Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:3745472.3                       5 END     3          16       60                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6871206.5                      26 PI      94        311     1203                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012770856 Xl3.1-IMAGE:7980087.5 - 18 ESTs
                                                                       ......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7980087.5                                     TTGACCGGTGCACTTGTTCATCTTCCTGAGTGTGGACTAAACAGCATTTATGGGCACCCAAATCTACCTGACTTCACTGGCTGGATTGGTACTGGAACAGTCTTAACATGGCCGGGAGCTGCAGGCTTCTCACCTCCTCAATATCTCAGCTGCTGCTGAGGAGACAAGGCCAAGGGGCTGCGCTGCTCTTGTGGGGCAGGAAAAGCTGCCCTGAGAGCTGCAGGGGGCTGCTGGGAAGGAAATACTGTCTTTGACCGGTGCACTTGTTCATCTTCCTGAGTGTGGACTAAACAGCATTTGATATCAAGGATTCATTTCAGAACAATTGGTATCCTCCCTTACCAGAGTATGATTCTCAACCGCTAACCATTAAAATAACCACAATGTTCATTGTGCGTGTTCGAGGTTTGCCATGGTCTTGCACTGCAGATGACGTGCTGAACTTTTTTGATGATTCCAATGTAAGAAATGGCACAGATGGAGTGCACTTCATTTTCAATAGGGATGGCAAGCCGAGAGGAGACGCTGTCATCGAATTTGAGTCTGCTGAAGATGTGCAGAAAGCAGTGGAGCAGCATAAGAAGTACATGGGCCAACGATATGTGGAAGTATTCGAGATGAACCAGAAGGAGGCAGAGTCTCTGCTGAATCGAATGCATTCTGCATTGTCACCCACCAGGCCGTCCTCTATGTCACTGTCTCCACAGTCTTCAATGGCTTCTCCTCCTAGTGATGGCATTGTGCGATTACGCGGGCTCCCATACAGTTGCAGCGAGCAGGACATAATACATTTTTTTTCAGGTTTGGACATAGCAGATGAGGGAATAACATTTGTCTTGGACCAGCGAGGGAGAAAATCTGGGGAAGCATTTGTACAGTTTCTATCACAAGAACATGCAGACCAGGCACTCCTCAAACACAAGCAGGAAATAGGCAGCAGGTACATTGAGATATTTCCAAGCAGGAGGAATGATGTTCAGACTGCCCGTTTCCCCTTTAGAAGGAGGAAAGGAGTAACATTTGCACCTACAATAAAAGACCTTTATGATCCAGACAACTGCATAAATAATACTAGTAAAGACTTGCTATCTGATGTCCCTGAGAATGGTCACATAAATGATTATGTAAAGGAGATGTCCGCTAAATCTGTGGATGTTCATGACTTCACAGTTATGTCTCCCGTGCACGACATCCATATTCGAGGCCTCCCGTTCCATGCTTCAGGGCAGGATATTGCAAATTTCTTCCATCCGATAATGCCTTTGAAGATCAGCATTGAGTACAGTGCTGATGCTGGTGGTGCTACTG
                                                  Xl3.1-CHK-1012690467                                           GGTGCACTTGTTCATCTTCCTGAGTGTGGACTAAACAGCATTTATGGGCACCCAAATCTACCTGACTTCACTGGCTGGATTGGTACTGGAACAGTCTTAACATGGCCGGGAGCTGCAGGCTTCTCACCTCCTCAATATCTCAGCTGCTGCTGAGGAGACAAGGCCAAGGGGCTGCGCTGCTCTTGTGGGGCAGGAAAAGCTGCCCTGAGAGCTGCAGGGGGCxGxxxGGAAGGAAATACTGTCTTTGACCGGTGCACTTGTTCATCTTCCTGAGTGTGGACTAAACAGCATTTGATATCAAGGATTCATTTCAGAACAATTGGTATCCTCCCTTACCAGAGTATGATTCTCAACCGCTAACCATTAAAATAACCACAATGTTCATTGTGCGTGTTCGAGGTTTGCCATGGTCTTGCACTGCAGATGACGTGCTGAACTTTTTTGATGATTCCAATGTAAGAAATGGCACAGATGGAGTGCACTTCATTTTCAATAGGGATGGCAAGCCGAGAGGAGACGCTGTCATCGAATTTGAGTCTGCTGAAGATGTGCAGAAAGCAGTGGAGCAGCATAAGAAGTACATGGGCCAACGATATGTGGAAGTATTCGAGATGAACCAGAAGGAGGCAGAGTCTCTGCTGAATCGAATGCATTCTGCATTGTCACCCACCAGGCCGTCCTCTATGTCACTGTCTCCACAGTCTTCAATGGCTTCTCCTCCTAGTGATGGCATTGTGCGATTACGCGGGCTCCCATACAGTTGCAGCGAGCAGGACATAATACATTTTTTTTCAGGTTTGGACATAGCAGATGAGGGAATAACATTTGTCTTGGACCAGCGAGGGAGAAAATCTGGGGAAGCATTTGTACAGTTTCTATCACAAGAACATGCAGACCAGGCACTCCTCAAACACAAGCAGGAAATAGGCAGCAGGTACATTGAGATATTTCCAAGCAGGAGGAATGATGTTCAGACTGCCCGTTTCCCCTTTAGAAGGAGGAAAGGAGTAACATTTGCACCTACAATAAAAGACCTTTATGATCCAGACAACTGCATAAATAATACTAGTAAAGACTTGCTATCTGATGTCCCTGAGAATGGTCACATAAATGATTATGTAAAGGAGATGTCCGCTAAATCTGTGGATGTTCATGACTTCACAGTTATGTCTCCCGTGCACGACATCCATATTCGAGGCCTCCCGTTCCATGCTTCAGGGCAGGATATTGCAAATTTCTTCCATCCGATAATGCCTTTGAAGATCAGCATTGAGTACAGTGCTGATGCTGGTGGTGCTACTGGAGAAG
