Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-rxl302f16.3                           9 PI      94         74     1100                hypothetical protein LOC100144979 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012770788 Xl3.1-IMAGE:7203605.3 - 30 ESTs
                                                                       .-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7203605.3                                TACATACAGGCCACTCTGTGCAATGCCTTTAGGGTTGAGCTTGGAGGGTTATTATGAAAACGCTTTAAGAAACTGTTATTTATGAAGTGGGAGAGGACTGTGACTTGTCAGAGGAAGATGTATATGACACGGAGAAAGCCAGCTCTGTACCTCAGAGAGGACAGCAGATCAAGCTTGTTTTTGGGGTTTCTGCCTCGGAAATGCAGCATTTTTAATTTGTTCCTGACTTGCTTGATCCTGGGTTTTCTATCTATGCTCTGGTTGCAACTCAGCTGTACTGGTGGTGATGTGAACAAGAGAGCAATTCAGGATGAAGTCTCTTCTCAGAAGTCCTGCCCCCAGATTCCTAGGACTGTGAATGAAGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGATCCCTTTTCGGGAGCGATTTGAAGAACTTATGAGCTTTGTTCCTCATATGCATCAGTACTTGATACAGAAAAAAATCCTTCATCATATTTTCATCATCAATCAAGTGGATCATTTTCGATTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGGAATGAAACGGATTACATAGCAATGCATGATGTGGACCTGTTGCCTCTTAACCTTGATTTGGATTATGGCTTCCCGGATAAGGGACCGTTCCACGTGGCCTCCCCAGAGCTGCACCCACTTTATCATTACAAGACATATGTGGGAGGGATTCTGCTGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGACGAGTTTTACAGAAGGATAAAAGGAGCTGAACTAGAGCTCTTTCGTCCGACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTTGCCTTGCCATTCTGTTTGGTAAAAAGACTGTTACTTTAAAAAA
                                                  Xl3.1-CHK-1012688053                                      CAGGCCACTCTGTGCAATGCCTTTAGGGTTGAGCTTGGAGGGTTATTATGAAAACGCTTTAAGAAACTGTTATTTATGAAGTGGGAGAGGACTGTGACTTGTCAGAGGAAGATGTATATGACACGGAGAAAGCCAGCTCTGTACCTCAGAGAGGACAGCAGATCAAGCTTGTTTTTGGGGTTTCTGCCTCGGAAATGCAGCATTTTTAATTTGTTCCTGACTTGCTTGATCCTGGGTTTTCTATCTATGCTCTGGTTGCAACTCAGCTGTACTGGTGGTGATGTGAACAAGAGAGCAATTCAGGATGAAGTCTCTTCTCAGAAGTCCTGCCCCCAGATTCCTAGGACTGTGAATGAAGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGATCCCTTTTCGGGAGCGATTTGAAGAACTTATGAGCTTTGTTCCTCATATGCATCAGTACTTGATACAGAAAAAAATCCTTCATCATATTTTCATCATCAATCAAGTGGATCATTTTCGATTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGGAATGAAACGGATTACATAGCAATGCATGATGTGGACCTGTTGCCTCTTAACCTTGATTTGGATTATGGCTTCCCGGATAAGGGACCGTTCCACGTGGCCTCCCCAGAGCTGCACCCACTTTATCATTACAAGACATATGTGGGAGGGATTCTGCTGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGACGAGTTTTACAGAAGGATAAAAGGAGCTGAACTAGAGCTCTTTCGTCCGACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTTGCCTTGCCATTCTGTTTGGTAAAAAGACTGTTACTTT
                                                      consensus depths                                     2     2     2     2     3     3     3     3     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     5     6     5     6     5     6     5     6     5     6     4     5     3     5     3     5     3     5     3     5     3     5     4     5     3     5     3     5     3     5     2     5     2     5     2     4     2     4     2     4     2     4    21    22    21    22    21    22    21    22    21    21    21    21    21    22    22    23    22    23    22    23    21    22    22    22    21    22    22    22    22    22    22    22    22    22    21    22    21    22    20    22    20    22    21    23    21    22    21    21    20    21    21    21    21    21    20    20    17    20    17    20    16    20    17    19    17    18    16    18     9     9     8     8     8     8     5     6
