Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xl289l22.5                            3 PI      81        246      843                t2, brachyury homolog (mouse) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012770741 Xl3.1-IMAGE:7299677.5 - 60 ESTs
                                                                       ....-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7299677.5                                                                                                                                                                                                   TTGTGTAGGCCTATTTATGGGTGGATGAAAGAACTCCAACTTAATCAGTGACTCGTATTCCTTTAATGTCAATTGGATTTACTACCTGCCGATCACTCGCACCTTGGGTTTTGTTCCGATTACAATAAAACAAATCAGTGGAAAAGCTGCTGTAAGTTTTTTTTGCCCCTGTTTGTGTGTTTGGACCCCCCTCTCTGGAGTAATGAGTGCGACCGAGAGCTGCGCCAAGAACGTACAGTACCGGGTGGATCATCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTTAGCCTGGAGGAGCGGGACCTGTGGACGAGGTTCAAGGAGCTCACCAACGAGATGATCGTCACCAAGAATGGAAGACGAATGTTTCCAGTTCTGAAGGTGAGCATGTCGGGCCTGGATCCCAATGCAATGTATACGGTTCTGCTGGACTTTGTGGCAGCCGACAACCACCGCTGGAAGTATGTGAATGGAGAATGGGTTCCAGGTGGCAAACCCGAGCCCCAGGCCCCCAGTTGTGTTTATATCCACCCAGACTCACCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTCTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCGAATCCACATAGTGAGAGTTGGTGGCACCCAGAGAATGATCACTAGCCATTCATTCCCTGAGACACAGTTCATAGCAGTGACCGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAATCCATTTGCCAAAGCATTTCTTGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGAATCGATAGTCAGCATTCTAATTTCTCTCAATTAGGTACTTGGCTTATTCCTAATGGTGGGTCATTATGTTCGCCCAATCCACACACTCAGTTCGGGGCACCTCTCTCTCTATCGTCACCTCATGGCTGTGAGCGATACTCATCTCTAAGGAACCACCGCTCAGCTCCTTACCCCAGTCCGTACACTCACAGAAACAATTCTCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTGTCAATGCTCCAGTCCCATGATAACTGGTCTACCCTTCAAATGCCAGCACACACTGGGATGTTGCCAATGAGTCACAGCACGGGAACACCACCTCCCTCAAGTCAGTACCCTTCTTTATGGTCTGTGAGTAACAGTGCCATCACACCAGTGTCTCAGTCTGGAGGAATAAGTAATGGAATAAGCTCCCAGTACCTACGTGGCTCTACACCTCACTACTCGTCTCTTTCACATGCTGTGCCCTCACCAACCACAGGATCTCCATTGTATGAGCATGGAGCACAAACAGAAATAGCAGAAAACCAGTATGATGTCACGGCACATTCCAGGCTTTCATCAACATGGACACCCGTTGCGCCACCATCAGTCTAAAGTAAAGACCTTGAGGACTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGAGGGAATGTAAAAAGGGAATGTAACTTAATTACAGTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCAGTGTAAGGTATCTACCAATCTACACGTTGATGTGGGGGACCATGTGATG
                                                  Xl3.1-CHK-1012686317                                                                                                                                                                                                         AGGCCTATTTATGGGTGGATGAAAGAACTCCAACTTAATCAGTGACTCGTATTCCTTTAATGTCAATTGGATTTACTACCTGCCGATCACTCGCACCTTGGGTTTTGTTCCGATTACAATAAAACAAATCAGTGGAAAAGCTGCTGTAAGTTTTTTTTGCCCCTGTTTGTGTGTTTGGACCCCCCTCTCTGGAGTAATGAGTGCGACCGAGAGCTGCGCCAAGAACGTACAGTACCGGGTGGATCATCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTTAGCCTGGAGGAGCGGGACCTGTGGACGAGGTTCAAGGAGCTCACCAACGAGATGATCGTCACCAAGAATGGAAGACGAATGTTTCCAGTTCTGAAGGTGAGCATGTCGGGCCTGGATCCCAATGCAATGTATACGGTTCTGCTGGACTTTGTGGCAGCCGACAACCACCGCTGGAAGTATGTGAATGGAGAATGGGTTCCAGGTGGCAAACCCGAGCCCCAGGCCCCCAGTTGTGTTTATATCCACCCAGACTCACCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTCTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCGAATCCACATAGTGAGAGTTGGTGGCACCCAGAGAATGATCACTAGCCATTCATTCCCTGAGACACAGTTCATAGCAGTGACCGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAATCCATTTGCCAAAGCATTTCTTGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGAATCGATAGTCAGCATTCTAATTTCTCTCAATTAGGTACTTGGCTTATTCCTAATGGTGGGTCATTATGTTCGCCCAATCCACACACTCAGTTCGGGGCACCTCTCTCTCTATCGTCACCTCATGGCTGTGAGCGATACTCATCTCTAAGGAACCACCGCTCAGCTCCTTACCCCAGTCCGTACACTCACAGAAACAATTCTCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTGTCAATGCTCCAGTCCCATGATAACTGGTCTACCCTTCAAATGCCAGCACACACTGGGATGTTGCCAATGAGTCACAGCACGGGAACACCACCTCCCTCAAGTCAGTACCCTTCTTTATGGTCTGTGAGTAACAGTACCATCACACCAGTGTCTCAGTCTGGAGGAATAAGTAATGGAACAAGCTCCCAGTACTTACGTGGCTCTACACCTCACTACTCGTCTCTTTCACATGCTGTGCCCTCACCATCCACAGGATCTCCATTGTATGAGCATGGAGCACAAACAGAAATAGCAGAAAACCAGTATGATGTCACGGCACATTCCAGGCTTTCATCAACATGGACACCCGTTGCGCCACCATCAGTCTAAAGTAAAGACCTTGAGGACTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGxxxCxxAAAGTTGGTTTGxxTTAxxTxxxAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTxTTCTxCATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGxxGxxxTGTAAAxAxxxAxTxTxxCTTAATxxxAxTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCxxxxxGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCAGTGTAAGGTATCTACCAATCTACACGTTGATGTGGGGGACCATGTGATGCTTCAA
                                                      consensus depths                                                                                                                                                                                                        3     3     3     3     3     3     3     3     3     3     6     7     6     9     6    11     6    12     6    12     6    12     6    12     7    12     6    11     6    11     6    11    11    11    11    11    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    12    12    12    12    12    12    11    11    11    11    11    11    10    11    10    11     7     7     5     5     5     5     4     4     5     5     6     7     6     7     7     7     7     7     7     7     7     7     6     8     7     8     7     8     7     8     6     9     7     8     7     8     7     8     7     8     8     9     8     9     8     9     6     9     8     9     7     8     6     9     8     9     8     9     8     9     8     9     8     9     8     9     6     9     8    10     8    10     8    10     8    10     6     9     6     9     5     9     5     9     6     9     7    10     8    11     8    11     6    10     7    10     9    10     8    10     8    