                                                      consensus depths                                          3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     5     4     5     4     6     4     6     4     6     4     6     5    10     5    10     5    10     5    10     5    10     5    10    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    14    12    14    12    14    12    14    13    15    13    15    13    15    13    15    12    15    12    15    12    15    12    15    11    14    11    14    11    14    11    14    11    14    11    14    11    14    11    14    11    14    10    13    11    14    10    14     9    14    10    14    10    14     9    13     9    13     9    12     8    12     8    12     6    11     5    11     7    11     6    11     6    11     6    11     6    11     6    11     5    11     5    11     5    10     5    10     5    10     5    10     6     8     5     6     4     5     5     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     2     3     2     3
                                                                   VAR                                                                                                                                                                                                                                                                         AGGCAGGGACAGAGTGGAGAAGAGTGCAGGAAAACAAGAGAAGGCTGGAGAGGTCATACTGTAGCAGTAAGG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                             -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------A--
                                               BLH MIN     275     104                                     
                                               BLH OVR     383     371                                     
                                               ORF LNG     383      27                                     
  5   1   2       chi Kid                             IMAGE:4031364.5p CATGTGTTGGGAGGTGCTGGGAAGGAAATACTGTCTTTGACCGGTGCACTTGTTCATCTTCCTGAGTGTGGACTAAACAGCATTTATGGGCACCCAAATCTACCTGACTTCACTGGCTGGATTGGTACTGGAACAGTCTTAACATGGCCGGGAGCTGCAGGCTTCTCACCTCCTCAATATCTCAGCTGCTGCTGAGGAGACAAGGCCAAGGGGCTGCGCTGCTCTTGTGGGGCAGGAAAAGCTGCCCTGAGAGCTGCAGGGGGCAGGCAGGGACAGAGTGGAGAAGAGTGCAGGAAAACAAGAGAAGGCTGGAGAGGTCATACTGTAGCAGTAAGGATATCAAGGATTCATTTCAAAACAATTGGTATCCTCCCTTACCAGAGTATGATTCTCAACCGCTAACCATTAAAATAACCACAATGTTCATTGTGCGTGTTCGAGGTTTGCCATGGTCTTGCACTGCAGATGACGTGCTGAACTTTTTTGATGATTCCAATGTAAGAAATGGCACAGATGGAGTGCACTTCATTTTCAATAGGGATGGCAAGCCGAGAGGAGACGCTGTCATCGAATTTGAGTCTGCTGAAGATGTGCAGAAAGCAGTGGGAGCAGCATAAGAAGTACATGGGCCCACGATATGTGGGAAGTATTCGAGATGAACCAGAAAGGAGGCAGAAGTCTCTGCTGAAATCGAATGCCTTTCTGCCTTTGTCAACCCACCCAAGGCCGGCCCCCCTATGGCAACTGGCCTCCCACAGGCCTTTCAAGGGGCTTcccccccccTAAGGGATGGCGATTGGGGGCGAATTACCCCGGGGCCTCCCATACAATTTGGCCCGCCAAGCCCGGACAATTATTACCACtttttttttttCCAGGGTTTGGGGAAACATACCCAAAAAGTAAGGGGGAAATATACCACTTTTGGGCCTCTGGGGAACCCGGCGCGAGAGGGGGGAGAAATAAATCTCGGGCGGGCAAACCATTT
  5   1   2       bld Spl  5g3  out                   IMAGE:8464016.5p                         GGAATACTGTCTTTGACCGGTGCACTTGTTCATCTTCCTGAGTGTGGACTAAACAGCATTTATGGGCACCCAAATCTACCTGACTTCACTGGCTGGATTGGTACTGGAACAGTCTTAACATGGCCGGGAGCTGCAGGCTTCTCACCTCCTCAATATCTCAGCTGCTGCTGAGGAGACAAGGCCAAGGGGCTGCGCTGCTCTTGTGGGGCAGGAAAAGCTGCCCTGAGAGCTGCAGGGGGCAGGCAGGGACAGAGTGGAGAAGAGTGCAGGAAAACAAGAGAAGGCTGGAGAGGTCATACTGTAGCAGTAAGGATATCAAGGATTCATTTCAGAACAATTGGTATCCTCCCTTACCAGAGTATGATTCTCAACCGCTAACCATTAAAATAACCACAATGTTCATTGTGCGTGTTCGAGGTTTGCCATGGTCTTGCACTGCAGATGACGTGCTGAACTTTTTTGATGATTCCAATGTAAGAAATGGCACAGATGGAGTGCACTTCATTTTCAATAGGGATGGCAAGCCGAGAGGAGACGCTGTCATCGAATTTGAGTCTGCTGAAGATGTGCAGAAAGCAGTGGAGCAGCATAAGAAGTACATGGGCCAACGATATGTGGAAGTATTCGAGATGAACCAGAAGGAGGCAGAGTCTCTGCTGAATCGAATGCATTCTGCATTGTCACCCACCAGGCCGTCCTCTATGTCACTGTCTCCACAGTCT
  5   1   2       bld Oo1  5g                         IMAGE:6641199.5p                                TGTCTTTGACCGGTGCACTTGTTCATCTTCCTGAGTGTGGACTAAACAGCATTTATGGGCACCCAAATCTACCTGACTTCACTGGCTGGATTGGTACTGGAACAGTCTTAACATGGCCGGGAGCTGCAGGCTTCTCACCTCCTCAATATCTCAGCTGCTGCTGAGGAGACAAGGCCAAGGGGCTGCGCTGCTCTTGTGGGGCAGGAAAAGCTGCCCTGAGAGCTGCAGGGGGCAGGCAGGGACAGAGTGGAGAAGAGTGCAGGAAAACAAGAGAAGGCTGGAGAGGTCATACTGTAGCAGTAAGGATATCAAGGATTCATTTCAGAACAATTGGTATCCTCCCTTACCAGAGTATGATTCTCAACCGCTAACCATTAAAATAACCACAATGTTCATTGTGCGTGTTCGAGGTTTGCCATGGTCTTGCACTGCAGATGACGTGCTGAACTTTTTTGATGATTCCAATGTAAGAAATGGCACAGATGGAGTGCACTTCATTTTCAATAGGGATGGCAAGCCGAGAGGAGACGCTGTCATCGAATTTGAGTCTGCTGAAGATGTGCAGAAAGCAGTGGAGCAGCATAAGAAGTACATGGGCCAACGATATGTGGAAGTATTCGAGATGAACCAGAAGGAGGCAGAGTCTCTGCTGAATCGAATGCATTCTGCATTGTCACCCACCAGGCCGTCCTCTATGTCACTGTCTCCACAGTCTTCAATGGCTTCTCCTCCTAGTGATGGCATTGTGCGATTACGCGGGCTCCCATACAGTTGCAGCGAGCAGGACATAATACATTTNTTTTTTCNGGTTTGGACATAGCAGATGAGGGAAATACATTTGTCTTGGACCAGCGAGAGAGAAAATCTGGNGGAGCATTTGTACAGTTTCTNATCACAGAACATGGCAGAACAGNGCACTTCCTCAA
  5   1   2       bld Egg3 5g                         IMAGE:6323291.5p                                                                                          GTTCGAAACCCGAGATGGGTGAATTTTTGCCTGAATTGAAATGGAAAAGATTANATGGACGGCAGCTGCAGGCTTCTCACCTCCTCAATATCTCAGCTGCTGCTGAGGAGACAAGGCCAAGGGGCTGCGCTGCTCTTGTGGGGCAGGAAAAGCTGCCCTGAGAGCTGCGGGGGGCAGGCAGGGACAGAGTGGAGAAGAGTGCAGGAAAACAAGAGAAGGCTGGAGAGGTCATACTGTAGCAGTAAGGATATCAAGGATTCATTTCAGAACAATTGGTATCCTCCCTTACCAGAGTATGATTCTCAACCGCTAACCATTAAAATAACCACAATGTTCATTGTGCGTGTTCGAGGTTTGCCATGGTCTTGCACTGCAGATGACGTGCTGAACTTTTTTGATGATTCCAATGTAAGAAATGGCACAGATGGAGTGCACTTCATTTTCAATAGGGATGGCAAGCCGAGAGGAGACGCTGTCATCGAATTTGAGTCTGCTGAAGATGTGCAGAAAGCAGTGGAGCAGCATAAGAAGTACATGGGCCACCGATATGTGGAAGTATTCGAGATGAACCAGAAGGAGGCAGAGTCTCTGCTGAATCGAATGCATTCTGCATTGTCACCCACCACGCACGACCCCCTATGTCACTGATCTCCACAGCACTTCCATGGATTTCTCCTCCCTAATTGATGGACATTGCTGCCGATTACCGCGGGGACTCCCGATACACAATGGCCCCCCAGCCAGGAACCTAACTACCCTTGTATTTTTCCAGGGGCTTGGGACCTTACCCCCCATGAAGGGGGACTCACCACTTTTGTCCCTGGGCACCACACCCAAGGGCGCGCACAAATACTTGGCGAGACAGCCCTTTTTGCCGCCCGCCGCTCCCTTTCTCCCACGCAACCCTGTGCCTCGAACATGCNGAACACTTCCTTTGCAAACCGTCGAGCCCTNGGGTGAAACAAAGGCCCCATCACCCGGCACCCCCTTCTGCAGCCAACTTTCTTTGCTCCCAGACCC
  5   1   2       bld Oo1  5g                         IMAGE:6639570.5p                                                                                                                                                                                      AGGCTGGACCGGTCCGGAATCCCGTGCTGCGTGTTGGTCACCCCCTGTCTCTAGCAGAAGGGTTACAgctgctgaattgagagtcccctcctgctccatgctgctctcattgctgctgctgctgTTGGACTGGCATGGAGATTAACTACTTGCTGATATCAAGGATTCATTTCAGAACAATTGGTATCCTCCCTTACCAGAGTATGATTCTCAACCGCTAACCATTAAAATAACCACAATGTTCATTGTGCGTGTTCGAGGTTTGCCATGGTCTTGCACTGCAGATGACGTGCTGAACTTTTTTGATGATTCCAATGTAAGAAATGGCACAGATGGAGTGCACTTCATTTTCAATAGGGATGGCAAGCCGAGAGGAGACGCTGTCATCGAATTTGAGTCTGCTGAAGATGTGCAGAAAGCAGTGGAGCAGCATAAGAAGTACATGGGCCAACGATATGTGGAAGTATTCGAGATGAACCAGAAGGAGGCAGAGTCTCTGCTGAATCGAATGCATTCTGCATTGTCACCCACCAGGCCGTCCTCTATGTCACTGTCTCCACAGTCTTCAATGGCTTCTCCTCCTAGTGATGGCATTGTGCGATTACGCGGGCTCCCATACAGTTGCAGCGAGCAGGACATAATACAttttttttCAGGTTTGGACATAGCAGATGAGGGAAATACATTTGTCTTGGACCAGCGAGAGAGAAAAATCTGGGAAGCATTTGTACAGTTTCTATCACAAGAACATGCAGACCCAGCACTCCTCAAACACAGCAGGAAATAGGCAGCAGGTACATTGAGATATTTCCAAGCAGGAGGGATGATGTTCAGACTGCCCGTTTCCCCTTTAGAAGGAGGAAGGAGTAACATTTGCACCTACAATAAAAGACCTTATGATCCAGACACTGCATAAATATACTAGGAAAGACTTGCTATCTGATGGCCCCGAGAATGGTCCCTTAAATGGATTTGTTAAAGGAGATGGTCCCTTAAAATCTGGGGGATGTTTCATGACTTTCCACAGTTATGTCCTCCCC
  5   1   2       bld Kid  5g                         IMAGE:4031734.5p                                                                                                                                                                                                                       AAGTTCCTCCTGATCTTCATGTTACTTCCTGTCCTCCATGTGTTGGGAGGTGCTGGGAAGGAAATACTGTCTTTGACCGGTGCACTTGTTCATCTTCCTGAGTGTGGACTAAACAGCATTTGATATCAAGGATTCATTTCAGAACAATTGGTATCCTCCCTTACCAGAGTATGATTCTCAACCGCTAACCATTAAAATAACCACAATGTTCATTGTGCGTGTTCGAGGTTTGCCATGGTCTTGCACTGCAGATGACGTGCTGAACTTTTTTGATGATTCCAATGTAAGAAATGGCACAGATGGAGTGCACTTCATTTTCAATAGGGATGGCAAGCCGAGAGGAGACGCTGTCATCGAATTTGAGTCTGCTGAAGATGTGCAGAAAGCAGTGGAGCAGCATAAGAAGTACATGGGCCAACGATATGTGGAAGTATTCGAGATGAACCAGAAGGAGGCAGAGTCTCTGCTGAATCGAATGCATTCTGCATTGTCACCCACCAGGCCGTCCTCTATGTCACTGTCTCCACAGTCTTCAATGGCTTCTCCTCCTAGTGATGGCATTGTGCGATTACGCGGGCTCCCATACAGTTGCAGCGAGCAGGACATAATACAttttttttCAGGTTTGGACATAGCAGATGAGGGAATAACATTTGTCTTTGGACCAGCGAAGGGAGAACATCTTGGGGAAGCATTTTGTACAGGTTTCTATTCCCCAGAACATGCAAGACCAGGCAACTCCTCAAACCCAAGCAGGGAAATAAGCCACCAGGTACACTTGGAGATATTTTCCCCGGCAGGAAGGAATGAATGTTCCACAACTGGCCCGTTTTCCCCCTTTACCAAGGGAGGGAAGGGAGCTAAATCTTTGGCACCCTAAAAATAAAAAGACCCCTCTATGATCTTAGCAAAACCTGCCCTACACCAATCACCACGCA
