Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL405c17ex.5                        111 PI      80         81      528                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:7205250.5                      12 PI      90        134      828                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012770857 Xl3.1-xl327c06.5 - 20 ESTs
                                                                       -570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl327c06.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGGTTGCTGAGTTAGCGGTGGCGGCTGTCGGGTTTGGGTTTCCTCCCTTTCCCCCTCCGTAAGCTTCTAATCAGGGGCAATGTCCACCCCGGCCAGGAGGAGGCTGATGAGGGACTTTAAGAGGTTGCAGGAAGATCCGCCAGTTGGAGTCAGCGGTGCACCTTCAGAAAACAATATAATGGTGTGGAATGCAGTTATATTTGGGCCTGAAGGGACTCCGTTTGAAGATGGTACATTTAAACTCGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTCTTTTTTTTGTTTTTTTGTCTGATTTAAAAATCCATAAAAGACAAACAAGGAGGCACCCGTAGATCATCGCACTAGTTTTAAGGATTTACATAGAGCGTTGTCCTTAAAAAAGACAAAATCTTATTTCCCCCCTTACCTTGTTTGGAAAATTTCGCTTTCTCTACTAATGTAATTTTTATTGCATGGTATGCATGATATCAAATAAGTTATTGCTATATTTGTAATATAACCTATTTGTATTCCCCCCCCTCAATGTATAATGTTGCTGTGAAGAT
                                                  Xl3.1-CHK-1012689847                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCTGAGTTAGCGGTGGCGGCTGTCGGGTTTGGGTTTCCTCCCTTTCCCCCTCCGTAAGCTTCTAATCAGGGGCAATGTCCACCCCGGCCAGGAGGAGGCTGATGAGGGACTTTAAGAGGTTGCAGGAAGATCCGCCAGTTGGAGTCAGCGGTGCACCTTCAGAAAACAATATAATGGTGTGGAATGCAGTTATATTTGGGCCTGAAGGGACTCCGTTTGAAGATGGTACATTTAAACTCGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTCTTTTTTTTGTTTTTTTGTCTGATTTAAAAATCCATAAAAGACAAACAAGGAGGCACCCGTAGATCATCGCACTAGTTTTAAGGATTTACATAGAGCGTTGTCCTTAAAAAAGACAAAATCTTATTTCCCCCCTTACCTTGTTTGGAAAATTTCGCTTTCTCTACTAATGTAATTTTTATTGCATGGTATGCATGATATCAAATAAGTTATTGCTATATTTGTAATATAACCTATTTGTATTCCCCCCCCTCAATGTATAATGTTGCTGTGAAGATTTCATG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                2     2    10    10    11    11    12    12    13    14    13    14    13    14    13    14    13    14    13    15    12    15    13    15    13    15    13    15    13    14    13    14    13    14    14    14    14    15    14    15    14    15    14    15    14    15    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    16    17    16    17    17    17    17    17    17    17    18    19    18    19    18    19    17    17    16    17    10    16     8    15     8    15     7    15     7    15     8    15     8    15     8    15     8    15     7    15     7    15     6    15     7    15     6    14     6    14     6    14     5    12     5    12     5    12     3    11     4     9     3     7     3     6