10     6    10     9    10     9    10     9    10     9    10     8    10     8    10     8    10     8    11     7    11     9    10     7    13    11    13    13    14    12    14    12    16    11    16    14    18    12    22    15    22    14    23    13    24    14    24    13    23    13    25    13    26    14    26    14    26    14    28    13    27    14    28    13    27    13    27    13    27    13    27    12    27    12    27    12    26    12    26    12    26    12    26    12    25    12    26    14    28    15    29    15    29    16    29    16    28    16    28    17    28    17    28    17    29    17    29    17    29    17    29    17    30    18    33    18    33    18    33    19    33    17    33    17    33    18    33    16    33    17    33    18    33    16    33    16    33    17    33    15    32    15    32    16    32    14    32    14    32    23    29    11    23    11    23    10    22    10    14     8    10     8    10     6     8     3     3     2     3
                                                                   VAR                                                                                                                                                                                                                                                                                       GTCAATTGGATTTACTACCTGCTGATCAATCGCACCTTGGGTTTTGTTCCGATTAGTGGAAAAGCTGCTAAAATTTTTCCCCCAGTCTGTGTGTTACGAAGCCTCCCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGTAGCTGAGTGTCCATGGCCCATAAAGCAAATGATTGCTGCAGGCCTCCCAAATAACTTAAAGTTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGTCTCTTTTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATACAGTATTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATACAGTATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTAAGACAATCCGATAAAAGAAATATTGTGGAACA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                   T-------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                       ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---G--G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---G------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------GA----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---T--C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   A--T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---C-----A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   C--------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --C----C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----T---T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   T-----A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---A-----A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----------TA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -A--------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -C-C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----A------T
                                               BLH ATG     202    1590                                                                                                                                                                                                   
                                               BLH MIN     202     280                                                                                                                                                                                                   
                                               BLH OVR     202      22                                                                                                                                                                                                   
                                               EST CLI      60      11                                                                                                                                                                                                   
                                               ORF LNG     202       2                                                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 5e-051     NP_498088.1 T BoX family member (47.0 kD) (tbx-2) [Caenorhabditis elegans] --------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 4e-082     NP_001071946.1 transcription factor protein [Ciona intestinalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ag ---- 4e-082     XP_320606.4 AGAP011927-PA [Anopheles gambiae str. PEST] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                      PROTEIN --- Dm ---- 4e-090     NP_524031.1 CG7260-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 3e-113     XP_001177265.1 PREDICTED: similar to transcription factor Brachyury [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Dr ==== 4e-180     XP_001343633.2 PREDICTED: similar to brachyury transcription factor [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Bt ==== 0          XP_869983.2 PREDICTED: similar to T brachyury protein isoform 3 [Bos taurus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ==== 0          NP_033335.1 brachyury; brachyury-like 3; low ratio; brachyury-like 2 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ==== 0          NP_003172.1 transcription factor T; T brachyury-like [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Cf ---= 0          NP_001003092.1 T brachyury protein [Canis familiaris] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Gg ==== 0          NP_990271.1 brachyury (T) [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 0          NP_001008139.1 MGC89607 protein [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 0          NP_001084047.1 brachyury (T) [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7299677.5                                                                                                                                                                                                                   ATG------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------TAA---------------------------------------------TAA------TGA------TAG---------------TAA---------TAG------------------------------------------------------------------------------------------------------------TGA---------------------TAG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------TAA------------------------------------------------TAG---ATG---------------------------------------------------------------------------------TGA---ATG------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------TGA------------------------------------------------------------ATG---------ATGTGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2       bld Ga14                                Ga14-p4d2.5p GCAACTCTTTGATATAGGTGTANACATTTGNGGGATTTGCATAAAGTACCTCTGACTTGCAATTAAGTTCCCAGGATTATCATAGGGCTCTGTGCTGGGTTTCCTCTGCTCCAATCAGCGGTTTCCTCGCCAACATCAAAGAGAAGATTGACCAATGAGCTGCCTGGTCGCACTGTTGGTGAAGGCACCACGGCTTGTGTAGGCCTATTTATGGGTGGATGAAAGAACTCCAACTTAATCAGTGACTCGTATTCCTTTAATGTCAATTGGATTTACTACCTGCCGATCACTCGCACCTTGGGTTTTGTTCCGATTACAATAAAACAAATCAGTGGAAAAGCTGCTGTAAGttttttttGC
  5   1   2       bld DMZ  5g3  in                         xl231n08.5p                                                                                                                                                                                       GGCACCACGGCTTGCTGTAGGCCTATTTATGGGTGGATGAAAGAACTCCAACTTAATCAGTGACTCGTATTCCTTTAATGTCAATTGGATTTACTACCTGCCGATCACTCGCACCTTGGGTTTTGTTCCGATTACAATAAAACAAATCAGTGGAAAAGCTGCTGTAAGttttttttGCCCCTGTTTGTGTGTTTGGACCCCCCTCTCTGGAGTAATGAGTGCGACCGAGAGCTGCGCCAAGAACGTACAGTACCGGGTGGATCATCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTTAGCCTGGAGGAGCGGGACCTGTGGACGAGGTTCAAGGAGCTCACCAACGAGATGATCGTCACCAAGAATGGAAGACGAATGTTTCCAGTTCTGAAGGTGAGCATGTCGGGCCTGGATCCCAATGCAATGTATACGGTTCTGCTGGACTTTGTGGCAGCCGACAACCACCGCTGGAAGTATGTGAATGGAGAATGGGTTCCAGGTGGCAAACCCGAGCCCCAGGCCCCCAGTTGTGTTTATATCCACCCAGACTCACCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTCTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGA
  5   1   2       bld DMZ  5g3  in                         xl231b15.5p                                                                                                                                                                                        GGCACCACGGCTTGTGTAGGCCTATTTATGGGTGGATGAAAGAACTCCAACTTAATCAGTGACTCGTATTCCTTTAATGTCAATTGGATTTACTACCTGCCGATCACTCGCACCTTGGGTTTTGTTCCGATTACAATAAAACAAATCAGTGGAAAAGCTGCTGTAAGttttttttGCCCCTGTTTGTGTGTTTGGACCCCCCTCTCTGGAGTAATGAGTGCGACCGANAGCTGCGCCNAGAACGTACAGTACCGGGTGGATCATCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTTAGCCTGGAGGAGCGGNACCTGTGGACGAGGTTCAAGGAGCTCACCAACGAGATGATCGTCACCAAGAATGGAAGACGAATGTTTCCAGTTCTGAAGGTGAGCATGTCGGGCCTGGATCCCAATGCAATGTATACGGTTCTGCTGGACTTTGTGGCAGCCGACAACCACCGCTGGAAGTATGTGAATGGAGAATGGGTTCCAGGTGGCAAACCCGAGCCCCAGGCCCCCAGTTGTGTTTATATCCACCCAGACTCACCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTCTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCG
  5   1   2       bld Emb1 5g3  in                    IMAGE:3402478.5p                                                                                                                                                                                                                                                               TTAATGTCAATTGGATTTACTACCTGCCGATCACTCGCACCTTGGGTTTTGTTCCGATTACAATAAAGACAAATCACGTGGAAAAGCTGCTGTAAGttttttttGCCCCTGTTTGTGTGTTTGGACCCCCCTCTCTGGAGTAATGAGTGCGACCGAGAGCTGCGCCAAGAACGTACAGTACCGGGTGGATCATCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTTAGCCTGGAGGAGCGGGACCTGTGGACGAGGTTCAAGGAGCTCACCAACGAGATGATCGTCACCAAGAATGGAAGACGAATGTTTCCA
  5   1   2       bld DMZ  5g3  in                         xl333o12.5p                                                                                                                                                                                                                                                               CTTTAATGTCAATTGGATTTACTACCTGCCGATCACTCGCACCTTGGGTTTTGTTCCGATTACAATAAAACAAATCAGTGGAAAAGCTGCTGTAAGttttttttGCCCCTGTTTGTGTGTTTGGACCCCCCTCTCTGGAGTAATGAGTGCGACCGAGAGCTGCGCCAAGAACGTACAGTACCGGGTGGATCATCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTTAGCCTGGAGGAGCGGGACCTGTGGACGAGGTTCAAGGAGCTCACCAACGAGATGATCGTCACCAAGAATGGAAGACGAATGTTTCCAGTTCTGAAGGTGAGCATGTCGGGCCTGGATCCCAATGCAATGTATACGGTTCTGCTGGACTTTGTGGCAGCCGACAACCACCGCTGGAAGTATGTGAATGGAGAATGGGTTCCAGGTGGCAAACCCGAGCCCCAGGCCCCCAGTTGTGTTTATATCCACCCAGACTCACCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTCTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCGAATCCACATAGTGAGAGTTGGTGGCACCCAGAGAAATGATCACTAGCCATTCATTCCCTG
  5   1   2       bld DMZ  5g3  in                         xl243o14.5p                                                                                                                                                                                                                                                               CTTTAATGTCAATTGGATTTACTACCTGCCGATCACTCGCACCTTGGGTTTTGTTCCGATTACAATAAAACAAATCAGTGGAAAAGCTGCTGTAAGttttttttGCCCCTGTTTGTGTGTTTGGACCCCCCTCTCTGGAGTAATGAGTGCGACCGAGAGCTGCGCCAAGAACGTACAGTACCGGGTGGATCATCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTTAGCCTGGAGGAGCGGGACCTGTGGACGAGGTTCAAGGAGCTCACCAACGAGATGATCGTCACCAAGAATGGAAGACGAATGTTTCCAGTTCTGAAGGTGAGCATGTCGGGCCTGGATCCCAATGCAATGTATACGGTTCTGCTGGACTTTGTGGCAGCCGACAACCACCGCTGGAAGTATGTGAATGGAGAATGGGTTCCAGGTGGCAAACCCGAGCCCCAGGCCCCCAGTTGTGTTTATATCCACCCAGACTCACCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTCTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCGAATCCACATAGTGAGAGTTGGTGGCACCCAGAGAATGATCACTAGCCATTCATTCCCTG
