Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:8329441.3                       6 END     2          11       33                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:7208123.5                       5 PI      90         18      784                (no blast hit)

 This cluster: approximate FL confidence score = 85%

 1012770796 Xl3.1-IMAGE:8535590.5 - 17 ESTs
                                                                       .....-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8535590.5                                    CCATTCTGGTCTGTGACGTCAGGCGCGGAGGCCGCCATTTTGGAGCGGAGAGAGTGGTGTTGGACGGATTGAGGCGCCCGGCGGGAGAGCCGTTATCTTCCGTTCGTTTCCCTTCCCCCCTTTTAGCCGGTAACATGTCGGATAAATACATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAATTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGATCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTCTAAAGACAGTGACGCGGATAAACAGTGGTGCTCCCCGGACGCTATTGTGTCGGTCGACAGAGCGAACAAAGCGAAAACCTTTCGAGGCGGACAATCACCACTCCACTTGTCGAGGAAGGCCTTCTTGCATGGAAAGGAGCACCCATGCACCCGCTGAACTTTATAACTAGAACGTGTAAGATAATAGAGTTTGTGAAATCCACCACATCTCATGGGTGGACGTACAGAGGCTCCAGTCCTCCCGGCTCGTGATTTATTTCGAAGCTCTCTCGGAAAGAGTCGTGTGACCCATCTCCATCACTGCCCTGATTTAGGACTT
                                                  Xl3.1-CHK-1012690832                                          TGGTCTGTGACGTCAGGCGCGGAGGCCGCCATTTTGGAGCGGAGAGAGTGGTGTTGGACGGATTGAGGCGCCCGGCGGGAGAGCCGTTATCTTCCGTTCGTTTCCCTTCCCCCCTTTTAGCCGGTAACATGTCGGATAAATACATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAATTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGATCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTCTAAAGACAGTGACGCGGATAAACAGTGGTGCTCCCCGGACGCTATTGTGTCGGTCGACAGAGCGAACAAAGCGAAAACCTTTCGAGGCGGACAATCACCACTCCACTTGTCGAGGAAGGCCTTCTTGCATGGAAAGGAGCACCCATGCACCCGCTGAACTTTATAACTAGAACGTGTAAGATAATAGAGTTTGTGAAATCCACCACATCTCATGGGTGGACGTACAGAGGCTCCAGTCCTCCCGGCTCGTGATTTATTTCGAAGCTCTCTCGGAAAGAGTCGTGTGACCCATCTCCATCACTGCCCTGATTTAGGACTTCCTTAC
                                                      consensus depths                                         2     2     2     2     4     5     5     7     7     8     8    10     9    11     9    11     9    11    11    13    13    14    13    15    16    16    16    16    16    16    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    16    17    16    17    15    17    15    17    15    17    15    17    15    17    14    16    14    16    14    16    13    16    13    15    13    15    12    14    12    14    12    14    11    13    11    13     7    13     7    13     6    13     6    13     6    13     5    13     7    13     5    13     4    12     4    12     3    11     2    10
                                                                   SNP                                                                                                                                                                                                                                                                                                ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------C----
                                               BLH ATG     134     276                                    
                                               BLH MIN     134      54                                    
                                               BLH OVR     134      25                                    