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAAATCTTATT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --G---------
                                               BLH ATG      79     807                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH MIN      79     102                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH MPR      79     102                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH OVR      79     136                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               CDS MIN      79      77                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               EST CLI       1      77                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               ORF LNG      79       2                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
  5  -1   2       add Emb9                            IMAGE:7974363.5p TACGCTCCTTTTCAATAAAAGTATTATTAAAATTCAAAGATGTGACATAAACTTATATGAAGAATATTATGCATTTGTCCCAAGAAAACAAAATATATCCCCAGTACACAGAACATATGACCACAAATTACAACTGTATCCTGAGAGACATTCATTCTGTGTACTACTTGGGTATATTTTTATATAAAGACAGTATTTTTTTCTACACCAAATTTACTTGGGACAAAATGCACCCCCATACCAGGCTACCCTCTTAGAGAGAGAACACGTGATATGACGCAACGCTTCTCCTGAGGAACTTTGAGGTGTCACTTACGGAATCGACCATTTTGTACTAGCGAGAGGGGTGATCACCAGCGATAAATCAAGCTGCAGCACGTCGGAGAAACGGCATACTGCTGCGCAATAAACTAAACATATAAATAACGATAAAGTTCAGTCGGAGAGTGCGAGTGCAAAGTTTCCATATGGCAGTTTAGCACGGAACCTCCCACTCTTAGGGATGTGGTACGGTCCTAGTCCAGCCCTATGTTGGGAACGCTGAGCGACGTCATTGCTGCTTGTTTGTGCCAGGGTTGCTGAGTTAGCGGTGGCGGCTGTCGGGTTTGGGTTTCCTCCCTTTCCCCCTCCGTAAGCTTCTAATCAGGGGCAATGTCCACCCCGGCCAGGAGGAGGCTGATGAGGGACTTTAAGAGGTGAGTATGGCTATTAAACAGCCTCCTTCCCTCGTCTGCTCCACTGCGA
  5   1   2       bld Ga15 5x3                           XL482c24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGGTTGCTGAGTTAGCGGTGGCGGCTGTCGGGTTTGGGTTTCCTCCCTTTCCCCCTCCGTAAGCTTCTAATCAGGGGCAATGTCCACCCCGGCCAGGAGGAGGCTGATGAGGGACTTTAAGAGGTTGCAGGAAGATCCGCCAGTTGGAGTCAGCGGTGCACCTTCAGAAAACAATATAATGGTGTGGAATGCAGTTATATTTGGGCCTGAAGGGACTCCGTTTGAAGATGGTACATTTAAACTCGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTCttttttttGTCTGATTTAAAAATCCATAAAAGACAAACAAGGAGGCACCCGTAGATCATCGCACTAGTTTTAAGGATTTACATAGAGCGTTGTCCTTAAAAAAGACAAAATCTTATTTCCCCCCTCACCTTGTTTGGAAAATTTCNCTTTCTCTACTAATGTAATTTTTATTGCATGGTATGCATGATATCNAAATAAGTTATTGCTATATTTGTAATATAACCTATTTGTATTcccccccc
  5   1   2       bld DMZ  5x3                             xl229e09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTTGCTGAGTTAGCGGTGGCGGCTGTCGGGTTTGGGTTTCCTCCCTTTCCCCCTCCGTGAGCTTCTAATCAGGGGCAATGTCCACCCCGGCCAGGAGGAGGCTGATGAGGGACTTTAAGAGGTTGCAGGAAGATCCGCCAGTTGGAGTCAGCGGTGCACCTTCAGAAAACAATATAATGGTGTGGAATGCAGTTATATTTGGGCCTGAAGGGACTCCGTTTGAAGATGGTACATTTAAACTCGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCANGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTC
  5   1   2       bld DMZ  5g3  in                         xl240e09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTTGCTGAGTTAGCGGTGGCGGCTGTCGGGTTTGGGTTTCCTCCCTTTCCCCCTCCGTGAGCTTCTAATCAGGGGCAATGTCCACCCCGGCCAGGAGGAGGCTGATGAGGGACTTTAAGAGGTTGCAGGAAGATCCGCCAGTTGGAGTCAGCGGTGCACCTTCAGAAAACAATATAATGGTGTGGAATGCAGTTATATTTGGGCCTGAAGGGACTCCGTTTGAAGATGGTACATTTAAACTCGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTCttttttttgtttttttGTCTGATTTAAAAATCCATAAAAGACAAACAAGGAGGCACCCGTAGATCATCGCACTAGTTTTAAGGATTTACATAGAGCGTTGTCCTTAAAAAAGACAAAATCTTATTTCCCCCCTTACCTTGNTTGGAAAATTTCGCTTTCTCTACT
  5   1   2       bld Neu4 5g3  in                    IMAGE:4085639.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTGCTGAGTTAGCGGTGGCGGCTGTCGGGTTTGGGTTTCCTCCCTTTCCCCCTCCGTGAGCTTCTAATCAGGGGCAATGTCCACCCCGGCCAGGAGGAGGCTGATGAGGGACTTTAAGAGGTTGCAGGAAGATCCGCCAGTTGGAGTCAGCGGTGCACCTTCAGAAAACAATATAATGGTGTGGAATGCAGTTATATTTGGGCCTGAAGGGACTCCGTTTGAAGATGGTACATTTAAACTCGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTGGGAATGATTCC
  5   1   2       bld DMZ  5x3                             xl327c06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTGCTGAGTTAGCGGTGGCGGCTGTCGGGTTTGGGTTTCCTCCCTTTCCCCCTCCGTAAGCTTCTAATCAGGGGCAATGTCCACCCCGGCCAGGAGGAGGCTGATGAGGGACTTTAAGAGGTTGCAGGAAGATCCGCCAGTTGGAGTCAGCGGTGCACCTTCAGAAAACAATATAATGGTGTGGAATGCAGTTATATTTGGGCCTGAAGGGACTCCGTTTGAAGATGGTACATTTAAACTCGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTCttttttttgtttttttGTCTGATTTAAAAATCCATAAAAGACAAACAAGGAGGCACCCGTAGATCATCGCACTAGTTTTAAGGATTTACATAGAGCGTTGTCCTTAAAAAAGACAAAATCTTATTTCCCCCCTTACCTTGTTTGGAAAATTTCGCTTTCTCTACTAATGTAATTTTTATTGCATGGTATGCATGATAT
  5   1   2       bld Skin 5g3  in                    IMAGE:8640350.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCTGAGTTAGCGGTGGCGGCTGTCGGGTTTGGGTTTCCTCCCTTTCCCCCTCCGTAAGCTTCTAATCAGGGGCAATGTCCACCCCGGCCAGGAGGAGGCTGATGAGGGACTTTAAGAGGTTGCAGGAAGATCCGCCAGTTGGAGTCAGCGGTGCACCTTCAGAAAACAATATAATGGTGTGGAATGCAGTTATATTTGGGCCTGAAGGGACTCCGTTTGAAGATGGTACATTTAAACTCGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTCttttttttttGGTCTGATTTAAAAATCCATAAAAGACAAACAAGGAGGCACCCGTAGATCATCGCACTAGTTTTAAGGATTTACATAGAGCGTTGTCCTTAAAAAGACAAAATCTTATTTCCCCCTTACCTGTTTGGAAATTCGCTTTCTCACTAATGTATTTTATGCATGTATGCTGATTCAATAAGTATGCTAATTGTATATACTATTGTATCCCCCCTCATGTTATGTGCTGGAGATCTGAAAAATATCCTTGTaaaaaaaaaaaaaGCGCCAGCGATCTACGGTCGCTCCTATGCGTC