  5   1   2       bld DMZ  5g3  in                         xl263i08.5p                                                                                                                                                                                                                                                               CTTTAATGTCAATTGGATTTACTACCTGCCGATCACTCGCACCTTGGGTTTTGTTCCGATTACAATAAAACAAATCAGTGGAAAAGCTGCTGTAAGttttttttGCCCCTGTTTGTGTGTTTGGACCCCCCTCTCTGGAGTAATGAGTGCGACCGAGAGCTGCGCCAAGAACGTACAGTACCGGGTGGATCATCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTTAGCCTGGAGGAGCGGGACCTGTGGACGAGGTTCAAGGAGCTCACCAACGAGATGATCGTCACCAAGAATGGAAGACGAATGTTTCCAGTTCTGAAGGTGAGCATGTCGGGCCTGGATCCCAATGCAATGTATACGGTTCTGCTGGACTTTGTGGCAGCCGACAACCACCGCTGGAAGTATGTGAATGGAGAATGGGTTCCAGGTGGCAAACCCGAGCCCCAGGCCCCCAGTTGTGTTTATATCCACCCAGACTCACCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTCTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCGAATCCACATAGTGAGAGTTGGTGGCACCCAGAGAATGATCACTAGCCATTCATTCCCTGAGAC
  5   1   2       bld DMZ  5g3  in                         xl286i17.5p                                                                                                                                                                                                                                                                         CTTATTCCCCTAATGTCAATTGGATTTACTACCTGCTGATCAATCGCACCTTGGGTTTTGTTCCGATTAGTGGAAAAGCTGCTAAAATTTTTCCCCCAGTCTGTGTGTTACGAAGCCTCCCTTTCTGGAGGAATGAGTGCGACCGAGAGCTGCGCCAAGAACGTGCAGTACCGGGTAGATCATCTGCTGAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAAAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGTCTGCAGGAGCGGGACCTGTGGACGAGGTTTAAGGAGCTCACCAATGAGATGATCGTCACTAAGAATGGAAGGAGAATGTTTCCAGTTCTGAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACGGTTCTTCTGGACTTTGTGGCAGCTGACAACCTCCGCTGGAAGTATGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCTAGTTGTGTTTACATCCACCCAGATTCCCCCAATTTTGGAGCCCACTGGATGAAAGATCCTGTGTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCGAATCCACATTGTGAGAGTTGGCGGCACCCAGAGAATGATCACCAGCCATTCATTCC
  5   1   2       bld DMZ  5g3  in                         xl287i17.5p                                                                                                                                                                                                                                                                         CTTATTCCCCTAATGTCAATTGGATTTACTACCTGCTGATCAATCGCACCTTGGGTTTTGTTCCGATTAGTGGAAAAGCTGCTAAAATTTTTCCCCCAGTCTGTGTGTTACGAAGCCTCCCTTTCTGGAGGAATGAGTGCGACCGAGAGCTGCGCCAAGAACGTGCAGTACCGGGTAGATCATCTGCTGAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAAAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGTCTGCAGGAGCGGGACCTGTGGACGAGGTTTAAGGAGCTCACCAATGAGATGATCGTCACTAAGAATGGAAGGAGAATGTTTCCAGTTCTGAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACGGTTCTTCTGGACTTTGTGGCAGCTGACAACCTCCGCTGGAAGTATGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCTAGTTGTGTTTACATCCACCCAGATTCCCCCAATTTTGGAGCCCACTGGATGAAAGATCCTGTGTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCGAATCCACATTGTGAGAGTTGGCGGCACCCAGAGAATGATCACCAGCCATTCATTCCCTGAGACACAGTTCATAGCAG
  5   1   2       bld Emb1 5g                IMAGE:6636009-IMAGp.IMAGp                                                                                                                                                                                                                                                                                CCCTAATGTCAATTGGATTTACTACCTGCTGATCAATCGCACCTTGGGTTTTGTTCCGATTAGTGGAAAAGCTGCTAAAATTTTTCCCCCAGTCTGTGTGTTACGAAGCCTCCCTTTCTGGAGGAATGAGTGCGACCGAGAGCTGCGCCAAGAACGTGCAGTACCGGGTAGATCATCTGCTGAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAAAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGTCTGCAGGAGCGGGACCTGTGGACGAGGTTTAAGGAGCTCACCAATGAGATGATCGTCACTAAGAATGGAAGGAGAATGTTTCCAGTTCTGAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACGGTTCTTCTGGACTTTGTGGCAGCTGACAACCTCCGCTGGAAGTATGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCTAGTTGTGTTTACATCCACCCAGATTCCCCCAATTTTGGAGCCCACTGGATGAAAGATCCTGTGTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCGAATCCACATTGTGAGAGTTGGCGGCACCCAGAGAATGATCACCAGCCATTCATTCCCTGAGACACAGTTCAT
  5   1   2       bld Emb1 5g                         IMAGE:6636009.5p                                                                                                                                                                                                                                                                                 CCTAATGTCAATTGGATTTACTACCTGCTGATCAATCGCACCTTGGGTTTTGTTCCGATTAGTGGAAAAGCTGCTAAAATTTTTCCCCCAGTCTGTGTGTTACGAAGCCTCCCTTTCTGGAGGAATGAGTGCGACCGAGAGCTGCGCCAAGAACGTGCAGTACCGGGTAGATCATCTGCTGAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAAAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGTCTGCAGGAGCGGGACCTGTGGACGAGGTTTAAGGAGCTCACCAATGAGATGATCGTCACTAAGAATGGAAGGAGAATGTTTCCAGTTCTGAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACGGTTCTTCTGGACTTTGTGGCAGCTGACAACCTCCGCTGGAAGTATGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCTAGTTGTGTTTACATCCACCCAGATTCCCCCAATTTTGGAGCCCACTGGATGAAAGATCCTGTGTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCGAATCCACATTGTGAGAGTTGGCGGCACCCAGAGAATGATCACCAGCCATTCATTCCCTGAGACACAGTTCATAGCAGTGACCGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAGCACAAACCATTTGCCAAAGCATTTCTTGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGNATGGAGGGAATTATTAATCAGGACTCCAAATTTCTCTCAGTTAGGTACTTTGGCTCATTTCCTTAAG