                                               EST CLI      17      13                                    
                                               ORF LNG     134       1                                    
  5   1   2       bld Te2N 5x3                        IMAGE:7205500.5p CTATTCCGCCTAGCGGCGGGGGGAGACTGGGCCCGCCATTCTGGTCTGTGACGTCAGGCGCGGAGGCCGCCATTTTGGAGCGGAGAGAGTGGTGTTGGACGGATTGAGGCGCCCGGCGGGAGAGCCGTTATCTTCCGTTCGTTTCCCTTCCCCCCTTTTAGCCGGTAACATGTCGGATAAATACATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAACTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGATCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTCTAAAGACAGTGACGCGGATAAACAGTGGTGCTCCCCGGACGCTATTGTGTCGGTCGACAGAGCGAACAAAGCGAAAACCTTTCGAGGCGGACAATCACCACTCCACTTGTCGAGGAAGGCCTTCTTGCATGGAAAGGAGCACCCATGCACCCGCTGAACTTTATAACTAGAACGTGNNTAGATATAGAGTTTNGTGAATCCACACATCTCATGGGTGGACGTACAGAGGCTCCAGTCCCTCCCGGCTCGTGATTTATTTTCGAGCTCTTCTCGGAAAGAGTCGTGGTGACCCATCTTCCTTCACCGGCCCTGAATTTAGGGACTTTCCTTTACGGTGGCC
  5   1   2      seed Ov1  5x3  out                   IMAGE:8329441.5p                                    CCATTCTGGTCTGTGACGTCAGGCGCGGAGGCCGCCATTTTGGAGCGGAGAGAGTGGTGTTGGACGGATTGAGGCGCCCGGCGGGAGAGCCGTTATCTTCCGTTCGTTTCCCTTCCCCCCTTTTAGCCGGTAACATGTCGGATAAATACATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAACTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGACCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTCTAAAGACAGTGACGCGGATAAACAGTGGTGCTCCCCGGACGCTATTGTGTCGGTCGACAGAGCGAACAAAGCGAAAACCTTTCGAGGCGGACAATCACCACTCCACTTGTCGAGGAAGGCCTTCTTGCATGGAAAGGAGCACCCATGCACCCGCTGA
  5   1   2       bld Te2  5x3                        IMAGE:7393822.5p                                                     GTCAGGCGCGGAGGCCGCCATTTTGGAGCGGAGAGAGTGGTGTTGGACGGATTGAGGCGCCCGGCGGGAGAGCCGTTATCTTCCGTTCGTTTCCCTTCCCCCCTTTTAGCCGGTAACATGTCGGATAAATACATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAACTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGACCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTCTAAAGACAGTGACGCGGATAAACAGTGGTGCTCCCCGGACGCTATTGTGTCGGTCGACAGAGCGAACAAAGCGAAAACCTTTCGAGGCGGACAATCACCACTCCACTTGTCGAGGAAGGCCTTCTTGCATGGAAAGGAGCACCCATGCACCCGCTGAACTTTATAACTAGAACGTGTAAGATAATAGAGTTTGTGAAATCCCCACATCTCATGGGTGGACGTACAGAGGCTCCAGTCTCCCGGCTCGTGATTTATTCGAGCTCTCTCGGAAAGAGTCG
  5   1   2       bld Panc 5x3                        IMAGE:8736330.5p                                                      TCAGGCGCGGAGGCCGCCATTTTGGAGCGGAGAGAGTGGTGTTGGACGGATTGAGGCGCCCGGCGGGAGAGCCGTTATCTTCCGTTCGTTTCCCTTCCCCCCTTTTAGCCGGTAACATGTCGGATAAATACATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAACTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGACCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTCTAAAGACAGTGACGCGGATAAACAGTGGTGCTCCCCGGACGCTATTGTGTCGGTCGACAGAGCGAACAAAGCGAAAACCTTTCGAGGCGGACAATCACCACTCCACTTGTCGAGGAACGCCTTCTTGCATGGAAAGGAGCACCCATGCACCCGCTGAACTTTATAACTAGAACGTGTAGATATAGAGTTTGTGAAATCCACCACATCTCATGGGTGGACGTACAGAGCTCAGTCCTCCCGGCTCGTGATTATTCGAGCTCTCTCGAAAGAGTCGTGTGACCCATCTCATTCACTGGCTTGAATAGAACTTCGTACGTTGCCAGACACTAGCGAAGCAGTCCAAGATGGGGGTTGTATA