                                               BLH ATG     117    1204                                
                                               BLH MIN     117     170                                
                                               BLH MPR     114     170                                
                                               BLH OVR      81     647                                
                                               CDS MIN      81     170                                
                                               EST CLI     885      53                                
                                               ORF LNG      81      75                                
  5   1   2       bld Tad1 5g                         IMAGE:6879817.5p ACAGTCCATGGGAGGCGATGCAGTTCATTTGTACATACAGGCCACTCTGTGCAATGCCTTTAGGGTTGAGCTTGGAGGGTTATTATGAAAACGCTTTAAGAAACTGTTATTTATGAAGTGGGAGAGGACTGTGACTTGTCAGAGGAAGATGTATATGACACGGAGAAAGCCAGCTCTGTACCTCAGAGAGGACAGCAGATCAAGCTTGTTTTTGGGGTTTCTGCCTCGGAAATGCAGCATTTTTAATTTGTTCCTGACTTGCTTGATCCTGGGTTTTCTATCTATGCTCTGGTTGCAACTCAGCTGTACTGGTGGTGATGTGAACAAGAGAGCAATTCAGGATGAAGTCTCTTCTCAGAAGTCCTGCCCCCAGATTCCTAGGACTGTGAATGAAGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGATCCCTTTTCGGGAGCGATTTGAAGAACTTATGAGCTTTGTTCCTCATATGCATCGGTACTTGATACAGAAAAAAATCCTTCATCATATTTTCATCATCAATCAAGTGGATCATTTTCGATTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGGAATNGAACGGATTACATAGCAATGCATGATGTGGACCTGTTGCCTCTTAACCTTGATTTGGATTATGGCTTCCCGGGATAAGGGAACCGTTCCACGTTGGCCCTCCCCAGAAGCTGCACCCCACTTTATCAT
  5   1   2       bld Te2  5g3  in                    IMAGE:7207777.5p                                TACATACAGGCCACTCTGTGCAATGCCTTTAGGGTTGAGCTTGGAGGGTTATTATGAAAACGCTTTAAGAAACTGTTATTTATGAAGTGGGAGAGGACTGTGACTTGTCAGAGGAAGATGTATATGACACGGAGAAAGCCAGCTCTGTACCTCAGAGAGGACAGCAGATCAAGCTTGTTTTTGGGGTTTCTGCCTCGGAAATGCAGCATTTTTAATTTGTTCCTGACTTGCTTGATCCTGGGTTTTCTATCTATGCTCTGGTTGCAACTCAGCTGTACTGGTGGTGATGTGAACAAGAGAGCAATTCAGGATGAAGTCTCTTCTCAGAAGTCCTGCCCCCAGATTCCTAGGACTGTGAATGAAGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGATCCCTTTTCGGGAGCGATTTGAAGAACTTATGAGCTTTGTTCCTCATATGCATCAGTACTTGATACAGAAAAAAATCCTTCATCATATTTTCATCATCAATCAAGTGGATCATTTTCGATTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGGAATGAAACGGATTACATAGCAATGCATGATGTGGACCTGTTGCCTCTTAACCTTGATTTGGATTATGGCTTCCCGGATAAGGGACCGTTCCACGTGGCCTCCCCAGAGCTGCACCCACTTTATCATTACAAGACATATNGTGGGAGGGATTCTGCTGCTCACCAAACAGCATTTATGAAATGTGCATGGGATGTCCNATCGATTCTGGGGATGGGGGTAGGGNAAGATGACGAGTTTTACAGAAAGATAAAAGGAGCTGGGACTAGAGCTCTTTTCGTTCGGACAGGAATAAGCACAGGGATACAAAACCTCTCGGTCCCATAATG
  5   1   2       bld Ga12      in                         XL165h04.5p                                             CTCTGTGCAATGCCTTTAGGGTTGAGCTTGGAGGGTTATTATGAAAACGCTTTAAGAAACTGTTATTTATGAAGTGGGAGAGGACTGTGACTTGTCAGAGGAAGATGTATATGACACGGAGAAAGCCAGCTCTGTACCTCAGAGAGGACAGCAGATCAAGCTTGTTTTTGGGGTTTCTGCCTCGGAAATGCAGCATTTTTAATTTGTTCCTGACTTGCTTGATCCTGGGTTTTCTATCTATGCTCTGGTTGCAACTCAGCTGTACTGGTGGTGATGTGAACAAGAGAGCAATTCAGGATGAAGTCTCTTCTCAGAAGTCCTGCCCCCAGATTCCTAGGACTGTGAATGAAGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGATCCCTTTTCGGGAGCGATTTGAAGAACTTATGAGCTTTGTTCCTCATATGCATCAGTACTTGATACAGAAAAAAATCCTTCATCATATTTTCATCATCAATCAAGTGGATCATTTTCGATTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGGAATGAAACGGATTACATAGCAATGCATGATGTGGACCTGTT
