     6     9     7     8     7     8     7     8     7     8     8     9     8     9     8     9     6     9     8     9     7     8     6     9     8     9     8     9     8     9     8     9     8     9     8     9     6     9     8    10     8    10     8    10     8    10     6     9     6     9     5     9     5     9     6     9     7    10     8    11     8    11     6    10     7    10     9    10     8    10     8    10     6    10     9    10     9    10     9    10     9    10     8    10     8    10     8    10     8    11     7    11     9    10     7    13    11    13    13    14    12    14    12    16    11    16    14    18    12    22    15    22    14    23    13    24    14    24    13    23    13    25    13    26    14    26    14    26    14    28    13    27    14    28    13    27    13    27    13    27    13    27    12    27    12    27    12    26    12    26    12    26    12    26    12    25    12    26    14    28    15    29    15    29    16    29    16    28    16    28    17    28    17    28    17    29    17    29    17    29    17    29    17    30    18    33    18    33    18    33    19    33    17    33    17    33    18    33    16    33    17    33    18    33    16    33    16    33    17    33    15    32    15    32    16    32    14    32    14    32    23    29    11    23    11    23    10    22    10    14     8    10     8    10     6     8     3     3     2     3
                                                                   VAR                                                                                                                                                                                                                                                                                       GTCAATTGGATTTACTACCTGCTGATCAATCGCACCTTGGGTTTTGTTCCGATTAGTGGAAAAGCTGCTAAAATTTTTCCCCCAGTCTGTGTGTTACGAAGCCTCCCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGTAGCTGAGTGTCCATGGCCCATAAAGCAAATGATTGCTGCAGGCCTCCCAAATAACTTAAAGTTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGTCTCTTTTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATACAGTATTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATACAGTATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTAAGACAATCCGATAAAAGAAATATTGTGGAACA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                   T-------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                       ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---G--G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---G------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------GA----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---T--C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   A--T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---C-----A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   C--------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --C----C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----T---T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   T-----A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---A-----A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----------TA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -A--------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -C-C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----A------T
                                               BLH ATG     202    1590                                                                                                                                                                                                   
                                               BLH MIN     202     280                                                                                                                                                                                                   
                                               BLH OVR     202      22                                                                                                                                                                                                   