  5   1   2       bld Ga12 5g3  in                         XL200f12.5p                                                                                                                                                                                                                                                                                              GATTTACTACCTGCTGATCAATCGCACCTTGGGTTTTGTTCCGATTAGTGGAAAAGCTGCTACAAGTTTTTCCCCCAGTCTGTGTGTTACGAAGCCTCCCTTTCTGGAGGAATGAGTGCGACCGAGAGCTGCGCCAAGAACGTGCAGTACCGGGTAGATCATCTGCTGAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAAAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGTCTGCAGGAGCGGGACCTGTGGACGAGGTTTAAGGAGCTCACCAATGAGATGATCGTCACTAAGAATGGAAGGAGAATGTTTCCAGTTCTGAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACGGTTCTTCTGGACTTTGTGGCAGCTGACAACCTCCGCTGGAAGTATGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCTAGTTGTGTTTACATCCACCCAGATTCCCCCAATTTTGGAGCCCACTGGATGAAAGATCCTGTGTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCGAATCCACATTGTGAGAGTTGGCGGCACCCAGAGAATGATCACCAGCCATTCATTCCCTGAGACACAGTTCATAGCAGTGACCGCATACCA
  5   1   2       bld DMZ       in                         xl266a02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAAGGTTAGCCTGGAGGAGCGGGACCTGTGGACGAGGTTCAAGGAGCTCACCAACGAGATGATCGTCACCAAGAATGGAAGACGAATGTTTCCAGTTCTGAAGGTGAGCATGTCGGGCCTGGATCCCAATGCAATGTATACGGTTCTGCTGGACTTTGTGGCAGCCGACAACCACCGCTGGAAGTATGTGAATGGAGAATGGGTTCCAGGTGGCAAACCCGAGCCCCAGGCCCCCAGTTGTGTTTATATCCACCCAGACTCACCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTCTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCGAATCCACATAGTGAGAGTTGGTGGCACCCAGAGAATGATCACTAGCCATTCATTCCCTGAGACACAGTTCATAGCAGTGACCGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAATCCATTTGCCAAAGCATTTCTTGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGAATCGATAGTCAGCATTCTAATTTCTCTCAATTAGGTACTTGGCTTATTCCTAATGGTGGGTCATTATGTTCGCCCAATCCACACACTCAGTTCGGGGCACCTCTCTCTCTATCGTCACCTCATGGCTGTGAGCGATACTCATCTCTNAGGAACCACCGCTCAG
  5   1   2       bld Neu1      in                      Neu1-20E9-2.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAGAATGGGTTCCAGGTGGCAAACCCGAGCCCCAGGCCCCCAGTTGTGTTTATATCCACCCAGACTCACCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTCTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCGAATCCACATAGTGAGAGTTGGTGGCACCCAGAGAATGATCACTAGCCATTCATTCCCTGAGACACAGTTCATAGCAGTGACCGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAATCCATTTGCCAAAGCATTTCTTGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGAATCGATAGTCAGCATTCTAATTTCTCTCAATTAGGTACTTGGCTTATTCCTAATGGTGGGTCATTATGTTCGCCCAATCCACACACTCAGTTCGGGGCACCTCTCTCTCTATCGTCACCTCATGGCTGTGAGCGATACTCATCTCTAAGGAACCACCGCTCAGCTCCTTACCCCAGTCCGTACACTCACAGAAACAATTCTCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTGTCAATGCTCCAGTCCCATGATAACTGGTCTACCCTCTCAAATGCCAGCACACACTGGGATGTTGCCAATGAGTCACAGCACGGGAACACCACCTCTCTCAAGTCAGTACCCTGTCTCTATGGTCTGTGAGTAACAGTGCCATCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTTACTTGGCTCTCACCCCTCACTACTCGTCTCTTCACATGCTGTGCGTCACCATCCACAGGTCTCCCATTGTATGAGCCTGGAGGCCCCAAACCAGAAAATAGCAGAAACAGTATGATGTCACGGCACATTCTAGGCTTTCATCACATGACACCGTGCGCACCATTCA
  5   1   2       bld Ga18      in                      xlk127k17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTTTGGAGCCCACTGGATGAAAGATCCTGTCTCTTTTAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGTTAAACTCTTTGCACAAGTATGAACCTCGAATCCACATAGTGAGAGTTGGTGGCACCCAGAGAATGATCACTAGCCATTCATTCCCTGAGACACAGTTCATAGCAGTGACCGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAATCCATTTGCCAAAGCATTTCTTGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGAATCGATAGTCAGCATTCTAATTTCTCTCAATTAGGTACTTGGCTTATTCCTAATGGTGGGTCATTATGTTCGCCCAATCCACACACTCAGTTCGGGGCACCTCTCTCTCTATCGTCACCTCATGGCTGTGAGCGATACTCATCTCTNAGGAACCACCGCTCAGCTCCTTACCCCAGTCCGTACACTCACAGAAACAATTCTCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTGTCAATGCTCCAGTCCCATGATAACTGGNCTACCCTTCAAATGCCAGCACACACTGGGATGTTNCCAATGAGTCACAGCACGGG
  5   1   2       bld Unk4                                726_21H24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATTACAGCACTTAAAATCAAACACAATCCATTTGCCAAAGCATTTCTTGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGAATCGATAGTCAGCATTCTAATTTCTCTCAATTAGGTACTTGGCTTATTCCTAATGGTGGGTCATTATGTTCGCCCAATCCACACACTCAGTTCGGGGCACCTCTCTCTCTATCGTCACCTCATGGCTGTGAGCGATACTCATCTCTAAGGAACCACCGCTCAGCTCCTTACCCCAGTCCGTACACTCACAGAAACAATTCTCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTGTCAATGCTCCAGTCCCATGATAACTGGTCTACCCTTCAAATGCCAGCACACACTGGGATGTTGCCAATGAGTCACAGCACGGGAACACCACCTCCCTCAAGTCAGTACCCTTCTTTATGGTCTGTGAGTAACAGTGCCATCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACTTGGCTCTACACCTCACTACTCGTCTCTTTCACATGCTGTGCCCTCACCATCCACAGGATCTCCATTGTATGAGCATGGAGCACAAACAGAAATAGCAGAAAACCAGTATGATGTCACGGCACATTCCAGGCTTTCATCAACATGGACACCCGTTGCGCCACCATCAGTCTAAAGTAAAGACCTTGAGGACTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTT
  5   1   2       bld Ga12      in                         XL163e11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACTTAAAATCAAGGCACAACCCATTTGCCAAAGCATTTCTTGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGAATTAATAGTCAGCACTCAAATTTCTCTCAGTTAGGTACTTGGCTCATTCCTAATGGTGGATCATTATGTACGCCCAATCCACACACTCAGTTCGGGGCACCTCTCTCTCTATCATCTCCTCATGGCTGTGAGCGATACTCATCTCTGAGGAACCACCGCTCCGCTCCTTACCCCAGTCCATACACTCACAGAAACAATTNTCCAAACAATTTAACAGATAATTCCTCAGCATGTCTTTCAATGCTCCAGTCCCATGGCAACTGGTCCACACTTCAAATGCCAGCACACACAGGGATGTTGCCAATGAGTCACAGCACAGGAACACCACCTACCTCAAGTCAGTACACTTNTTTGTGGTCTGTAAGTAACAGTACCATCACACCAGTGTCTCANTCTGGAGGAATAAGTAATGGAACAAG
  5   1   2       bld Ga12      in                         XL160k14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACTTAAAATCAAGCACAACCCATTTGCCAAAGCATTTCTTGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGAATTAATAGTCAGCACTCAAATTTCTCTCAGTTAGGTACTTGGCTNATTCCTAATGGTGGATCATTATGTACGCCCAATCCACACACTCAGTTCGGGGCACCTCTCTCTCTATCATCTCCTCATGGCTGTGAGCGATACTCATCTCTGAGGAACCACCGNTCCGCTCCTTACCCCAGNCCATACACTCACAGAANCAATTCTCCAAACAATTTAACAGATAATTCCTCAGCATGTCTTTCAATGCTCCAGTCCCATGGCAACTGGNCCACACTTCAAATGCCAGCACACACAGGGATGTTGCCAATGAGTCACAGNACAGGAACACCACCTACCTCAAGTCAGTACACTTCTTTGNGGTCTGTAAGTAACAGTACCATCACACCAGTGTCTCAGTCTGGAGGAATAAGTAATGGAACAAGTGCCCAGTACCTACGTGGCTCTACACCTCATTACTCATCTCTTTCACATGCTGTGCCCTCACCAACCACAGGATCCCCATTGTATGAACATGGAGCACAAACAGAAATAGCAGAAA