  5   1   2       bld Te2N 5g3  in                    IMAGE:7203605.5p                                                                        TTGGAGGGTTATTATGAAAACGCTTTAAGAAACTGTTATTTATGAAGTGGGAGAGGACTGTGACTTGTCAGAGGAAGATGTATATGACACGGAGAAAGCCAGCTCTGTACCTCAGAGAGGACAGCAGATCAAGCTTGTTTTTGGGGTTTCTGCCTCGGAAATGCAGCATTTTTAATTTGTTCCTGACTTGCTTGATCCTGGGTTTTCTATCTATGCTCTGGTTGCAACTCAGCTGTACTGGTGGTGATGTGAACAAGAGAGCAATTCAGGATGAAGTCTCTTCTCAGAAGTCCTGCCCCCAGATTCCTAGGACTGTGAATGAAGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGATCCCTTTTCGGGAGCGATTTGAAGAACTTATGAGCTTTGTTCCTCATATGCATCAGTACTTGATACAGAAAAAAATCCTTCATCATATTTTCATCATCAATCAAGTGGATCATTTTCGATTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGGAATGAAACGGATTACATAGCAATGCATGATGTGGACCTGTTGCCTCTTAACCTTGATTTGGATTATGGCTTCCCGGATAAGGGACCGTTCCACGTGGCCTCCCCAGAGCTGCACCCACTTTATCATTACAAGACATATGTNGGGAGGGATTCTGCTGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCATTCTGGGGATGGGGGGTAGGGGAAGATGACGAGTTTTACAGGAAGGATAAAAGGAGCTGAACTAGAGCTCTTTCGTCCGACAGAATAAGCACAGGATACAAACTTTCCGTCACATACTGAACCTCTGCATGGAGGAAACCAAAAACCAAAAGAGGGATTGTTGGCTTCAAAGCG
  3   1   2       bld Ga12      in                         XL165h04.3p                                                                                                                     AGTGGGAGAGGACTGTGACTTGTCAGAGGAAGATGTATATGACACGGAGAAAGCCAGCTCTGTACNTCAGAGAGGACAGCAGATCAAGCTTGTTTTTGGGGTTTCTGCCTCGGAAATGCAGCATTTTTAATTTGTTCCTGACTTGCTTGATCCTGGGTTTTCTATCTATGCTCTGGTTGCAACTCAGCTGTACTGGTGGTGATGTGAACAAGAGAGCAATTCAGGATGAAGTCTCTTCTCAGAAGTCCTGCCCCCAGATTCCTAGGACTGTGAATGAAGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGATCCCTTTTCGGGAGCGATTTGAAGAACTTATGAGCTTTGTTCCTCATATGCATCAGTACTTGATACAGAAAAAAATCCTTCATCATATTTTCATCATCAATCAAGTGGATCATTTTCGATTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGGAATGAAACGGATTACATAGCAATGCATGATGTGGACCTGTTGCCTCTTAACCTTGATTTGGATTATGGCTTCCCGGATAAGGGACCGTTCCACGTGGCCTCCCCAGAGCTGCACCCACTTTATCATTACAAGACATATGTGGGAGGGATTCTGCTGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGACGAGTTTTACAGAAGGATAAAAGGAGCTTAAAAAGAAAAAAAAGAAGAAAAAAGA
  5   1   2       bld Ga12                                 XL154b09.5p                                                                                                                                                                              CTCTGTACCTCAGANAGGACAGCAGATCAAGCTTGTTTTTGGGGTTTCTGCCTCGGAAATGCAGCATTTTTAATTTGTTCCTGACTTGCTTGATCCTGGGTTTTCTATCTATGCTCTGGTTGCAACTCAGCTGTACTGGTGGTGATGTGAACAAGAGAGCAATTCAGGATGAAGTCTCTTCTCAGAAGTCCTGCCCCCAGATTCCTAGGACTGTGAATGAAGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGATCCCTTTTCGGGAGCGATTTGAAGAACTTATGAGCTTTGTTCCTCATATGCATCAGTACTTGATACAGAAAAAAATCCTTCATCATATTTTCATCATCAATCAAGTGGATCATTTTCGATTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGGAATGAAACGGATTACATAGCAATGCATGATGTGGACCTGTTGCCTCTTAACCTTGATTTGGATTATGGCTTCCCGGATAAG