  5   1   2       chi Sp1                             IMAGE:5512110.5p                                                          CGGACGCGTGGGCGGACTCGTGGGTCAGAGAGTGGTGTTGGACGGATTGAGGCGCCCGGCGGGAGAGCCTTTATCTTCCGTTCGTTTCCCTTCCCCCCTTTTAGCCGGTAACATGTCGGATAAATACATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAATTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGACCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGTAACCTGCCTACTTTTGCTTCTCCACACTGGATCTCTTGCAGTTCACTGTATCATAGAGCTGGGATGCGTCAACTTTTTTTACGTAAATGGATCACCCTGTCAGTGGCAGAAGGATCAGTGTCGCATTGGCTTCCCCATACGGCACGGACCCTTCCGACCCTGACGAAGCTAAGCTATTAACAGTTCACTGAAAACAGCTAGCTATTAACCGTGTTCCCGACCAGCAGATGCTGCTTGCTTAGAGTTTTGCAGTGGGTGATGGGAAATGTNTGATTTCTTGCGCTGAGAATTCGCTCAGATCCTTATGACTTTGTTTCTATGTAGAATN
  5   1   2       bld Egg1 5x3                           PBX0113G08.5p                                                              GGAGGCCGCCATTTTGGAGCGGAGAGAGTGGTGTTGGACGGATTGAGGCGCCCGGCGGGAGAGCCGTTATCTTCCGTTCGTTTCCCTTCCCCCCTTTTAGCCGGTAACATGTCGGATAAATACATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAATTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGATCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTCTAAAGACAGTGACGCGGATAAACAGTGGTGCTCCCCGGACGCTATT
  5   1   2       bld Ooc1 5x3                         Ooc1-db22c11.y1                                                                 GGGTCGACCCACGCGTCCGAGAGAGTGGTGTTGGACGGATTGAGGCGCCCGGCGGGAGAGCCGTTATCTTCCGTTCGTTTCCCTTCCCCCCTTTTAGCCGGTAACATGTCGGATAAATACATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAATTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGATCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTCTAAAGACAGTGACGCAGATAAACAGTGGTGCTCCCCGGACGCTATTGTGTCNGTCGACAGAGCGAACAAAGCGAAAACCTTTCGAGGCTGACAATCACCACTGCACTTGTCGAGGAAAG
  5   1   2       bld Em10 5x3                        IMAGE:8321570.5p                                                                                 GGAGAGAGTGGTGTTGGACGGATTGATTGCGCCCGGCGGGAGAGCCGTTATCTTCCGTTCGTTTCCCCTCCCCCCTTTTAGCCGGTAACATGTCGGATAAATACATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAATCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAACTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGATCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTCTAAAGACAGTGACGCGGATAAACAGTGGTGCTCCCCGGACGCTATTGTGTCGGTCGACAGAGCGAACAAAGCGAAAAACCTTTTCGAGGCGGAAAAA
  5   1   2       bld Lmb1 5x3                        IMAGE:8535590.5p                                                                                           GGTGTTGGACGGATTGAGGCGCCCGGCGGGAGAGCCGTTATCTTCCGTTCGTTTCCCTTCCCCCCTTTTAGCCGGTAACATGTCGGATAAATACATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAATTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGATCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTCTAAAGACAGTGACGCGGATAAACAGTGGTGCTCCCCGGACGCTATTGTGTCGGTCGACAGAGCGAACAAAGCGAAAACCTTTCGAGGCGGACAATCACCACTCCACTTGTCGAGGAAGGCCTTCTTGCATGGAAAGGAGCACCCATGCACCCGCTGAACTTTATAACTAGAACGTGTAAGATAATAGAGTTTGTGAAATCCACCACATCTCATGGGTGGACGTACAGAGGCTCCAGTCCCTCCGGCTCGTGATTTATTTCGAGCTCTCTCGGAAGAGTCGTGTGACCATCTCATCACTGCCTGATTNAGACTCGTACGTGGCCAACACTAGCAAAGCAGTCAGATGGGTGTATACTACGTACGGGAGTTGCTAACTTAGCTGGGTACA
  5   1   2       bld Kid  5x3                        IMAGE:4031445.5p                                                                                            GGTGTTGGACGGATTGAGGCGCCCGGCGGGAGAGCCGTTATCTTCCGTTCGTTTCCCTTCCCCCTTTTAGCCGGTAACATGTCGGATAAATACATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAATTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGATCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTCTAAAGACAGTGACGCGGATAAACAGTGGTGCTCCCCGGACGCTATTGTGTCGGTCGACAGAGCGAACAAAGCGAAAACCTTTCGAGGCGGACAATCACCACTCCACTTGTCGAGGAAGGCCTTCTTGCATGGAAAGGAGCACCCATGCACCCGCTGAACTTTATAACTAGAACGTGTAAGATACCGTAATAGAGTTTGTGAAATCCACACATCTCATGGGTGGACGTACAGAGGCTCCAGTCCTCCCGGCTCGTGATTTATTTCGAAGCTCTCTCGGAAAGAGTCGTGTGACCCATCTCCATCACTGCCCTGATTTAGGACATCGTAACGTGGCCCAGACCACTAGCCCAAAGCCAGTTCCAAGAAGGGGGTTGTATTTACCTACTGTTAAACCGGGGGAGGGTTGGCCCTAAAACTTTTTAAGCATTGGGGGTATAGCCAAATTTTAGGGAACACCCCTCCCTCCTATTCCCCCGGTA