  5   1   2       bld Ga18      in                       xlk60k05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GANGAGGGANTCGATAGTCAGCATTCTAATTTCTCTCAATTAGGTACTTGGCTTATTCCTAATGGTGGGTCATTATGTTCGCCCAATCCACACACTCAGTTCGGGGCACCTCTCTCTCTATCGTCACCTCATGGCTGTGAGCGATACTCATCTCTAAGGAACCACCGCTCAGCTCCTTACCCCAGTCCGTACACTCACAGAAACAATTCTCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTGTCAATGCTCCAGTCCCATGATAACTGGTCTACCCTTCAAATGCCAGCACACACTGGGATGTTGCCAATGAGTCACAGCACGGGAACACCACCTCCCTCAAGTCAGTACCCTTCTTTATGGTCTGTGAGTAACAGTGCCATCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACTTGGCTCTACACCTCACTACTCGTCTCTTTCACATGCTGTGNCCTCACCATCCACAGGATCTCCATTGTATGAGCATGGAGCACAAACAGAAATAGCAGAAAACCAGTATGATGTCACGGCACATTCCAGGCTTTCATCAACATGGACACCCGTTGCGCCACCATCAGTCTAAAGTAAAGANCTTGAGGNCTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGNCTCCAAAACAACTTA
  5  -1   2       bld Bla2                            IMAGE:7299677.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACGGGTATAATTACTAATNNTTATNGTGGGGGTGGGATAANATCCCACCCCTTATAttttttgtttgtgtttgcaaaaggacaatctttttaatattttttAAAGGCAAGGGGGGATCCCTTTTACAAACCAAATAATTTTTATTTTCCCTATGGGGGCAGGAATTTTTTTGGGGAAATTCCAAGTTTTTTCATTAAAAAATAAGCGAATTTTTAGCTTTTGCAAAGTCCATCCCAGAAAATGTTTACCCTTAATCGCAGCCACAAGGATGTTCCCATGGGTACAGCAAGGAACCCACCTCCCTCAAGTCATACCTTCTTTTGGTTGGGAGTACAGTGCATCACACCAGTGTCTCAGTTGGAGGATTAACTATTGGATAAGCTCCCAGTACTTACTGGGCTCTACACCTCACTACTCGTCTCTTTCACATGCTGTGGCCTCACCATCCACAGGATCTCCATTGTATGAGCATGGAGCACAAACAGAAATAGCAGAAAACCAGTATGATGTCACGGCACATTCCAGGCTTTCATCAACATGGACACCCGTTGCGCCACCATCAGTCTAAAGTAAAGACCTTGAGGACTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTGATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATAttttttttaatatgccttattaagtaaaaaataatttaaaatgtttaaataatttaaaatGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCAATCGCCCATGATTGGG
  5   1   2       bld Unk4                                AGL_20F06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCACCTCTCTCTCTATCATCTCCTCATGGCTGTGAGCGATACTCATCTCTGAGGAACCACCGCTCCGCTCCTTACCCCAGTCCATACACTCACAGAAACAATTCTCCAAACAATTTAACAGATAATTCCTCAGCATGTCTTTCAATGCTCCAGTCCCATGGCAACTGGTCCACACTTCAAATGCCAGCACACACAGGGATGTTGCCAATGAGTCACAGCACAGGAACACCACCTACCTCAAGTCAGTACACTTCTTTGTGGTCTGTAAGTAACAGTACCATCACACCAGTGTCTCAGTCTGGAGGAATAAGTAATGGAACAAGTCCCCAGTACCTACGTGGCTCTACACCTCATTACTCATCTCTTTCACATGCTGTGCCCTCACCAACCACAGGATCCCCATTGTATGAACATGGAGCACAAACAGAAATAGCAGAAAACCAGTATGATGTCACTGCACATTCCAGGCTTTCATCAGCATGGACACCAGTTGCACCACCATCAATCTAAAGTAAAGACTATAAGGACTTAATACACAAATCAGTATTTCCTGGGCCAAGTAGCTGAGTGTCCATGGCCCATAAAGCAAATGATTGCTGCAGGCCTCCCAAATAACTTAAAGTTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTAGTTTTCTGAATGTACTGGCAAGGGGTGATTATCCAGGAGCTCTTCTAAAGGGAATGTAA
  5   1   2       bld Gas3      in                      xlnga002i16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCCTTACCCCTGTCCATACACTCACAGAAACAATTCTCCAAACAATTTAACAGATAATTCCTCAGCATGTCTTTCAATGCTCCAGTCCCATGGCAACTGGTCCACACTTCAAATGCCAGCACACACAGGGATGTTGCCAATGAGTCACAGCACA
  5   1   2       bld Ga18      in                      xlk118e22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTNGTCTACCCTTCAAATGCCAGCACACACTGGGATGTTGCCAATGAGTCACAGCACGGGAACACCACCTCCCTCAAGTCAGTACCCTTCTTTATGGTCTGTGAGTAACAGTGCCATCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACTTGGCTCTACACCTCACTACTCGTCTCTTTCACATGCTGTGNCCTCACCATCCACAGGATCTCCATTGTATGAGCATGGAGCACAAACAGAAATAGCAGAAAACCAGTATGATGTCACGGCACATTCCAGGCTTTCATCAACATGGACACCCGTTGCGCCACCATCAGTCTAAAGTAAAGACCTTGAGGACTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGNCTCCAAAACAACTTAAAGATGTGCTTAGNNAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCNACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGNACAAAGNNGGGTTAACTTACACATANTAANGTGATTACACCAAGGNNCGTTATCACCTCTGTATATTCTACNNCATTTTTCTGAATGTACTNGCANGGGGNGATTTACCCAGGNGNCTCTTTTAANGGNANNNNAAAAATAC
  3   1   2      seed Ga18      in                      xlk118e22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GNNNGGGAACNCCNNNNCNNNAAGTCAGTACCNNNNTNNTNNTCNGTGANNANNNAGTGNCATCANNCNANTNNCTCAGTCTGNNGGAATAACTAANNNAATAAGCTCCCAGNANNNCTNGNCTCTACACCTCNCTACTCNTCTCTTTCACATNNTGNGCCCTCACNATCCACAGGATCTCCATTGTATGAGCATGGAGNACAAACAGAAATAGCAGAAAACCAGTATGATGTCACGGCACATTCCAGGCTTTCATCAACATGGACACCCGTTNNGCCACCATCAGTCTAAAGTANAGNCCTTGAGGACTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGA
  5   1   2       bld DMZ       in                         xl324d19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACAGTACCATCACACCAGTGTCTCAGTCTGGAGGAATAAGTAATGGAACAAGTCCCCAGTACCTACGTGGCTCTACACCTCATTACTCATCTCTTTCACATGCTGTGCCCTCACCAACCACAGGATCCCCATTGTATGAACATGGAGCACAAACAGAAATAGCAGAAAACCAGTATGATGTCACTGCACATTCCAGGCTTTCATCAGCATGGACACCAGTTGCACCACCATCAATCTAAAGTAAAGACTATAAGGACTTAATACACAAATCAGTATTTCCTGGGCCAAGTAGCTGAGTGTCCATGGCCCATAAAGCAAATGATTGCTGCAGGCCTCCCAAATAACTTAAAGTTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGNTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACA
  5   1   2       bld Ga12      in                         XL159e08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACACCAGTGTCTCAGTCTGGAGGAATAAGTAATGGAACAAGTCCCCAGTACCTACGTGGCTCTACACCTCATTACTCATCTCTTTCACATGCTGTGCCCTCACCAACCACAGGATCCCCATTGTATGAACATGGAGCACAAACAGAAATAGCAGAAAACCAGTATGATGTCACTGCACATTCCAGGCTTTCATCAGCATGGACACCAGTTGCACCACCATCAATCTAAAGTAAAGACTATAAGGACTTAATACACAAATCAGTATTTCCTGGGCCAAGTAGCTGAGTGTCCATGGCCCATAAAGCAAATGATTGCTGCAGGCCTCCCAAATAACTTAAAGTTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCC
  3   1   2       bld Ga18                             rxlk106k06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ANNAATAGNAGAAACNAGTANGNNGTCNCGNNNCNTTCCANGCTTTCNNNACATGGANNNCCGTTGNNCCACCATCAGTCTAAAGTAAAGNCCTTGAGGACTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGNTNCCTGGTACATAAAGCAAATGATTGCTGTAGNCCTCCAAAACAACTNAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGNCTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCNCCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGNAAG
  3   1   2       bld Ga18      in                       xlk60k05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGNTTTCNNCANCATGGACNNCGTTGNNCCACCNTCAGTCTAAAGTAAAGNCCTTGAGGACTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGNTCCCTGGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAANCAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTANNNTGNAAG
  3   1   2       bld Ga18      in                      xlk127k17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCATCAGTCTAAAGTAAAGNCCTTGAGGNCTCAGTATAAAATCAGTATTTNNTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGNNCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGNCTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGAC
  3   1   2       bld DMZ  5g3  in                         xl231b15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTCTAAAGTAAAGGCCCTTGAGGACTCAGTATAAAAATCAGTNTTTCCTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAANTGANTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCANCCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCNGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCNTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTAnTAAGTAAAAAATAATTTAAAATGTTTAAATAATnTAAAATGTGGTACCGTCTAGATTATGGAAAAATNTTGGAAGCAGCTTTNGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTANATCATTGTGTAACTGGNATTGCNGTATTTATNTNATCTNCATGTTTTTGTGGTAAATGTANANGTGCNGTAAATATGTT
  3   1   2       bld DMZ  5g3  in                         xl333o12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCTAAAGTAAAGACCTTGAGGACTCAGTATAAAAATCAGTATTTCCTGGNCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATNGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATG
  3   1   2       bld DMZ  5g3  in                         xl231n08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCAGTATAAAAATCAGTATTTCCTGGGCCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTCTTAAAGGGAATGTAAAANTACAGTNTTAATAAGAAGGTCTGCTTCTTTTNTACACTGCCTTNATATNGCTATAANTTACTNTTATTTGGGACTGCNGCTACAGACTACNCATTTTTATTATAGACATATTTTTTNTAATANGCCTTANTAAGTAAAAAATAATTTAAAAnGTTTAAATAATTTAAAANGTGGTACTGTCTAGATTATGGAAAAATCTTGGAAGCAGCTCTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCNGCTAANCTGATTNGAAATATGGTTTCTAAAAAAATAACCGGGGAGAGAAACGTATGTTATATCATTGTGTAAGCTGGTACNTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCCTGTAAATATGTTA
  3   1   2       bld DMZ  5g3  in                         xl263i08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGAATTGCTGGGGGTCCCTGGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACNGATTTGAAATANGGTTTCTAAAAAAATAACGGGGAGNNAAAGTATGNTATATCATTGTGTAACTGGTACTTGCTGNA
  5   1   2       bld DMZ                                  xl326d19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGTAGCTGAGTGTCCATGGCCCATAAAGCAAATGATTGCTGCAGGCCTCCCAAATAACTTAAAGTTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATA
  3   1   2       bld DMZ       in                         xl266a02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTACATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATANGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGGGAACAGAAAAATGGAGTCT
  3   1   2       bld DMZ                                 rxl226a21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAAAGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCT
  3   1   2       bld Ga12                                 XL149c24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCAAATGATTGCTGTAGGCCTCCAAAACAACTTAAAGATGTGCTTAGGCAAGTTATATCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAACAAAATAACGGGGAGAGANAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATCTTATTTCATCNTCATGTTTCTGTGGTAAATGTATATGTGTCTGTAAATATGTCTACTGTATGCTGTAA
  5   1   2       bld DMZ       in                         xl268c09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAAATGATTGCTGCAGGCCTCCCAAATAACTTAAAGTTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATAttttaaatatgcctttttaagtaaacctaatttaatatgtttaaataatttaaaaTGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGA
  5   1   2       bld DMZ       in                         xl268d09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAAATGATTGCTGCAGGCCTCCCAAATAACTTAAAGTTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATAttttaaatatgcctttttaagtaaacctaatttaatatgtttaaataatttaaaaTGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGNTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCA
  3   1   2       bld Neu1      in                      Neu1-20E9-2.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCTGGTACATAAGCAAATGATTGCTGTGCCTCCAACACAACTAAAGATGGCTTAGGCAAGTTATTCAGTGTTTACCTGCTTCTAAAGACTTCATGGGCCCAACCAGGGTGGGTGGTCTGCCCGCGGGCCCCCATATGGATATGATGCTTAGCACAAGTGGGGTTACTTACACATATTAAGTGATTACCCAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTCTGGCAGGGGTGATTTACCCAGGAGTCTCTTTTAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAG
  3   1   2       bld DMZ  5g3  in                         xl287i17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAAGGTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCAGTGTAAGGTATCTACCAATCTACACGTTGA
  3   1   2       bld DMZ       in                         xl324d19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAAGTTGTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCAGTGTAAGGTATCTACCAATCTAC
  3   1   2       bld DMZ  5g3  in                         xl286i17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGCTTAGGCTAGTTATGTCAGCCTTTCCCTGCTTCTAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCCTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCAGTGTAAGGTATCTACCAATCTACACGTTGATGTGG