  5   1   2       bld Egg1 5g                            PBX0035F06.5p                                                                                                                                                                                                                                                                 CACGAGGGTGCTGGGAAGGAAATACTGTCTTTGACCGGTGCACTTGTTCATCTTCCTGAGTGTGGACTAAACAGCATTTGATATCAAGGATTCATTTCAAAACAATTGGTATCCTCCCTTACCAGAGTATGATTCTCAACCGCTAACCATTAAAATAACCACAATGTTCATTGTGCGTGTTCGAGGTTTGCCATGGTCTTGCACTGCAGATGACGTGCTGAACTTTTTTGATGATTCCAATGTAAGAAATGGCACAGATGGAGTGCACTTCATTTTCAATAGGGATGGCAAGCCGAGAGGAGACGCTGTCATCGAATTTGAGTCTGCTGAAGATGTGCAGAAAGCAGTGGAGCAGCATAAGAAGTACATGGGCCAACGATATGTGGAAGTATTCGAGATGAACCAGAAGGAGGCAGAGTCTCTGCTGAATCGAATGCATTCTGCATTGTCACCCACCAGGCCGTCCTCTATGTCACTGTCTCCACAGTCTTCAATGGCTTCTCCTCCTAGTGATGGCATTGTGCGATTACGCGGGCTCCCATACAGTTGCAGCGAGCAGGACATAATACAttttttttCAGGTTTGGACATAGCAGATGAGGGAATAACATTTGTCTTGGACCAGCGAGGGAGAAAATCTGGGGAAGCATTTGTACAGTTTCTATCAC
  5   1   2       bld Egg1 5g                            PBX0035F11.5p                                                                                                                                                                                                                                                                 CACGAGGGTGCTGGGAAGGAAATACTGTCTTTGACCGGTGCACTTGTTCATCTTCCTGAGTGTGGACTAAACAGCATTTGATATCAAGGATTCATTTCAAAACAATTGGTATCCTCCCTTACCAGAGTATGATTCTCAACCGCTAACCATTAAAATAACCACAATGTTCATTGTGCGTGTTCGAGGTTTGCCATGGTCTTGCACTGCAGATGACGTGCTGAACTTTTTTGATGATTCCAATGTAAGAAATGGCACATATGGAGTGCACTTCATTTTCAATAGGGATGGCAAGCCGAGAGGAGACGCTGTCATCGAATTTGAGTCTGCTGAAGATGTGCAGAAAGCAGTGGAGCAGCATAAGAAGTACATGGGCCAACGATATGTGGAAGTATTCGAGATGAACCAGAATGAGGCAGAGTCTCTGCTGAATCGAATGCATCATGCATTGGC
  5   1   2       bld Oo1  5g                         IMAGE:6640550.5p                                                                                                                                                                                                                                                                 TTGGGAGGTGCTGGGAAGGAAATACTGTCTTTGACCGGTGCACTTGTTCATCTTCCTGAGTGTGGACTAAACAGCATTTGATATCAAGGATTCATTTCAGAACAATTGGTATCCTCCCTTACCAGAGTATGATTCTCAACCGCTAACCATTAAAATAACCACAATGTTCATTGTGCGTGTTCGAGGTTTGCCATGGTCTTGCACTGCAGATGACGTGCTGAACTTTTTTGATGATTCCAATGTAAGAAATGGCACAGATGGAGTGCACTTCATTTTCAATAGGGATGGCAAGCCGAGAGGAGACGCTGTCATCGAATTTGAGTCTGCTGAAGATGTGCAGAAAGCAGTGGAGCAGCATAAGAAGTACATGGGCCAACGATATGTGGAAGTATTCGAGATGAACCAGAAGGAGGCAGAGTCTCTGCTGAATCGAATGCATTCTGCATTGTCACCCACCAGGCCGTCCTCTATGTCACTGTCTCCACAGTCTTCAATGGCTTCTCCTCCTAGTGATGGCATTGTGCGATTACGCGGGCTCCCATACAGTTGCAGCGAGCAGGACATAATACAttttttttCAGGTTTGGACATAGCAGATGAGGGAATAACATTTGTCTTGGACCAGCGAGAGAGAAAATCTGGGGAAGCATTTGTACAGTTTCTATCACAAGAACATGCAGACCAGGCACTCCTCAAACACAAGCAGGAAATAGGCAGCAGGTACATTGAGATATTTCCAGCAGGAAGGAATGATGTTCAGACTGCCCGTTCCCCTTTAGAAGGGAGGAAAAGAGTAACATTTGCACCTACAATAAAAGACCCTTTATGATCCAGACAACTGCATAAATAATAACTAGTAAAGACTTGGCTATCTGATGGTCCCTGAGAATGGGCACCTTAATGGATTTT