  3   1   2       bld Te2  5g3  in                    IMAGE:7207777.3p                                                                                                                                                                                                                                                                                                                       TGTGGTGAGGGAANCAAGAGAAGCATTTCAGGATGAAGTCTCTCTCAGAAGTCCTGCCCCCAGATTCCTAAGACTGTGAATGAAGATCCCTCATGGGTCCCTCACCGGCTTGCTTGNCTGATCCCTTTTCGGGAGCGATTTGAAGAACTTATGAGCTTTGTTCCTCATATGCATCAGTACTTGATACAGAAAAAAATCCTTCATCATATTTTCATCATCAATCAAGTGGATCATTTTCGATTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGGAATGAAACGGATTACATAGCAATGCATGATGTGGACCTGTTGCCTCTTAACCTTGATTTGGATTATGGCTTCCCGGATAAGGGACCGTTCCACGTGGCCTCCCCAGAGCTGCACCCACTTTATCATTACAAGACATATGTGGGAGGGATTCTGCTGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGACGAGTTTTACAGAAGGATAAAAGGAGCTGGACTAGAGCTCTTTCGTCCGACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATNTTCCAACANAGTCTGATGAAATTTTAGCCCAATAATGAACTTCTCGGTAGAA
  3   1   2       bld Te2N 5g3  in                    IMAGE:7203605.3p                                                                                                                                                                                                                                                                                                                                                                                                                       GGTCTCACCCGGCTGCTTTNGCTGATCCCTTTTCGGGAGCGATTGAAAGAACTTATGAGCTTGTTTCCTCATATGCATCAGTACTTGATACAGAAAAAAATCCTTCATCATATTTTCATCATCAATCAAGTGGATCATTTTCGATTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGGAATGAAACGGATTACATAGCAATGCATGATGTGGACCTGTTGCCTCTTAACCTTGATTTGGATTATGGCTTCCCGGATAAGGGACCGTTCCACGTGGCCTCCCCAGAGCTGCACCCACTTTATCATTACAAGACATATGTGGGAGGGATTCTGCTGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGACGAGTTTTACAGAAGGATAAAAGGAGCTGAACTAGAGCTCTTTCGTCCGACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCGACAGCTATTTCCAACAAGTCTGATGAAATTTAGCCAATAATGAACTCCGAGACATTTTAACAAAGAGCCCCTTAGGN
  3   1   2       bld DMZ                                 rxl284j20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGAGGCNTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACNGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCNTCAGTGGA
  3   1   2       bld DMZ                                 rxl284k17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTNTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCAGCATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGANTAATGTCTACATGAAAGTGCCTG
  5   1   2      seed DMZ       in                         xl230g21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTTGCCTTGCCATTCTGTTTGGTAAAAAGACTGTTACTTTaaaaaaaaaa
  5   1   2       bld DMZ       in                         xl283j20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTTGCCTTGCCATTCTGTTTGGTAAAAAGACTGTTACTTTaaaaaaaaaa
  5   1   2       bld DMZ       in                         xl283j21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCNACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTTGCCTTGCCATTCTGTTTGGTAAAAAGACTGTTACTTT
  5   1   2       bld DMZ       in                         xl283k18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTTGCCTTGCCATTCTGTTTGGTAAAAAGACTGTTACTTTANNAAAAAAA