  3   1   2       bld Ga12 5g3  in                         XL200f12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAAGGCTTCATGGATCCAACCAGGCATGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCAGTGTAAGGTATCTACCAATCTACACGTTGATGTGGGGGACCATGTGATGCTTCAATA
  3   1   2       bld Ga12      in                         XL163e11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCTTCATGGATCCAACCAGGCAGGGGTGGTCTGCTCAGTGGGTCACCATCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATNCAGTATTGCTTAATTNCAGTATTAANTAAGATCCATTNTGCTNNTTNTAAAACATTCCCTCTATTGNTCTAAATNACTCTTTATCTGAGAC
  3   1   2       bld DMZ  5g3  in                         xl243o14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCATGGGCCCAACCAGGTGTGGGTGGTCTGCTCAGCGGGCCACCATATGGATATAGATGCTTAGCACAAAGTGGGGTTAACTTACACATATTAAGTGATTACACCAAGGATCGTTATCACCTCTGTATATTCTACATCATTTTTCTGAATGTACTGGCAAGGGGTGATTTACCCAGGAGTCTCTTTTAAAGGGAATGTAAAAATACAGTATTAATAAGAAGGTCTGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTANATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGGGAACAGAAAAATNGAGTCTA
  3   1   2       bld DMZ       in                         xl268c09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCATCNTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCAGTGTAAGGTATCTACCAATCTACCACGTTGATG
  3   1   2       bld DMZ       in                         xl268d09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTTGAGATGCTTAACACAAAGTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCCAGTGTAAGGTATCTACCAATCTAC
  3   1   2       bld Ga12      in                         XL160k14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTGGTTTGACTTACATATAAGTGCAACATATAGGTTCTATTACCTGTATATTCTATGTCAGTTTTCTGAATGTACTGGCAAGGGGTGATTTATCCAGGAGGCTCTTCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAANTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTNCAGTGTAAGGTATCNACCAATNTACACGTNGATGTGGG
  3   1   2       bld Ga12      in                         XL159e08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTAAAGGGAATGTAAAGATACAGTATTGCTTAATTACAGTATTAACTAAGATCCATTCTGCTTTTTTTAAAACATTCCCTCTATTGTTCTAAATTACTTTTATCTGAGACTGCTGCCTGCTGCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGTATTTGTCTGAATCTGCTGTGTCAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCAGTGTAAGGTATCTACCAATCTACACGTTGATGTGGGGGACCATGNAGCTTCAATAAATACACT
  3   1   2       add Ga18      in                      xlk157p04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCNNNGNCCGNCCACGCGTCCGTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGAAAAATGGANTCTATTGTAATAAA
  3   1   2       bld Ga18      in                      xlk103o19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCNGTAAGA
  5   1   2       bld Ga18      in                      xlk103o19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCTTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATAttttttttaatatgccttattaagtaaaaaataatttaaaatgtttaaataatttaaaatGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGANaaaaaaaa
  5   1   2       add Ga18      in                      xlk157p04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCTTTTTTACACTGCCTTTATATTGCTATAAATTACTTTTATTTGGGACTGCTGCTACAGACTACACATTTTTATTATAGACATAttttttttaatatgccttattaagtaaaaaataatttaaaatgtttaaataatttaaaatGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGAAAAATGGAGTCTATTGTAATAAATATATCATTCAGGATGTTTTCATAGAAATaaaaaaaaaa
  3   1   2       bld Gas3      in                      xlnga002i16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTACAGAGTCAGACTACATGTTTTTTATTATAGACATATTTTAAATATGCCTTTTTAAGTAAACCTAATTTAATATGTTTAAATAATTTAAAATGTGGTACTGTCCAGATCATGGGAAAATATTTAGAGCAGGTATTTGTCTGATTACGCTGAGGACAGATTATCTGCTGCCTAAATACCCACAAACTGCACCAAGCTAGGTTAATTCTAAATAGTTTTTCCAAAAACTGAAGAGAACGTATGCTTTTCATTGTGTAACTGGTATTTCTGTATTTATTTTTTCCATGTGGCCATGTTTTTTGTGGTTAATGTATATGTACTGTAAACATGTTATTGTATGCTGAAAGACGATCTCTTTTGCCCCACTGAAGTGCAGTGTAAGGTATCTACCAATCTACACGTTGATGTGGGGGACCATGTGATGCTTCAATAAATACACTATTTTTTCTAAA
  3   1   2       bld Emb1 5g3  in                    IMAGE:3402478.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATATTTTTTTTAATATGCCTTATTAAGTAAAAAATAATTTAAAATGTTTAAATAATTTAAAATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGAAAAAA
  3  -1   2       add DMZ                                 rxl337j09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATGTGGTACTGGNCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCGTGCCTANATANCCACAANCTTCTCCCAGCNAAANTGATTTGAAATATGGCTTCTAAAAAAATAACGGGGANAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCNTCNTGTTTTTGTGGTANATGTATATGTGCTGTANATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGAAAAAAAAAAAAAAAAAAAAACCCCG
  3  -1   2       bld DMZ                                 rxl248p07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGTGGTACTGNCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATANCCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGAAAAAAAAAAAAAAAAAAAAACC
  3  -1   2       bld DMZ                                 rxl267b15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGTGGTACTGTCTAGATTATGGAAAAATATTGGAAGCAGCTTTTGTCTGAATCTGCTACTTGCTGCCTAAATAACCACAAACTTCTCCCAGCTAAACTGATTTGAAATATGGTTTCTAAAAAAATAACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCTTCATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGAAAAAAAAAAAAAAAAAAAAACC
  3  -1   2       add DMZ                                 rxl320o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGTGGTACTGNCTAGATTATGGAAAAATATTGGANGCAGCTTTTGTCTGAATCTGCTACTTGCGTGCCTANATANCCACAANCTTCTCCCAGCNNAANTGATTTGAAATATGGNTTCTAAAAAAATNACGGGGAGAGAAAGTATGTTATATCATTGTGTAACTGGTATTGCTGTATTTATTTTATCNTCNTGTTTTTGTGGTAAATGTATATGTGCTGTANATATGTTATTGTATGCTGTAAGACAATCCGATAAAAGAAATATTGTGGAACAGAAAAAAAAAAAAAAAAAAAAACCCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)