Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 23 Sep 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL219l12.3                           12 END     8          50       66                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:5514075.5                      13 PI      93         54     1127                hypothetical protein MGC69454 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012770813 Xl3.1-IMAGE:5516394.5 - 16 ESTs
                                                                       ...0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5516394.5    GCAGCCTGCCATACTCTCAGACTTTCTTCTCAACATCACTCGAGAACTAAGTACTAACATCCAGCTTAAGTGCTTGGGAATTCCTTGCTCATCATGAGTCACTCTGGTCTAAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTCTTTCTTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTTGGAAGTCCTTCTCCTGGTCCCTCCAGCCGATCATCCTCCTCGGCCTTCAGGGTAAGGTCCAGTACTCCTGTCCGAGTCTCTCTGGACCGGGTTGACTTCTCTGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCCGAACTACAGGAGCTTAATGACCGATTTGCTAGCTTCATAGAGAAGGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCCGAGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAAGCAGTTGGAACTACTGGGCAAAGACAGGGACCACATCCAGGTGGAGAGGGACAACTTTGCAGAAGACCTTGCTTTTCTGAAGCAAAGGCTAGATGAAGAAGTTCACAAACGGGAAGATGCAGAGAATAATCTAGTCCTGTTTAGAAAGGATGTGGATGATGCCACACTCTCCCGCCTGGAGCTAGAGAGGAAGATTGAGTCTTTGATGGATGAAATAGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTCTCAGTTCAGGCACAGCCAGTACACATGGAAATTGAAGCTGCAAAACAGCCTGACCTGACCTCCGCACTGAGGGACATTCGAAGTCAGTATGAGACTATTGCTGCTAAAAACGTACAAGAGTCGGAGGACTGGTACAAGTCCAAGTTTGCTGATCTCTCAGATGCTGCAAATCGCAACAGTGAAGCTCTGCGCCAAGCCAAGCAGGACATGAATGAATCGCGACGCCAGATCCAAAGTCTGACATGTGAGGTTGATGGTCTGAAGGGAACAAATGAAGCACTGCTGCGTCAGATGAAAAATATGGAGGAGCAGTTTGGGATGGAGGCAGCTAATTACCAGGACACAATTGGAGGACTGGAG
                                                  Xl3.1-CHK-1012691422          TGCCATACTCTCAGACTTTCTTCTCAACATCACTCGAGAACTAAGTACTAACATCCAGCTTAAGTGCTTGGGAATTCCTTGCTCATCATGAGTCACTCTGGTCTAAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTCTTTCTTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTTGGAAGTCCTTCTCCTGGTCCCTCCAGCCGATCATCCTCCTCGGCCTTCAGGGTAAGGTCCAGTACTCCTGTCCGAGTCTCTCTGGACCGGGTTGACTTCTCTGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCCGAACTACAGGAGCTTAATGACCGATTTGCTAGCTTCATAGAGAAGGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCCGAGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAAGCAGTTGGAACTACTGGGCAAAGACAGGGACCACATCCAGGTGGAGAGGGACAACTTTGCAGAAGACCTTGCTTTTCTGAAGCAAAGGCTAGATGAAGAAGTTCACAAACGGGAAGATGCAGAGAATAATCTAGTCCTGTTTAGAAAGGATGTGGATGATGCCACACTCTCCCGCCTGGAGCTAGAGAGGAAGATTGAGTCTTTGATGGATGAAATAGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTCTCAGTTCAGGCACAGCCAGTACACATGGAAATTGAAGCTGCAAAACAGCCTGACCTGACCTCCGCACTGAGGGACATTCGAAGTCAGTATGAGACTATTGCTGCTAAAAACGTACAAGAGTCGGAGGACTGGTACAAGTCCAAGTTTGCTGATCTCTCAGATGCTGCAAATCGCAACAGTGAAGCTCTGCGCCAAGCCAAGCAGGACATGAATGAATCGCGACGCCAGATCCAAAGTCTGACATGTGAGGTTGATGGTCTGAAGGGAACAAATGAAGCACTGCTGCGTCAGATGAAAAATATGGAGGAGCAGTTTGGGATGGAGGCAGCTAATTACCAGGACACAATTGGAGGACTGGAGCAGAAG