  5   1   2       bld Sp1  5x3               IMAGE:4174331-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGTTAGCGGTGGCGGCTGTCGGGTTTGGGTTTCCTCCCTTTCCCCCTCCGTAAGCTTCTAATCAGGGGCAATGTCCACCCCGGCCAGGAGGAGGCTGATGAGGGACTTTAAGAGGTTGCAGGAAGATCCGCCAGTTGGAGTCAGCGGTGCACCTTCAGAAAACAATATAATGGTGTGGAATGCAGTTATATTTGGGCCTGAAGGGACTCCGTTTGAAGATGGTACATTTAAACTCGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTCttttttttttGTCTGATTTAAAAATCCATAAAAGACAAACAAGGAGGCACCCGTAGATCATCGCACTAGTTTTAAGGATTTACATAGAGCGTTGTCCTTAAAAAAGACAAAATCTTATTTCCCCCCTCACCTTGTTTGGAAAATTTCGCTTTCTCTACTAATGTAATTTTTATTGCATGGTATGCATGATATCAAATAAGTTATTGCTATATTTGTAATATAACCTATTTGTATTccccccccTCAATGTATAATGTTGCTGTGAAGATTTCATGGaaaaaaaaTATACACATTTTGTAAATCTGTAAC
  5   1   2      seed Sp1  5x3                        IMAGE:4174331.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTAGCGGTGGCGGCTGTCGGGTTTGGGTTTCCTCCCTTTCCCCCTCCGTAAGCTTCTAATCAGGGGCAATGTCCACCCCGGCCAGGAGGAGGCTGATGAGGGACTTTAAGAGGTTGCAGGAAGATCCGCCAGTTGGAGTCAGCGGTGCACCTTCAGAAAACAATATAATGGTGTGGAATGCAGTTATATTTGGGCCTGAAGGGACTCCGTTTGAAGATGGTACATTTAAACTCGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGGATCC
  5   1   2       bld Skin 5g3  in                    IMAGE:8641707.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTAGCGGTGGCGGCTGTCGGGTTTGGGTTTCCTCCCTTTCCCCCTCCGTAAGCTTCTAATCAGGGGCAATGTCCACCCCGGCCAGGAGGAGGCTGATGAGGGACTTTAAGAGGTTGCAGGAAGATCCGCCAGTTGGAGTCAGCGGTGCACCTTCAGAAAACAATATAATGGTGTGGAATGCAGTTATATTTGGGCCTGAAGGGACTCCGTTTGAAGATGGTACATTTAAACTCGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTCttttttttgtttttttGTCTGATTTAAAAATCCATAAAAGACAAACAAGGAGGCACCCGTAGATCATCGCACTAGTTTTAAGGATTTACATAGAGCGTTGTCCTTNAAAAGAAAAATCTTATTTCCCCCCTTACTTGTTTGGAATTTCGCTTCTCTACTATGTATTTTNATGCATGTATGCTGATTCAATAAGTATGCTTATTGTATATACTATTGTATCCCCCCCTCATGATATGTGCGTG
  5   1   2       bld FaBN 5x3                        IMAGE:8076803.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGCTGTCGGGTTTGGGTTTCCTCCCTTTCCCCCTCCGTAAGCTTCTAATCAGGGGCAATGTCCACCCCGGCCAGGAGGAGGCTGATGAGGGACTTTAAGAGGTTGCAGGAAGATCCGCCAGTTGGAGTCAGCGGTGCACCTTCAGAAAACAATATAATGGTGTGGAATGCAGTTATATTTGGGCCTGAAGGGACTCCGTTTGAAGATGGTACATTTAAACTCGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTCNTTTTTTGTCTGATTTNAAATCCATAAAGACAACAAGGAGGCACCGTAGATCATCGCACTGTTTTAAGGATTACTAGAGCTTGTCTTAAAAAGACAAATCTATTTCCCCTCACCTGTTTGGAATTTCCTTCTCTACAAGTAATTTATTCATGTAGCTGAATCAATAGTATGCATTTTTATATACTATTGATCCCCCTC
  5   1   2       bld Skin 5x3                        IMAGE:8641550.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCGGGTTTGGGTTTCCTCCCTTTCCCCCTCCGTAAGCTTCTAATCAGGGGCAATGTCCACCCCGGCCAGGAGGAGGCTGATGAGGGACTTTAAGAGGTTGCAGGAAGATCCGCCAGTTGGAGTCAGCGGTGCACCTTCAGAAAACAATATAATGGTGTGGAATGCAGTTATATTTGGGCCTGAAGGGACTCCGTTTGAAGATGGTACATTTAAACTCGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTCttttttttGTCTGATTTAAAAATCCATAAAAGACAAACAAGGAGGCACCCGTAGATCATCGCACTAGTTTTAAGGATTTACATAGAGCGTTGTCCTTAAAAAGACAAATCTTATTTCCCCCTCACCTTGTTGGAAATTCGCTTCTCTCTATGTATTTTATGCATGTATGCTGATATCAATAGTATGCTAATTGTATATACTATTGTATCCCCCCTCATGATATGTGCTGGAGATCATGGAAAATATCCATTGTATCGTaaaaaaaaaaaaaaaaaaaGCGCCAG