  5   1   2       bld Int2 5x3                        IMAGE:8821509.5p                                                                                                 AGACCCCTAATGAACGCAGGATCCAATAAAATTCGAATTCGTCCCGTTTCCCTTCCCCCTTTTAGCCGGTAACATGTCGGATAAATACATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAATTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGATCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTCTAAAGACAGTGACGCGGATAAACAGTGGTGCTCCCCGGACGCTATTGTGTCGGTCGACAGAGCGAACAAAGCGAAAACCTTTCGAGGCGGACAATCACCACTCCACTTGTCGAGGAAGGCCTTCTTGCATGGAAAGGAGCACCCATGCACCCGCTGAACTTTATAACTAGAACGTGTAAGATACCGTAATAGAGTTTGTGAAATCCACCACATCTCATGGGTGGACGTACAGACGCTCCAGTCCTCCCGGCTCGTGATTTATTTCGAAGCTCTCTCGGAAAGAGTCGTGTGACCCATCTCCATCACTGCCCTGATTTAGACATCGTACGTGCCCAGACCACTAGCCAAAGCAGTCAGATGGGGTGTATACTACTGTTAACGGGAGTTGGCTAGACTTAGCATGGGTATAGCAATAGACCCCCTCCTCTATCCCAGTGAAATTTATAAAAAAGACTCTCTTGGA
  5   1   2       bld Tail 5x3                        IMAGE:8541662.5p                                                                                                                                        GCCCTTTTTCCCTTCCCCCCTTTTAGCCGGTAACATGTCGGATAAATACATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAACTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGACCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTCTAAAGACAGTGACGCGGATAAACAGTGGTGCTCCCCGGACGCTATTGTGTCGGTCGACAGAGCGAACAAAGCGAAAACCTTTCGAGGCGGACAATCACCACTCCACTTGTCGAGGAAGGCCTTCTTGCATGGAAAGGAGCACCCATGCACCCGCTGAACTTTATAACTAGAACGTGTAAGATAATAGAGTTTGTGAAATCCACCACATCTCATGGGTGGACGTACAGAGGCTCCAGTCCTCCCGGCTCGTGATTTATTTCGAAGCTCTCTCGGAAAGAGTCGTGTGACCCATCTCCATCACTGCCCTGATTTAG
  5   1   2       bld Emb4 5x3                        IMAGE:5570045.5p                                                                                                                                             TTCCCTTCCCCCCTTTTAGCCGGTAACATGGTCGGATAAATANCATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAATTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGATCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTCTAAAGACAGTGACGCGGATAAACAGTGGTGCTCCCCGGACGCTATTGTGTCGGTCGACAGAGCGAACAAAGCGAAAACCTTTCGAGGCGGACAATCACCACTCCACTTGTCGAGGAAGGCCTTCTTGCATGGAAAGGAGCACCCATGCACCCGCTGAACTTTATAACTAGAACGTGTAAGATAATAGAGTTTGTGAAATCCACCACATCTCATGGGTGGACGTACAGAGGCTCCAGTCCTCCCGGCTCGTGATTTATTTCGAAGCTCTCTCCGGAAAAAGTCGGGGGAACCATCTCCATCACTGCCCTGGATTAAGACTTCGTTACGTGGCCCAGACCCATAACCCAAAGCCAGTCCCAAAATGGGGGTGGAATTACCCACCGGGAAACGGGGGAAGGTTTTTCCTAAACTTTTTTAAACTTGGGGGA
  5   1   2       bld Brn3 5x3                        IMAGE:8540377.5p                                                                                                                                                    TTCCCCCCTTTTAGCCGGTAACATGTCGGATAAATACATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAATTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGATCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTCTAAAGACAGTGACGCGGATAAACAGTGGTGCTCCCCGGACGCTATTGTGTCGGTCGACAGAGCGAACAAAGCGAAAACCTTTCGAGGCGGACAATCACCACTCCACTTGTCGAGGAAGGCCTTCTTGCATGGAAAGGAGCACCCATGCACCCGCTGAACTTTATAACTAGAACGTGTAAGATAATAGAGTTTGTGAAATCCACCACATCTCATGGGTGGACGTACAGAGGCTCCAGTCCTCCCGGCTCGTGATTTATTTCGAAGCTCTCTCGGAAAGAGTCGTGTGACCCATCTCCATCACTGGCCTGATTTAGGACTTTCGTACGTGGCCCAGACACTAGCCAAAGCCAGTCCAGATGGGGGTGTATACTACTGTAAACGGGGAGTTNNGCTAGACTTAGCC