                                                      consensus depths         2     2     2     2     2     2     2     2     4     7    11    12    12    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    13    13    13    13    13    13    13    13    13    13    14    13    14    13    14    13    14    13    14    13    14    13    14    11    14    10    13    10    13    10    13    11    14    11    14    11    14    11    14    10    12     9    12     9    12     8    12     7    10     5     9     5     8     4     7     4     7     4     7     4     7     4     7     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     5     3     5     2     5     2     4     2     4     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                        -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                        --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----G------
                                               BLH ATG      93    1309    
                                               BLH MIN      93     162    
                                               BLH MPR      69     162    
                                               BLH OVR      93     110    
                                               CDS MIN      93      43    
                                               EST CLI      49      43    
                                               ORF LNG      93       6    
                                                                                                                                                                                                                                                                                   PROTEIN --- Sp ---- 5e-018     NP_999665.1 nuclear intermediate filament protein [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PROTEIN === Dm ==== 1e-027     NP_476616.1 CG6944-PA [Drosophila melanogaster] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 1e-029     NP_001076764.1 Intermediate Filament, A family member (ifa-1) [Caenorhabditis elegans] --------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PREDICTED - ?? ---- 5e-047     XP_607274.4 PREDICTED: similar to Neurofilament heavy polypeptide (NF-H) (Neurofilament triplet H protein) (200 kDa neurofilament protein) isoform 1 [Bos taurus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                           PROTEIN --- Ci ---- 1e-060     NP_001027681.1 intermediate filament protein IF-A [Ciona intestinalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                             PROTEIN --- Gg ==== 3e-105     NP_001041541.1 vimentin [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN === Dr ==== 9e-121     NP_571129.1 plasticin [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                     PROTEIN --- Mm ---= 4e-131     NP_038667.1 peripherin 1; peripherin [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PREDICTED = Cf ==== 3e-134     XP_534812.2 