  5   1   2       bld Oo1  5g                         IMAGE:6861718.5p                                                                                                                                                                                                                                                                         TGCTGGGAAGGAAATACTGTCTTTGACCGGTGCACTTGTTCATCTTCCTGAGTGTGGACTAAACAGCATTTGATATCAAGGATTCATTTCAGAACAATTGGTATCCTCCCTTACCAGAGTATGATTCTCAACCGCTAACCATTAAAATAACCACAATGTTCATTGTGCGTGTTCGAGGTTTGCCATGGTCTTGCACTGCAGATGACGTGCTGAACTTTTTTGATGATTCCAATGTAAGAAATGGCACAGATGGAGTGCACTTCATTTTCAATAGGGATGGCAAGCCGAGAGGAGACGCTGTCATCGAATTTGAGTCTGCTGAAGATGTGCAGAAAGCAGTGGAGCAGCATAAGAAGTACATGGGCCAACGATATGTGGAAGTATTCGAGATGAACCAGAAGGAGGCAGAGTCTCTGCTGAATCGAATGCATTCTGCATTGTCACCCACCAGGCCGTCCTCTATGTCACTGTCTCCACAGTCTTCAATGGCTTCTCCTCCTAGTGATGGCATTGTGCGATTACGCGGGCTCCCATACAGTTGCAGCGAGCAGGACATAATACAttttttttCAGGTTTGGACATAGCAGATGAGGGAATAACATTTGTCTTGGACCAGCGAGAGAGAAAATCTGGGGAAGCATTTGTACAGTTTCTATCACAAGAACATGCAGACCAGGCACTCCTCAAACACAAGCAAGAAATAGGCAGCAGGTACATTGAGATATTTCCAAGCANNGAGAATGATGTTCAGACTGCCCGTTTCCCCCTTAGAAGGAGGAAAAGGAGTAACTTTTGCACCTACAATAAAAAGACCTTTTATGAATTCAGACAACTGGCATTAAATAATACCTAGGTAAAAGACTTTGCCTATCTGGAAGGTCCCCTGAAAAAAGGA
  5   1   2       bld Em10 5g                         IMAGE:7980087.5p                                                                                                                                                                                                                                                                                                                                            GCAGGATATCAAGGATTCATTTCAGAACAATTGGTATCCTCCCTTACCAGAGTATGATTCTCAACCGCTAACCATTAAAATAACCACAATGTTCATTGTGCGTGTTCGAGGTTTGCCATGGTCTTGCACTGCAGATGACGTGCTGAACTTTTTTGATGATTCCAATGTAAGAAATGGCACAGATGGAGTGCACTTCATTTTCAATAGGGATGGCAAGCCGAGAGGAGACGCTGTCATCGAATTTGAGTCTGCTGAAGATGTGCAGAAAGCAGTGGAGCAGCATAAGAAGTACATGGGCCAACGATATGTGGAAGTATTCGAGATGAACCAGAAGGAGGCAGAGTCTCTGCTGAATCGAATGCATTCTGCATTGTCACCCACCAGGCCGTCCTCTATGTCACTGTCTCCACAGTCTTCAATGGCTTCTCCTCCTAGTGATGGCATTGTGCGATTACGCGGGCTCCCATACAGTTGCAGCGAGCAGGACATAATACAttttttttCAGGTTTGGACATAGCAGATGAGGGAATAACATTTGTCTTGGACCAGCGAGGGAGAAAATCTGGGGAAGCATTTGTACAGTTTCTATCACAAGAACATGCAGACCAGGCACTCCTCAAACACAAGCAGGAAATAGGCAGCAGGTACATTGAGATATTTCAAGCANGAGGATGATGTCAGACTGCCGTTTCCCCCTTAGAAGAGAAAGAGTACATTTCACTACATAAAGACTTTAGATCAGACACTGATAATATACTATAAACTGCTACGATGCCTGAATGTCCCTAATGATAGTAGAATGTCCAACTTGAGTAGATCCATTGTCCG