                                               EST CLI      60      11                                                                                                                                                                                                   
                                               ORF LNG     202       2                                                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 5e-051     NP_498088.1 T BoX family member (47.0 kD) (tbx-2) [Caenorhabditis elegans] --------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 4e-082     NP_001071946.1 transcription factor protein [Ciona intestinalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ag ---- 4e-082     XP_320606.4 AGAP011927-PA [Anopheles gambiae str. PEST] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                      PROTEIN --- Dm ---- 4e-090     NP_524031.1 CG7260-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 3e-113     XP_001177265.1 PREDICTED: similar to transcription factor Brachyury [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Dr ==== 4e-180     XP_001343633.2 PREDICTED: similar to brachyury transcription factor [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Bt ==== 0          XP_869983.2 PREDICTED: similar to T brachyury protein isoform 3 [Bos taurus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ==== 0          NP_033335.1 brachyury; brachyury-like 3; low ratio; brachyury-like 2 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ==== 0          NP_003172.1 transcription factor T; T brachyury-like [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Cf ---= 0          NP_001003092.1 T brachyury protein [Canis familiaris] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Gg ==== 0          NP_990271.1 brachyury (T) [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 0          NP_001008139.1 MGC89607 protein [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 0          NP_001084047.1 brachyury (T) [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7299677.5                                                                                                                                                                                                                   ATG------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------TAA---------------------------------------------TAA------TGA------TAG---------------TAA---------TAG------------------------------------------------------------------------------------------------------------TGA---------------------TAG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------TAA------------------------------------------------TAG---ATG---------------------------------------------------------------------------------TGA---ATG------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------TGA------------------------------------------------------------ATG---------ATGTGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2       bld Ga18      in                      xlk127k17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTTTGGAGCCCACTGGATGAAAGATCCTGTCTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCGAATCCACATAGTGAGAGTTGGTGGCACCCAGAGAATGATCACTAGCCATTCATTCCCTGAGACACAGTTCATAGCAGTGACCGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAATCCATTTGCCAAAGCATTTCTTGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGAATCGATAGTCAGCATTCTAATTTCTCTCAATTAGGTACTTGGCTTATTCCTAATGGTGGGTCATTATGTTCGCCCAATCCACACACTCAGTTCGGGGCACCTCTCTCTCTATCGTCACCTCATGGCTGTGAGCGATACTCATCTCTNAGGAACCACCGCTCAGCTCCTTACCCCAGTCCGTACACTCACAGAAACAATTCTCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTGTCAATGCTCCAGTCCCATGATAACTGGNCTACCCTTCAAATGCCAGCACACACTGGGATGTTNCCAATGAGTCACAGCACGGG
  5   1   2       bld Unk4                                726_21H24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATTACAGCACTTAAAATCAAACACAATCCATTTGCCAAAGCATTTCTTGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGAATCGATAGTCAGCATTCTAATTTCTCTCAATTAGGTACTTGGCTTATTCCTAATGGTGGGTCATTATGTTCGCCCAATCCACACACTCAGTTCGGGGCACCTCTCTCTCTATCGTCACCTCATGGCTGTGAGCGATACTCATCTCTAAGGAACCACCGCTCAGCTCCTTACCCCAGTCCGTACACTCACAGAAACAATTCTCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTGTCAATGCTCCAGTCCCATGATAACTGGTCTACCCTTCAAATGCCAGCACACACTGGGATGTTGCCAATGAGTCACAGCACGGGAACACCACCTCCCTCAAGTCAGTACCCTTCTTTATGGTCTGTGAGTAACAGTGCCATCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACTTGGCTCTACACCTCACTACTCGTCTCTTTCACATGCTGTGCCCTCACCATCCACAGGATCTCCATTGTATGAGCATGGAGCACAAACAGAAATAGCAGAAAACCAGTATGATGTCACGGCACATTCCAGGCTTTCATCAACATGGACACCCGTTGCGCCACCATCAGTCTAAAGTAAAGACCTTGAGGACTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTT
  5   1   2       bld Ga12      in                         XL163e11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACTTAAAATCAAGGCACAACCCATTTGCCAAAGCATTTCTTGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGAATTAATAGTCAGCACTCAAATTTCTCTCAGTTAGGTACTTGGCTCATTCCTAATGGTGGATCATTATGTACGCCCAATCCACACACTCAGTTCGGGGCACCTCTCTCTCTATCATCTCCTCATGGCTGTGAGCGATACTCATCTCTGAGGAACCACCGCTCCGCTCCTTACCCCAGTCCATACACTCACAGAAACAATTNTCCAAACAATTTAACAGATAATTCCTCAGCATGTCTTTCAATGCTCCAGTCCCATGGCAACTGGTCCACACTTCAAATGCCAGCACACACAGGGATGTTGCCAATGAGTCACAGCACAGGAACACCACCTACCTCAAGTCAGTACACTTNTTTGTGGTCTGTAAGTAACAGTACCATCACACCAGTGTCTCANTCTGGAGGAATAAGTAATGGAACAAG
  5   1   2       bld Ga12      in                         XL160k14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACTTAAAATCAAGCACAACCCATTTGCCAAAGCATTTCTTGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGAATTAATAGTCAGCACTCAAATTTCTCTCAGTTAGGTACTTGGCTNATTCCTAATGGTGGATCATTATGTACGCCCAATCCACACACTCAGTTCGGGGCACCTCTCTCTCTATCATCTCCTCATGGCTGTGAGCGATACTCATCTCTGAGGAACCACCGNTCCGCTCCTTACCCCAGNCCATACACTCACAGAANCAATTCTCCAAACAATTTAACAGATAATTCCTCAGCATGTCTTTCAATGCTCCAGTCCCATGGCAACTGGNCCACACTTCAAATGCCAGCACACACAGGGATGTTGCCAATGAGTCACAGNACAGGAACACCACCTACCTCAAGTCAGTACACTTCTTTGNGGTCTGTAAGTAACAGTACCATCACACCAGTGTCTCAGTCTGGAGGAATAAGTAATGGAACAAGTGCCCAGTACCTACGTGGCTCTACACCTCATTACTCATCTCTTTCACATGCTGTGCCCTCACCAACCACAGGATCCCCATTGTATGAACATGGAGCACAAACAGAAATAGCAGAAA
  5   1   2       bld Ga18      in                       xlk60k05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GANGAGGGANTCGATAGTCAGCATTCTAATTTCTCTCAATTAGGTACTTGGCTTATTCCTAATGGTGGGTCATTATGTTCGCCCAATCCACACACTCAGTTCGGGGCACCTCTCTCTCTATCGTCACCTCATGGCTGTGAGCGATACTCATCTCTAAGGAACCACCGCTCAGCTCCTTACCCCAGTCCGTACACTCACAGAAACAATTCTCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTGTCAATGCTCCAGTCCCATGATAACTGGTCTACCCTTCAAATGCCAGCACACACTGGGATGTTGCCAATGAGTCACAGCACGGGAACACCACCTCCCTCAAGTCAGTACCCTTCTTTATGGTCTGTGAGTAACAGTGCCATCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACTTGGCTCTACACCTCACTACTCGTCTCTTTCACATGCTGTGNCCTCACCATCCACAGGATCTCCATTGTATGAGCATGGAGCACAAACAGAAATAGCAGAAAACCAGTATGATGTCACGGCACATTCCAGGCTTTCATCAACATGGACACCCGTTGCGCCACCATCAGTCTAAAGTAAAGANCTTGAGGNCTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGNCTCCAAAACAACTTA
  5  -1   2       bld Bla2                            IMAGE:7299677.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACGGGTATAATTACTAATNNTTATNGTGGGGGTGGGATAANATCCCACCCCTTATAttttttgtttgtgtttgcaaaaggacaatctttttaatattttttAAAGGCAAGGGGGGATCCCTTTTACAAACCAAATAATTTTTATTTTCCCTATGGGGGCAGGAATTTTTTTGGGGAAATTCCAAGTTTTTTCATTAAAAAATAAGCGAATTTTTAGCTTTTGCAAAGTCCATCCCAGAAAATGTTTACCCTTAATCGCAGCCACAAGGATGTTCCCATGGGTACAGCAAGGAACCCACCTCCCTCAAGTCATACCTTCTTTTGGTTGGGAGTACAGTGCATCACACCAGTGTCTCAGTTGGAGGATTAACTATTGGATAAGCTCCCAGTACTTACTGGGCTCTACACCTCACTACTCGTCTCTTTCACATGCTGTGGCCTCACCATCCACAGGATCTCCATTGTATGAGCATGGAGCACAAACAGAAATAGCAGAAAACCAGTATGATGTCACGGCACATTCCAGGCTTTCATCAACATGGACACCCGTTGCGCCACCATCAGTCTAAAGTAAAGACCTTGAGGACTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTGATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATAttttttttaatatgccttattaagtaaaaaataatttaaaatgtttaaataatttaaaatGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCAATCGCCCATGATTGGG
  5   1   2       bld Unk4                                AGL_20F06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCACCTCTCTCTCTATCATCTCCTCATGGCTGTGAGCGATACTCATCTCTGAGGAACCACCGCTCCGCTCCTTACCCCAGTCCATACACTCACAGAAACAATTCTCCAAACAATTTAACAGATAATTCCTCAGCATGTCTTTCAATGCTCCAGTCCCATGGCAACTGGTCCACACTTCAAATGCCAGCACACACAGGGATGTTGCCAATGAGTCACAGCACAGGAACACCACCTACCTCAAGTCAGTACACTTCTTTGTGGTCTGTAAGTAACAGTACCATCACACCAGTGTCTCAGTCTGGAGGAATAAGTAATGGAACAAGTCCCCAGTACCTACGTGGCTCTACACCTCATTACTCATCTCTTTCACATGCTGTGCCCTCACCAACCACAGGATCCCCATTGTATGAACATGGAGCACAAACAGAAATAGCAGAAAACCAGTATGATGTCACTGCACATTCCAGGCTTTCATCAGCATGGACACCAGTTGCACCACCATCAATCTAAAGTAAAGACTATAAGGACTTAATACACAAATCAGTATTTCCTGGGCCAAGTAGCTGAGTGTCCATGGCCCATAAAGCAAATGATTGCTGCAGGCCTCCCAAATAACTTAAAGTTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTAGTTTTCTGAATGTACTGGCAAGGGGTGATTATCCAGGAGCTCTTCTAAAGGGAATGTAA