PREDICTED: similar to peripherin isoform 1 [Canis familiaris] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN === Hs ==== 9e-135     NP_006253.2 peripherin; neurofilament 4 (57kD) [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN === Bt ==== 4e-137     NP_001095848.1 peripherin [Bos taurus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PREDICTED = Xt ==== 0          NP_001001235.1 hypothetical protein MGC69454 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN === Xl ==== 0          NP_001080529.1 peripherin [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5516394.5                                                          TAA---------TAA------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------ATG---------------ATG
                                                                   ORF                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
  5   1   2       bld Emb4      out                   IMAGE:5440338.5p AAAGCAGCCTGCCATACTCTCAGACTTTCTTCTCAACATCACTCGAGAACTAAGTACTAACATCCAGCTTAAGTGCTTGGGAATTCCTTGCTCATCATGAGTCACTCTGGTCTAAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTCTTTCTTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTTGGAAGTCCTTCTCCTGGTCCCTCCAGCCGATCATCCTCCTCGGCCTTCAGGGTAAGGTCCAGTACTCCTGTCCGAGTCTCTCTGGACCGGGTTGACTTCTCTGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCCGAACTACAGGAGCTTAATGACCGATTTGCTAGCTTCATAGAGAAGGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCCGAGCTTCAGACCTGTGCCAGTAGGAGCTGAGGGAACTGCGCAAGCAGTTGGAACTACTGGGCAAAGACAGGGACCACATCCAGGTGGAGAGGGACAACTTTGCAGAAGACCTTGCTTTTCTGAAGCAAAGGCTAGATGAAGAAGTTCACAAACGGGAAGATGCAGAGAATAATCTAGTCCTGTTTAGAAAGGATGTGGATGATGCCACACTCTNCCGCCTGGAGCTAGAGAGGAAGAATTGAGTCTTGATGGATGAAATA
  5   1   2       bld DMZ  5g                              xl309a24.5p    GCAGCCTGCCATACTCTCAGACTTTCTTCTCAACATCACTCGAGAACTAAGTACTAACATCCAGCTTAAGTGCTTGGGAATTCCTTGCTCATCATGAGTCACTCTGGTCTAAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTCTTTCTTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTTGGAAGTCCTTCTCCTGGTCCCTCCAGCCGATCATCCTCCTCGGCCTTCAGGGTAAGGTCCAGTACTCCTGTCCGAGTCTCTCTGGACCGGGTTGACTTCTCTGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCCGAACTACAGGAGCTTAATGACCGATTTGCTAGCTTCATAGAGAAGGTCCGCTACCTGGAGC
  5   1   2       bld Emb4 5g                         IMAGE:5516394.5p                                         CTCGAGAACTAAGTACTATACATCCAGCTTAAGTGCTTGGGAATTCCTTGCTCATCATGAGTCACTCTGGTCTAAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTCTTTCTTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTTGGAAGTCCTTCTCCTGGTCCCTCCAGCCGATCATCCTCCTCGGCCTTCAGGGTAAGGTCCAGTACTCCTGTCCGAGTCTCTCTGGACCGGGTTGACTTCTCTGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCCGAACTACAGGAGCTTAATGACCGATTTGCTAGCTTCATAGAGAAGGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCCGAGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAAGCAGTTGGAACTACTGGGCAAAGACAGGGACCACATCCAGGTGGAGAGGGACAACTTTGCAGAAGACCTTGCTTTTCTGAAGCAAAGGCTAGATGAAGAAGTTCACAAACGGGAAGATGCAGAGAATAATCTAGTCCTGTTTAGAAAGGATGTGGATGATGCCACACTCTCNCGCCTGGAACTGGAGAGGAAGATTGAGTCTTTGATGGATGAAATAGAATTTCTGAAGAAGCTTCATGANGAGGAACTCAATGATGTACAAGTCTCAGTTCAGGCACAGCCAGTACA