  5   1   2       add Emb1 5x3                        IMAGE:6634158.5p                                                                                                                                                                        ATGGTCGGATAAATANCATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAATTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGATCTTCCGCAGAGGAAGTCTTCACTGGTGACCCAGCAGCTAGCGGGGCATGTCGAGGACTGGCACACGTCTAAGACAGGACGCGGATAACAGTGGTGCTCCCCGACGCTATGTGTCGGTCGACAGAGCGAACAAGCGAAAACTTTCGAGGCGGACATCACCACTCACGTGTCAAGGAAGCCTTNCTGCATGAAAGGAGCACCATGCCCCGGTGAACTTATTACTAAACGGGGAAGAATATAAAATTTGGGAAATCCCCCACTTTTCTTGGGGGGAACGAAAAAGGGTTCCAAccccccccgggtcggggattttttttccaaaaccccctccgaaaaaaaaCCGGGGGGAAACCATTTCCCCAAAAAGGGCGCGGGATTTTAAGGAAAttttttttATAAGGGGGCCCCAAAACCCCCTTTTTCCAAAAAAGGCCGGT
  5   1   2       bld Tail      out                   IMAGE:8542914.5p                                                                                                                                                                           ATGTCGGATAATACATAGGAGACTCACACCTGGAAGAGACCGGCGAGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAACTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAGGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCCCTGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGACCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACCTGCACCACGTCTAAAGACAGTGACGCGGATAAACAGTGGTGCTCCCCGGACGCTATTGTGTCGGTCGACAGAGCGAACAAAGCGAAAACCTTTCGAGGCGGACAATCACCACTCCACTTGTCGAGGAAGGCCTTCTTGCATGGAAAGGAGCACCCATGCACCCGCAGAACTTTATAACTAGAACGTGTAAGATAATAGAGTTTGTGAAATCCACCACATCTCATGGGTGGACGTACAGAGGCTCCAGTCCTCACGGCTCGTGATTTATTTCGAAGCTCTCTCGGAAAGAGTCTTGTGACCCATCACTGCCCTGATTTAGGACATCGTTACGTGGCCCAGACCATGAGCCCAAAGCCGGTCCAAGATGG
  5   1   2       bld Ov1                             IMAGE:6317899.5p                                                                                                                                                                                                              CCACGCGTCCGGGAGAAGCAGGACTCCCAAGAAAAGGAAGCCGTGACTCCCGAAAAAGCAGAGGAGCAAAAACTGAAATCCAAATACCCTAACTTAGGACAGAAACCTGGAGGTTCAGACTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCAGGTGACTACAACATGGCAAAGGCCAAGATGAAGAACAAACAGCTGCCGTGCGCAGGGCCAGACAAGAACCTGGTAACCGGAGACCACATCCCTACGCCACAGGACCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTCTAAAGACAGTGACGCGGATAAACAGTGGTGCTCCCCGGACGCTATTGTGTCGGTCGACAGAGCGAACAAAGCGAAAACCTTTCGAGGCGGACAATCACCACTCCACTTGTCGAGGAAGGCCTTCTTGCATGGAAAGGAGCACCCATGCACCCGCTGAACTTTATAACTAGAACGTGTAAGATAATAGAGTTTGTGAAATCCACCACATCTCATGGGTGGACGTACAGAGGCTCCAGTCCTCCCGGCTCGTGATTTATTTCGAAGCTCTCTCGGAAAGAGTCGTGTGACCCATCTCCATCACTGCCCTGATTTAGGACTTCCTTACGTGGCCCCGACCACTAACCAAAAGCCAGTCCAGATGGGGNTGTATTAACTACTTTAAACGGGGAGGTTGCCTAGACTTTTAAGCATGGGGTATTACAATTAAGGACCACCTCCTCTATCCCAGTTGAAAAATATAAAAAATAGAACTCTGGAGAAGGTTGCCTAAATGCAAATACCGGGGGAAATACCCGAAAAAGAGGGCTCCGGTATTTCCCCTTACCAAAAAATAACACTGGGGGAAAATCCTCCTCTGGGGGCAAGGCCTGCCCCTGGTTGGGGCCCCAACCTACCCCCAGACGCTCAATTGGGCGCGTTTATTAATTTACCCCCAATTTTGGCCATAGTGNCCAAGGCGATTTCTCAAGTGGGGGAGCACACAACCACCGCTGGGGGGCAATTTCCCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)