  5   1   2      seed Ooc1 5g                IMAGE:3745472-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                             CAGGATATCAAGGATTCATTTCAGAACAATTGGTATCCTCCCTTACCAGAGTATGATTCTCAACCGCTAACCATTAAAATAACCACAATGTTCATTGTGCGTGTTCGAGGTTTGCCATGGTCTTGCACTGCAGATGACGTGCTGAACCTTTTTGATGATTCCAATGTAAGAAATGGCACAGATGGAGTGCACTTCATTTTCAATAGGGATGGCAAGCCGAGAGGAGACGCTGTCATCGAATTTGAGTCTGCTGAAGATGTGCAGAAAGCAGTGGAGCAGCATAAGAAGTACATGGGCCAACGATATGTGGAAGTATTCGAGATGAACCAGAAGGAGGCAGAGTCTCTGCTGAATCGAATGCATTCTGCATTGTCACCCACCAGGCCGTCCTCTATGTCACTGTCTCCACAGTCTTCAATGGCTTCTCCTCCTAGTGATGGCATTGTGCGATTACGCGGGCTCCCATACAGTTGCAGCGAGCAGGACATAATACAttttttttCAGGTTTGGACATAGCAGATGAGGGAATAACATTTGTCTTGGACCAGCGAGGGAGAAAATCTGGGGAAGCATTTGTACAGTTTCTATCACAAGAACATGCAGACCAGGCACTCCTCAAACACAAGCAGGAAATAGGCAGCAGGTACATTGAGATATTTCCAAGCAGGAGGAATGATGTTCAGACTGCCCGTTTCCCCTTTAGAAGGAGGAAAGGAGTAACATTTGCACCTACAATAAAAGACCTTTATGATCCAGACAACTGCATAAATAATACTAGTAAAGACTTGCTATCTGATGTCCCTGAGAATGGTCACATAAATGATTATGTAAAGGAGATGTCCGCTAAATCT
  5   1   2       bld Egg4 5g3  out                   IMAGE:3743336.5p                                                                                                                                                                                                                                                                                                                                                          ATTCATTTCAGAACAATTGGTATCCTCCCTTACCAGAGTATGATTCTCAACCGCTAACCATTAAAATAACCACAATGTTCATTGTGCGTGTTCGAGGTTTGCCATGGTCTTGCACTGCAGATGACGTGCTGAACCTTTTTGATGATTCCAATGTAAGAAATGGCACAGATGGAGTGCACTTCATTTTCAATAGGGATGGCAAGCCGAGAGGAGACGCTGTCATCGAATTTGAGTCTGCTGAAGATGTGCAGAAAGCAGTGGAGCAGCATAAGAAGTACATGGGCCAACGATATGTGGAAGTATTCGAGATGAACCAGAAGGAGGCAGAGTCTCTGCTGAATCGAATGCATTCTGCATTGTCACCCACCAGGCCGTCCTCTATGTCACTGTCTCCACAGTCTTCAATGGCTTCTCCTCCTAGTGATGGCATTGTGCGATTACGCGGGCTCCCATACAGTTGCAGCGAGCAGGACATAATACAttttttttCAGGTTTGGACATAGCAGAT
  5   1   2       bld FaB                             IMAGE:8072336.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAAAGCAGTGGAGCAGCATAAGAAGTACATGGGCCAACGATATGTGGAAGTATTCGAGATGAACCAGAAGGAGGCAGAGTCTCTGCTGAATCGAATGCATTCTGCATTGTCACCCACCAGGCCGTCCTCTATGTCACTGTCTCCACAGTCTTCAATGGCTTCTCCTCCTAGTGATGGCATTGTGCGATTACGCGGGCTCCCATACAGTTGCAGCGAGCAGGACATAATACAtttttttttCAGGTTTGGACATAGCAGATGAGGGAATAACATTTGTCTTGGACCAGCGAGGGAGAAAATCTGGGGAAGCATTTGTACAGTTTCTATCACAAGAACATGCAGACCAGGCACTCCTCAAACACAAGCAGGAAATAGGCAGCAGGTACATTGAGATATTTCCAAGCAGGAGGAATGATGTTCAGACTGCCCGTTTCCCCTTTAGAAGGAGGAAAGGAGTAACATTTGCACCTACAATAAAAGACCTTTATGATCCAGACAACTGCATAAATAATACTAGTAAAGACTTGCTATCTGATGTCCCTGAGAATGGTCACATAAATGATTATGTAAAGGAGATGTCCGCTAAATCTGTGGATGTTCATGACTTCACAGTTATGTCTCCCGTGCACGACATCCATATTCGAGGCCTCCCGTTCCATGCTTCAGGNCAGGATATTGCAAATTTCTTCCATCCGATAATGCCTTTGAGATCAGCATTGAGTACAGTGCTGATGCTGGTGGTGCTACTGGAGAA