  5   1   2       bld Tbd7      out                        XL079h11.5p                                            CGAGGCTAAGTACTAACATACCAGCTTAAGTGCTTGGGAATTCCTTGCTCATCATGAGTCACTCTGGTCTAAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTCTTTCTTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTTGGAAGTCCTTCTCCTGGTCCCTCCAGCCGATCATCCTCCTCGGCCTTCAGGGTAAGGTCCAGTACTCCTGTCCGAGTCTCTCTGGACCGGGTTGACTTCTCTGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCCGAACTACAGGAGCTTAATGACCGATTTGCTAGCTTCATAGAGAAGGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCCGAGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAAGCAGTTGGAACTACTGGGCAAAGACAGGGACCACATCCAGGTGGAGAGGGACAACTTTGCAGAAGACCTTGCTTTTCTGAAGCAAAGGCTAGATGAAGAAGTTCACAAACGGGAAGATGCAGAGAATAATCTAGTCCTGT
  5   1   2       bld Emb4 5g                         IMAGE:5543232.5p                                                   TAAGTACTAACATCCAGCTTAAGTGCTTGGGAATTCCTTGCTCATCATGAGTCACTCTGGTCTAAGAAGCACCTCCACATCCTACCGCCGTACTTTTGGGGGTCCTCTCCTGTCCCCTCTTTCTTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTTGGAAGTCCTTCTCCTGGTCCCTCCAGCCGATCATCCTCCTCGGCCTTCAGGGTAAGGTCCAGTACTCCTGTCCGAGTCTCTCTGGACCGGGTTGACTTCTCTGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCCGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAGAAGGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCCGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAAGCAGTTGGAACTACTGGGCAAAGACAGGGACCACATCNCAGGTGGAGAGGGACAACTTTGCAGAAGACCTTGCTTTTCTGAAGCAAAGGCTAGATGAAGAAGTTCACAAACGGGAAGATGCAGAGAATAATCTAGTCCTGTTTAGAAAGGGATGTGGATGATGCCACACTCTCCCGCCTGGAGCTAGAGAGGAAGATTGAGTCTTTGATGGATGAAATAGAATTTCTGAAGAAGCTTCATGAGGAGGAAACTCATGATGTANCAGTCTCAGTTCAGGCACAGCCAGTACACATGGGAAATTGAAGCTGCAAAACAGCCCTGACCTGACCTCCGCACTGAGGGGAACTTCCGAAGTCAGTATGGAGACTATTTGCTGCTAAAAACGTACAAGAAATCGGAGGACTGGGTACAAGTC
  5   1   2       bld Emb4 5g                         IMAGE:5543471.5p                                                    AAGTACTAACATCCAGCTTAAGTGCTTGGGAATTCCTTGCTCATCATGAGTCACTCTGGTCTAAGAAGCACCTCCACATCCTACCGCCGTACTTTTGGGGGTCCTCTCCTGTCCCCTCTTTCTTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTTGGAAGTCCTTCTCCTGGTCCCTCCAGCCGATCATCCTCCTCGGCCTTCAGGGTAAGGTCCAGTACTCCTGTCCGAGTCTCTCTGGACCGGGTTGACTTCTCTGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCCGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAGAAGGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCCGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAAGCAGTTGGAACTACTGGGCAAAGACAGGGACCACATCCAGGTGGAGAGGGACAACTTTGCAGAAGACCTTGCTTTTCTGAAGCAAAGGCTAGATGAAGAAGTTCACAAACGGGAAGATGCAGAGAATAATCTAGTCCTGTTTTAGAAAGGATGTGGATGATGCCACACTCTCCCGCCTGGAGCTAGAGAGGAAGATTGAGTCTTTGATGGATGAAATAGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTCTCAGTTCAGGCACAGCCAGTACACATGGGAAAATGAAGCTGCAAAACAGCCTGGACCTGACCTTCGCACTGAGGGACATTTCAAAGTCAGTATGAAACTATTGCTGCTAAAAACGTACCAAAGTCCGAAGGACTGGTACCAGTCCCAGGTTTGCTGAATCTCTTCAAAAGCTGGCA