  5   1   2       bld Gas3      in                      xlnga002i16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCCTTACCCCTGTCCATACACTCACAGAAACAATTCTCCAAACAATTTAACAGATAATTCCTCAGCATGTCTTTCAATGCTCCAGTCCCATGGCAACTGGTCCACACTTCAAATGCCAGCACACACAGGGATGTTGCCAATGAGTCACAGCACA
  5   1   2       bld Ga18      in                      xlk118e22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTNGTCTACCCTTCAAATGCCAGCACACACTGGGATGTTGCCAATGAGTCACAGCACGGGAACACCACCTCCCTCAAGTCAGTACCCTTCTTTATGGTCTGTGAGTAACAGTGCCATCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACTTGGCTCTACACCTCACTACTCGTCTCTTTCACATGCTGTGNCCTCACCATCCACAGGATCTCCATTGTATGAGCATGGAGCACAAACAGAAATAGCAGAAAACCAGTATGATGTCACGGCACATTCCAGGCTTTCATCAACATGGACACCCGTTGCGCCACCATCAGTCTAAAGTAAAGACCTTGAGGACTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGNCTCCAAAACAACTTAAAGATGTGCTTAGNNAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCNACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGNACAAAGNNGGGTTAACTTACACATANTAANGTGATTACACCAAGGNNCGTTATCACCTCTGTATATTCTACNNCATTTTTCTGAATGTACTNGCANGGGGNGATTTACCCAGGNGNCTCTTTTAANGGNANNNNAAAAATAC
  3   1   2      seed Ga18      in                      xlk118e22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GNNNGGGAACNCCNNNNCNNNAAGTCAGTACCNNNNTNNTNNTCNGTGANNANNNAGTGNCATCANNCNANTNNCTCAGTCTGNNGGAATAACTAANNNAATAAGCTCCCAGNANNNCTNGNCTCTACACCTCNCTACTCNTCTCTTTCACATNNTGNGCCCTCACNATCCACAGGATCTCCATTGTATGAGCATGGAGNACAAACAGAAATAGCAGAAAACCAGTATGATGTCACGGCACATTCCAGGCTTTCATCAACATGGACACCCGTTNNGCCACCATCAGTCTAAAGTANAGNCCTTGAGGACTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGA
  5   1   2       bld DMZ       in                         xl324d19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACAGTACCATCACACCAGTGTCTCAGTCTGGAGGAATAAGTAATGGAACAAGTCCCCAGTACCTACGTGGCTCTACACCTCATTACTCATCTCTTTCACATGCTGTGCCCTCACCAACCACAGGATCCCCATTGTATGAACATGGAGCACAAACAGAAATAGCAGAAAACCAGTATGATGTCACTGCACATTCCAGGCTTTCATCAGCATGGACACCAGTTGCACCACCATCAATCTAAAGTAAAGACTATAAGGACTTAATACACAAATCAGTATTTCCTGGGCCAAGTAGCTGAGTGTCCATGGCCCATAAAGCAAATGATTGCTGCAGGCCTCCCAAATAACTTAAAGTTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGNTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACA
  5   1   2       bld Ga12      in                         XL159e08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACACCAGTGTCTCAGTCTGGAGGAATAAGTAATGGAACAAGTCCCCAGTACCTACGTGGCTCTACACCTCATTACTCATCTCTTTCACATGCTGTGCCCTCACCAACCACAGGATCCCCATTGTATGAACATGGAGCACAAACAGAAATAGCAGAAAACCAGTATGATGTCACTGCACATTCCAGGCTTTCATCAGCATGGACACCAGTTGCACCACCATCAATCTAAAGTAAAGACTATAAGGACTTAATACACAAATCAGTATTTCCTGGGCCAAGTAGCTGAGTGTCCATGGCCCATAAAGCAAATGATTGCTGCAGGCCTCCCAAATAACTTAAAGTTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCC
  3   1   2       bld Ga18                             rxlk106k06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ANNAATAGNAGAAACNAGTANGNNGTCNCGNNNCNTTCCANGCTTTCNNNACATGGANNNCCGTTGNNCCACCATCAGTCTAAAGTAAAGNCCTTGAGGACTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGNTNCCTGGTACATAAAGCAAATGATTGCTGTAGNCCTCCAAAACAACTNAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGNCTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCNCCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGNAAG
  3   1   2       bld Ga18      in                       xlk60k05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGNTTTCNNCANCATGGACNNCGTTGNNCCACCNTCAGTCTAAAGTAAAGNCCTTGAGGACTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGNTCCCTGGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAANCAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTANNNTGNAAG
  3   1   2       bld Ga18      in                      xlk127k17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCATCAGTCTAAAGTAAAGNCCTTGAGGNCTCAGTATAAAATCAGTATTTNNTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGNNCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGNCTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGAC
  3   1   2       bld DMZ  5g3  in                         xl231b15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTCTAAAGTAAAGGCCCTTGAGGACTCAGTATAAAAATCAGTNTTTCCTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAANTGANTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCANCCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCNGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCNTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTAnTAAGTAAAAAATAATTTAAAATGTTTAAATAATnTAAAATGTGGTACCGTCTAGATTATGGAAAAATNTTGGAAGCAGCTTTNGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTANATCATTGTGTAACTGGNATTGCNGTATTTATNTNATCTNCATGTTTTTGTGGTAAATGTANANGTGCNGTAAATATGTT
  3   1   2       bld DMZ  5g3  in                         xl333o12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCTAAAGTAAAGACCTTGAGGACTCAGTATAAAAATCAGTATTTCCTGGNCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATNGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATG
  3   1   2       bld DMZ  5g3  in                         xl231n08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTCTTAAAGGGAATGTAAAANTACAGTNTTAATAAGAAGGTCTGCTTCTTTTNTACACTGCCTTNATATNGCTATAANTTACTNTTATTTGGGACTGCNGCTACAGACTACNCATTTTTATTATAGACATATTTTTTNTAATANGCCTTANTAAGTAAAAAATAATTTAAAAnGTTTAAATAATTTAAAANGTGGTACTGTCTAGATTATGGAAAAATCTTGGAAGCAGCTCTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCNGCTAANCTGATTNGAAATATGGTTTCTAAAAAAATAACCGGGGAGAGAAACGTATGTTATATCATTGTGTAAGCTGGTACNTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCCTGTAAATATGTTA
  3   1   2       bld DMZ  5g3  in                         xl263i08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACNGATTTGAAATANGGTTTCTAAAAAAATAACGGGGAGNNAAAGTATGNTATATCATTGTGTAACTGGTACTTGCTGNA
  5   1   2       bld DMZ                                  xl326d19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGTAGCTGAGTGTCCATGGCCCATAAAGCAAATGATTGCTGCAGGCCTCCCAAATAACTTAAAGTTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATA
  3   1   2       bld DMZ       in                         xl266a02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATANGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGGGAACAGAAAAATGGAGTCT
  3   1   2       bld DMZ                                 rxl226a21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCT
  3   1   2       bld Ga12                                 XL149c24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAACAAAATAACGGGGAGAGANAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATCTTATTTCATCNTCATGTTTCTGTGGTAAATGTATATGTGTCTGTAAATATGTCTACTGTATGCTGTAA
  5   1   2       bld DMZ       in                         xl268c09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAAATGATTGCTGCAGGCCTCCCAAATAACTTAAAGTTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATAttttaaatatgcctttttaagtaaacctaatttaatatgtttaaataatttaaaaTGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGA
  5   1   2       bld DMZ       in                         xl268d09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAAATGATTGCTGCAGGCCTCCCAAATAACTTAAAGTTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATAttttaaatatgcctttttaagtaaacctaatttaatatgtttaaataatttaaaaTGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGNTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCA
  3   1   2       bld Neu1      in                      Neu1-20E9-2.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCTGGTACATAAGCAAATGATTGCTGTGCCTCCAACACAACTAAAGATGGCTTAGGCAAGTTATTCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGGTGGGTGGTCTGCCCGCGGGCCCCCATATGGATATGATGCTTAGCACAAGTGGGGTTACTTACACATATTAAGTGATTACCCAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTCTGGCAGGGGTGATTTACCCAGGAGTCTCTTTTAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAG
  3   1   2       bld DMZ  5g3  in                         xl287i17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAAGGTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCAGTGTAAGGTATCTACCAATCTACACGTTGA
  3   1   2       bld DMZ       in                         xl324d19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAAGTTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCAGTGTAAGGTATCTACCAATCTAC