  5   1   2       bld Emb3                            IMAGE:3399302.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTCGAGATGAACCAGAAGGAGGCAGAGTCTCTGCTGAATCGAATGCATTCTGCATTGTCACCCACCAGGCCGTCCTCTATGTCACTGTCTCCACAGTCTTCAATGGCTTCTCCTCCTAGTGATGGCATTGTGCGATTACGCGGGCTCCCATACAGTTGCAGCGAGCAGGACATAATACAttttttttCAGGTTTGGACATAGCAGATGAGGGAATAACATTTGTCTTGGACCAGCGAGGGAGAAAATCTGGGGAAGCATTTGTACAGTTTCTATCACAAGAACATGCAGACCAGGCACTCCTCAAACACAAGCAGGAAATAGGCAGCAGGTACATTGAGATATTTCCAAGCAGGAGGAATGATGTTCAGACTGCCCGTTTCCCCTTTAGAAGGAGGAAAGGAGTAACATTTGCACCTACAATAAAAGACCTTTATGATCCAGACAACTGCATAAATAATACTAGTAAAGACTTGCTATCTGATGTCCCTGAGAATGGTCACATAAATGATTATGTAAAG
  5   1   2       bld Ov1       out                   IMAGE:5049019.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACCCACGCGTCCGCCCACCAGGCCGTCCTCTATGTCACTGTCTCCACAGTCTTCAATGGCTTCTCCTCCTAGTGATGGCATTGTGCGATTACGCGGGCTCCCATACAGTTGCAGCGAGCAGGACATAATACAttttttttCAGGTTTGGACATAGCAGATGAGGGAATAACATTTGTCTTGGACCAGCGAGGGAGAAAATCTGGGGAAGCATTTGTACAGTTTCTATCACAAGAACATGCAGACCAGGCACTCCTCAAACACAAGCAGGAAATAGGCAGCAGGTACATTGAGATATTTCCAAGCAGGAGGAATGATGTTCAGACTGCCCGTTTCCCCTTTAGAAGGAGGAAAGGAGTAACATTTGCACCTACAATAAAAGACCTTTATGATCCAGACAACTGCATAAATAATACTAGTAAAGACTTGCTATCTGATGTCCCTGAGAATGGTCACATAAATGATTATGTAAAGGAGATGCCCGCTAAATCTGTGGATGTTCATGACTTCACAGTTATGTCTCCCGTGCACGACATCCATATTCGAGGCCTCCCGTTCCATGCTTCAGGGCAGGATATTGCAAATTTCTTCCATCCGATAATGCCTTTGAAGATCAGCATTGAGTACAG
  5   1   2       bld Egg1                               PBX0103E05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAATAACATTTGTCTTGGACCAGCGAGGGAGAAAATCTGGGGAAGCATTTGTACAGTTTCTATCACAAGAACATGCAGACCAGGCACTCCTCAAACACAAGCAGGAAATAGGCAGCAGGTACATTGAGATATTTTCAAGCAGGAGGAATGATGTTCAGACTGCCCGTTTCCCCTTTAGAAGGAGGAAAGGAGTAACATTTGCACCTACAATAAAAGACCTTTATGATCCAGACAACTGCATAAATAATACTAGTAAAGACTTGCTATCTGATGTCCCTGAGAATGGTCACATAAATGATTATGTAAAGGAGATGTCCGCTAAATCTGTGGATGTTCATGACTTCACAGTTATGTCTCCCGTGCACGACATCCATATTCGAGGCCTCCCGTTCCATGCTTCAGGGCAGGATATTGCAAATTTCTTCCATCCGATAATGCCTTTGAAGATCAGCATTGAGTACAGTGCTGATGCTGGTGGTGCTACTGGAGAAGCAG
  5   1   2       bld Emb4                            IMAGE:4681551.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTCACATAAATGATTATGTAAAGGAGATGTCCGCTAAATCTGTGGATGTTCATGACTTCACAGTTATGTCTCCCGTGCACGACATCCATATTCGAGGCCTCCCGTTCCATGCTTCAGGGCAGGATATTGCAAATTTCTTCCATCCGATAATGCCTTTGAAGATCAGCATTGAGTACAGTGCTGATGCTGGTGGTGCTACTGGAGAAGCAGTTGTGAGGTTCCTCACTCATGATGACGCTGTAGCAGCCATGGCTAAAAACAGATGCCATTCCCAACATGGTTATTTAGAACTTTACCTGAATTCATCTACAGACAGTAAATAAGAGCAGTGTTTGATATTATGTTGCACGGATCTTTCTTAGAAAGGACAAAGCAACAATCCTTTGCCTCCAATGGACATTAGCCAGTGTGCACCCTCCTTACACAGCCATTCAACAGATGTTTGTTTCTAACAAACTGGTATCTTTCTAAACAGTTTTTGTTGCTGTTGtttttttttttttGTGCCGACTGATTCTAAGAATGCCAATCCAGCAGGGATCAGACATTTCTTCTTGGCTAATGGAGATTTGGTAAAACTGGTGCAAAATGTTCCTTTTCTCTGTCGGCAATTCAGGCCTTTCTTATTTTGTGAACCACCAATTTATCCCtttttttttGCATCAAAGTGCCTAAAGTTAATAATATTTAAAAATGCGGGTTTGTGATTGTAAGGGCCTCCCGAGCCTGGGTTTATTTCCCGGGTATGGCCCATGGAAAAAATCAAAATTTCCGGGTTCTACAAAAAACCCCCACAACGCCAGCACTGGGGTCACGATTACGCGCCCCCACCACCATACTGTGCTTCACCCCCGGAAGACGGTGAAAAAAACTCTTCTTATAACACACAACTTAACTCCTTGGCCTAGGAAGTGTTTGTCCAACCCCACATGGCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)