  5   1   2       bld Ga12      out                        XL219l12.5p                                                    CGAGGCTAACATCCAGCTTAAGTGCTTGGGAATTCCTTGCTCATCATGAGTCACTCTGGTCTAAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTCTTTCTTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTTGGAAGTCCTTCTCCTGGTCCCTCCAGCCGATCATCCTCCTCGGCCTTCAGGGTAAGGTCCAGTACTCCTGTCCGAGTCTCTCTGGACCGGGTTGACTTCTCTGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCCGAACTACAGGAGCTTAATGACCGATTTGCTAGCTTCATAGAGAAGGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCCGAGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAAGCAGTTGGAACTACTGGGCAAAGACAGGGACCACATCCAGGTGGAGAGGGACAACTTTGCAGAAGACCTTGCTTTTCTGAAGCAAAGGCTAGATGAAGAAGTTCACAAACGGGAAGATGCAGAGAATAATCTAGTCCTGTTTA
  5   1   2       bld Emb4      out                   IMAGE:4202560.5p                                                     AGTACTAACATCCAGCTTAAGTGCTTGGGAATTCCTTGCTCATCATGAGTCACTCTGGTCTAAGAAGCACCTCCACATCCTACCGCCGTACTTTTGGGGGTCCTCTCCTGTCCCCTCTTTCTTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTTGGAAGTCCTTCTCCTGGTCCCTCCAGCCGATCATCCTCCTCGGCCTTCAGGGTAAGGTCCAGTACTCCTGTCCGAGTCTCTCTGGACCGGGTTGACTTCTCTGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCCGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAGAAGGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCCGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAAGCAGTTGGAACTACTGGGCAAAGACAGGGACCACATNCAGGTGGAGAGG
  5   1   2       bld Emb4 5g                IMAGE:5543471-IMAGp.IMAGp                                                         TCCCCATGCTTTAAGTCGCTTTGGGAATTCCTTGCTCATCATGAGTCACTCTGGTCTAAGAAGCACCTCCACATCCTACCGCCGTACTTTTGGGGGTCCTCTCCTGTCCCCTCTTTCTTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTTGGAAGTCCTTCTCCTGGTCCCTCCAGCCGATCATCCTCCTCGGCCTTCAGGGTAAGGTCCAGTACTCCTGTCCGAGTCTCTCTGGACCGGGTTGACTTCTCTGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCCGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAGAAGGTCCGCTACCTGCAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCCGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAAGCAGTTGGAACTACTGGGCAAAGACAGGGACCACATCCAGGTGGAGAGGGACAACTTTGCAGAAGACCTTGCTTTTCTGAAGCAAAGGCTAGATGAAGAAGTTCACAAACGGGAAGATGCAGAGAATAATCTAGTCCTGTTTAGAAAGGATGTGGATGATGCCACACTCTCCCGCCTGGAGCTAGAGAGGAAGATTGAGTC
  5   1   2       bld DMZ       out                        xl306b24.5p                                                         CTAACATCCAGCTTAAGTGCTTGGGAATTCCTTGCTCATCATGAGTCACTCTGGTCTAAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTCTTTCTTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTTGGAAGTCCTTCTCCTGGTCCCTCCAGCCGATCATCCTCCTCGGCCTTCAGGGTAAGGTCCAGTACTCCTGTCCGAGTCTCTCTGGACCGGGTTGACTTCTCTGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCCGAACTACAGGAGCTTAATGACCGATTTGCTAGCTTCATAGAGAAGGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCCGAGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAAGCAGTTGGAACTACTGGGCAAAGACAGGGACCACATCCAGGTGGAGAGGGACAACTTTGCAGAAGACCTTGCTTTTCTGAAGCAAAGGCTAGATGAAGAAGTTCACAAACGGGAAGATGCAGAGAATAATCTAGTCCTGTTTAGAAAGGATGTGGATGATGCCACACTCTCCCGCCTGGAGCTAGAGAGG