  3   1   2       bld DMZ  5g3  in                         xl286i17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCCTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCAGTGTAAGGTATCTACCAATCTACACGTTGATGTGG
  3   1   2       bld Ga12 5g3  in                         XL200f12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCAGTGTAAGGTATCTACCAATCTACACGTTGATGTGGGGGACCATGTGATGCTTCAATA
  3   1   2       bld Ga12      in                         XL163e11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCTTCATGGATCCAACCAGGCAGGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATNCAGTATTGCTTAATTNCAGTATTAANTAAGATCCATTNTGCTNNTTNTAAAACATTCCCTCTATTGNTCTAAATNACTCTTTATCTGAGAC
  3   1   2       bld DMZ  5g3  in                         xl243o14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTANATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGGGAACAGAAAAATNGAGTCTA
  3   1   2       bld DMZ       in                         xl268c09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCATCNTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCAGTGTAAGGTATCTACCAATCTACCACGTTGATG
  3   1   2       bld DMZ       in                         xl268d09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCCAGTGTAAGGTATCTACCAATCTAC
  3   1   2       bld Ga12      in                         XL160k14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAANTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTNCAGTGTAAGGTATCNACCAATNTACACGTNGATGTGGG
  3   1   2       bld Ga12      in                         XL159e08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCAGTGTAAGGTATCTACCAATCTACACGTTGATGTGGGGGACCATGNAGCTTCAATAAATACACT
  3   1   2       add Ga18      in                      xlk157p04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCNNNGNCCGNCCACGCGTCCGTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGAAAAATGGANTCTATTGTAATAAA
  3   1   2       bld Ga18      in                      xlk103o19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCNGTAAGA
  5   1   2       bld Ga18      in                      xlk103o19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATAttttttttaatatgccttattaagtaaaaaataatttaaaatgtttaaataatttaaaatGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGANaaaaaaaa
  5   1   2       add Ga18      in                      xlk157p04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATAttttttttaatatgccttattaagtaaaaaataatttaaaatgtttaaataatttaaaatGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGAAAAATGGAGTCTATTGTAATAAATATATCATTCAGGATGTTTTCATAGAAATaaaaaaaaaa
  3   1   2       bld Gas3      in                      xlnga002i16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGGTATTTGTCTGATTACGCTGAGGACAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCAGTGTAAGGTATCTACCAATCTACACGTTGATGTGGGGGACCATGTGATGCTTCAATAAATACACTATTTTTTCTAAA
  3   1   2       bld Emb1 5g3  in                    IMAGE:3402478.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGAAAAAA
  3  -1   2       add DMZ                                 rxl337j09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATGTGGTACTGGNCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCGTGCCTANATANCCACAANCTTCTCCCAGCNAAANTGATTTGAAATATGGCTTCTAAAAAAATAACGGGGANAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCNTCNTGTTTTTGTGGTANATGTATATGTGCTGTANATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGAAAAAAAAAAAAAAAAAAAAACCCCG
  3  -1   2       bld DMZ                                 rxl248p07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGTGGTACTGNCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATANCCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGAAAAAAAAAAAAAAAAAAAAACC
  3  -1   2       bld DMZ                                 rxl267b15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGAAAAAAAAAAAAAAAAAAAAACC
  3  -1   2       add DMZ                                 rxl320o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGTGGTACTGNCTAGATTATGGAAAAATATTGGANGCAGCTTTTGTCTGAATCTGCTACTTGCGTGCCTANATANCCACAANCTTCTCCCAGCNNAANTGATTTGAAATATGGNTTCTAAAAAAATNACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCNTCNTGTTTTTGTGGTAAATGTATATGTGCTGTANATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGAAAAAAAAAAAAAAAAAAAAACCCC

In case of problems mail me! (