  5   1   2       bld DMZ       in                         xl283k19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTTGCCTTGCCATTCTGTTTGGTAAAAAGACTGTTACTTTaaaaaaaaaa
  5   1   2       bld DMZ       in                         xl283k22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTTGCCTTGCCATTCTGTTTGGTAAAAAGACTGTTACTTTAA
  5   1   2       bld DMZ       in                         xl282k19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTTGCCTTGCCATTCTGTTTGGTAAAAAGACTGTTACTTTaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl282k19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTGCCTG
  3   1   2       bld DMZ       in                         xl230g21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTNTACATGAAAGTNC
  3   1   2       bld DMZ       in                         xl283j20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTGCCTGC
  3   1   2       bld DMZ       in                         xl283j21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTGCCT
  3   1   2       bld DMZ                                 rxl283k24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATNCAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAANGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTGCC
  3   1   2       bld DMZ       in                         xl283k22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACCATGAAAGTGCCTG
  3   1   2       bld DMZ       in                         xl283k19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTGCCTG
  3   1   2       bld DMZ       in                         xl283k18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTGCCTG
  3   1   2       bld DMZ                                 rxl283l23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTANTGAATGTTNTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCNTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATNTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATNTTATTTGGGATTTTACACCAAATGACCTACCAGCATGGACCTGCAAGTATCCAACAATGAAGGAAANACCGTTTATTTAAGGG
  3   1   2       bld DMZ                                 rxl283o19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGCATGGAGGAAGCGAGACCAGAAGAGGATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGGGCAGGAGGTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTNTACACCAAAGG
  5   1   2       bld Ga15      in                       XL451o08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTTGCCTTGCCATTCTGTTTGGTAAAAAGACTGTTACTTTATaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL451o08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTTGCACAGTGTTAAGTATCGTGTGGAATCAAGGTCAGAGGTCACCATCAGTGGAGCCCCTTGCACAGTACTGAATGTTCTCCTGGAATGTGACTTGGGGCACACACCATGGTGTGTCTTTAACTGAGGCCCAACAGCTATTTCCAACAAGTCTGATGAAATTTTAGCCAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTCTACAGAGTGCTCATATTTTATTTGGGATTTTACACCAAATGACCTACCACATGGACCTGCAAGTATCCAACAATGAAGGAAAACCGTTTATTTAAGGGATTAATGTCTACATGAAAGTTGCCTGCCAT
  3   1   2       bld DMZ                                 rxl283k21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAATAATGAACTCCGAGACATTTTTTATACAATAATAAACAGCACCCAATTGTACAGAGTGCTCATATNTTATTTGGGATTNTCCACCAAATGACCTACCAGCATGGATCCTGCAAGTATCCAGACACATGAAGGNA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)