  5   1   2      seed DMZ       out                        xl274o12.5p                                                         CTAACATCCAGCTTAAGTGCTTGGGAATTCCTTGCTCATCATGAGTCACTCTGGTCTAAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTCTTTCTTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTTGGAAGTCCTTCTCCTGGTCCCTCCAGCCGATCATCCTCCTCGGCCTTCAGGGTAAGGTCCAGTACTCCTGTCCGAGTCTCTCTGGACCGGGTTGACTTCTCTGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCCGAACTACAGGAGCTTAATGACCGATTTGCTAGCTTCATAGAGAAGGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCCGAGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAAGCAGTTGGAACTACTGGGCAAAGACAGGGACCACATCCAGGTGGAGAGGGACAACTTTGCAGAAGACCTTGCTTTTCTGAAGCAAAGGCTAGATGAAGAAGTTCACAAACGGGAAGATGCAGAGAATAATCTAGTCCTGTTTAGAAAGGATGTGGATGATGCCACACTCTCCCGCCTGGAGCTAGAGAGGAAGATTGAGTCTTTGATGGATGAAA
  5   1   2       bld DMZ       out                        xl284e04.5p                                                         CTAACATCCAGCTTAAGTGCTTGGGAATTCCTTGCTCATCATGAGTCACTCTGGTCTAAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTCTTTCTTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTTGGAAGTCCTTCTCCTGGTCCCTCCAGCCGATCATCCTCCTCGGCCTTCAGGGTAAGGTCCAGTACTCCTGTCCGAGTCTCTCTGGACCGGGTTGACTTCTCTGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCCGAACTACAGGAGCTTAATGACCGATTTGCTAGCTTCATAGAGAAGGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCCGAGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAAGCAGTTGGAACTACTGGGCAAAGACAGGGACCACATCCAGGTGGAGAGGGACAACTTTGCAGAAGACCTTGCTTTTCTGAAGCAAAGGCTAGATGAAGAAGTTCACAAACGGGAAGATGCAGAGAATAATCTAGTCCTGTTTAGAAAGGATGTGGATGATGCCACACTCTCCCGCCTGGAGCTAGAGAG
  5   1   2       bld Emb4 5g                         IMAGE:5542568.5p                                                                            CCACGCGTCCGCTTGCTCATCATGAGTCACTCTGGTCTAAGAAGCACCTCCACATCCTACCGCCGTACTTTTGGGGGTCCTCTCCTGTCCCCTCTTTCTTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTTGGAAGTCCTTCTCCTGGTCCCTCCAGCCGATCATCCTCCTCGGCCTTCAGGGTAAGGTCCAGTACTCCTGTCCGAGTCTCTCTGGACCGGGTTGACTTCTCTGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCCGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAGAAGGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCCGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAAGCAGTTGGAACTACTGGGCAAAGACAGGGACCACATCCAGGGTGGAGAGGGACAACTTTGCAGAAGACCTTGCTTTTCTGAAGCAAAGCTAGGATGAAGAAGTTCACAAACGGGAAGATGCAGAGAATAATCTAGTCCTGTTTTAGAAGGGATGTGGGATGATGCCACACTCTCCCGCCTGGAGCTAGAGAGGAAGATTGAGTCTTTGATGGATGGAATAGAATTTCTGAAGAAGCTTCCTGGAGAGGAACTCAATGATGTACCAAGTCTCAGTTCAGGCACAGCCAGTACACATGGGAAATTGAAGCTGCAAAACAGCCTGACCTGACCTCCGCACTGAGGGGACTTTCGAAAGTCAGTATGAAAACTATTT
  5   1   2       bld Te2  5g                         IMAGE:7211499.5p                                                                                     ATCTTGCTCATCATGAGTCACTCTGGTCTAAGAAGCACCTCCACATCCTACCGCCGTACTTTTGGGGGTCCTCTCCTGTCCCCTCTTTCTTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTTGGAAGTCCTTCTCCTGGTCCCTCCAGCCGATCATCCTCCTCGGCCTTCAGGGTAAGGTCCAGTACTCCTGTCCGAGTCTCTCTGGACCGGGTTGACTTCTCTGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCCGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAGAAGGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCCGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAAGCAGTTGGAACTACTGGGCAAAGACAGGGACCACATCCAGGTGGAGAGGGACAACTTTGCAGAAGACCTTGCTTTTCTGAAGCAAAGGCTAGATGAAGAAGTTCACAAACGGGAAGATGCAGAGAATAATCTAGTCCTGTTTAGAAAGGATGTGGATGATGCCACACTCTCCCGCCTGGAGCTAGAGAGGAAGATTGAGTCTTTGATGGATGAAATAGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTCTCAGTTCAGGCACAGCCAGTACACATGGAAATTGAAGCTGNCAAACAGCCTGACCTGACCNTCGCACTGAGGGACATTCGAAGTCAGTATGAGACTATTGCTGCTAAAAACGTACAGGAGTCGGAAGACTGGGTACAGTTCCAGGTTTGCTTGATCTCTTCGAATGCTGGCCAATCCCCAACATGTGAAGCTTT
  5   1   2       chi Thy       out                   IMAGE:8550743.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCATAGTAGATGCATCCGTAGGTCGTCTCGTCTTCGTCCCTTTGAAATAAGAAGAAGGAAGCTGATCGCTCCGTGGTGCTTGCTGGAATAACCCCAGACCGGTGCAGTTTTCTCCTGATAGGTGCAATGGCCCGGGGTGTCAGGCTAGATGAAGAAGTTCACAAACGGGAAGATGCAGAGAATAATCTAGTCCTGTTTAGAAAGGATGTGGATGATGCCACACTCTCCCGCCTGGAGCTAGAGAGGAAGATTGAGTCTTTGATGGATGAAATAGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTCTCAGTTCAGGCACAGCCAGTACACATGGAAATTGAAGCTGCAAAACAGCCTGACCTGACCTCCGCACTGAGGGACATTCGAAGTCAGTATGAGACTATTGCTGCTAAAAACGTACAAGAGTCGGAGGACTGGTACAAGTCCAAGTTTGCTGATCTCTCAGATGCTGCAAATCGCAACAGTGAAGCTCTGCGCCAAGCCAAGCAGGACATGAATGAATCGCGACGCCAGATCCAAAGTCTGACATGTGAGGTTGATGGTCTGAAGGGAACAAATGAAGCACTGCTGCGTCAGATGAAAAATATGGAGGAGCAGTTTGGGATGGAGGCAGCTAATTACCAGGACACAATTGGAGGACTGGAGCAGAAGTGCAGCATATGAAGGAGGAGATGTCACGTCACCTGAGAGAGTACCAAGACCTGCTCAATGTCAAGATGGCTTTAGATATTGAGATTGCAACTTACAGAAAGCTCCTAGAAGAGAGGAGAGCAGGATTGCTGTCCCAATCCACTCTCTGACATCTCTTAGTATAAAAGTCAGCTCCTGAAATCGATCGCAGCACGAGACCACACCCAGAAAACGTTGTTATAAAACTATTGAGACAGGATGGAAGCAGTGTCACTGAGTCTCGAAAGAGCAGTCTCGAAAGAAGAAATGATCTGTATGCGGTGCTCCGGAAGAACCAGTCCATTGC
  5   1   2       add Emb4                            IMAGE:5571337.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACGCGTGGGTGAAGAAGTTCCAAACGGGAAGATGCAGAGAATATCTAGTCCTGTTTAGAAAGGATGTGGATGATGCCACACTCTCCCGCCTGGAGCTAGAGAGGAAGATTGAGTCTTTGATGGATGAAATAGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTCTCAGTTCAGGCACAGCCAGTACACATGGAAATTGAAGCTGCAAAACAGCCTGACCTGACCTCCGCACTGAGGGACATTCGAAGTCAGTATGAGACTATTGCTGCTAAAAACGTACAAGAGTCGGAGGACTGGTACAAGTCCAAGTTTGCTGATCTCTCAGATGCTGCAAATCGCAACAGTGAAGCTCTGCGCCAAGCCAAGCAGGACATGAATGAATCGCGACGCCAGATCCAAAGTCTGACATGTGAGGTTGATGGTCTGAAGGGAACAAATGAAGCACTGCTGCGTCAGATGAAAAATATGGAGGAGCAGTTTGGGATGGAGGCAGCTAATTACCAGGACACAATTGGAGGACTGGAGCAGGAAGTGCAGCATATGAAGGAGGAGATGTCACGTCACCTGAGAGAGTACCAAGACCTGCTCAATGTCAAGATGGCTTTAGATATTGAGATTGCAACTTACAGAAAGCTCCTANAAGGAGAGGAGAGCAGGATTGCTGTCCCAATCCACTCTCTGACATCTCTTAGTATTAAAAGTCCAGCAGCTCCTGAAATCGATCGCAGCACCGAGACACCACCACGAAAAACGGTTGTTATAAAAACTATTGAAACCAGGGGATGGAAAAGCAAGTTGTCCCCTGGAGTCTCGGAAAAGAGCAGTCTTCCCAAAAGGAGAAAAAGGGATCCTGGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)