  5   1   2       bld Eye1 5x3                        IMAGE:4757287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCCTTTCCCCCTCCGTAAGCTTCTAATCAGGGGCAATGTCCACCCCGGCCAGGAGGAGGCTGATGAGGGACTTTAAGAGGTTGCAGGAAGATCCGCCAGTTGGAGTCAGCGGTGCACCTTCAGAAAACAATATAATGGTGTGGAATGCAGTTATATTTGGGCCTGAAGGGACTCCGTTTGAAGATGGTACATTTAAACTCGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTCtttttttttttGTCT
  3   1   2       add Skin 5g3  in                    IMAGE:8640350.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGGGCGGTGTCGGTTGGTCCTCCTTCCCCTCGTAGTTTTATCAGGGCATTCACCCCGCCAGAGGAGCTGAGAGGACTTAAGAGTGCAGGAAGATCGCCAGTTGAGTTAGCGGTCACCTTCAGAAAACAATATAATGGTGTGAATGCAGTATATTTGGGCCTGAAGGGACTCCGTTTGAAGATGGTACATTTAAACTTGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGGTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGGTGGAGTCCAACATATGATGTATTGTCAATATTAACTTCAATTCAGTTTTTTTTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGGGGCACAACTTTATCAAGAAAACAAGGGAGAGTACGAGAAAAGGGTTTTTGGGATTGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTTTTTTTTTTTTTGTCTGATTTAAAAATCCATAAAAGACAAACAAGGAGGCACCCGTAGATCATCGCACTAGTTTTAAGGATTTACATAGAGCGTTGTCCTTAAAAAAGACAAAATCTTATTTCCCCCCTTACCTTGTTTGGAAAATTTCGCTTTCTCTACTAATGTAATTTTTATTGCATGGTATGCATGATATCAAATAAGTTATTGCTATATTTGTAATATAACCTATTGTATTCCCCCCCCCCTCAATGTATAAGCTGCGCCACCTGCTTCTTAGATACGTTTTTAA
  3   1   2       bld Skin 5g3  in                    IMAGE:8641707.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGAGGAGGCTGTGAGGGATTTAAGAGGTGCAGGAGGTCCGCCAGGTAGAGTCAGCGGTGCACCTCAGAAAAACAATTTAATGGTGTGGAATGCAGTTATATTTGGGCCTGAAGGGACTCCGTTTGAAGATGGTACATTTAAACTCGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTCTTTTTTTTGTTTTTTTGTCTGATTTAAAAATCCATAAAAGACAAACAAGGAGGCACCCGTAGATCATCGCACTAGTTTTAAGGATTTACATAGAGCGTTGTCCTTAAAAAAGACAAAATCTTATTTCCCCCCTTACCTTGTTTGGAAAATTTCGCTTTCTCTACTAATGTAATTTTTATTGCATGGTATGCATGATATCAAATAAGTTATTGCTATATTTGTAATATAACCTACTTGTATTCCCCCCCCCCTCAACGAGTGCGATGATCTACGGGTGCCTCCTGCTGTCTTATGATATCGGNNNNNNACCGGGTT
  3   1   2       bld Ga18                             rxlk101n09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGCGGNCGCGTGGNCGGACGCGTGGNNGGACGCGTGGGTCGTCATAGAATTTTCAGAAGAGTATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATNTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCANCCAANNNNAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTCTTTTTTTTGTTTTTTTGTCTGATTTAAAAATCCATAAAAGACAAACAAGGAGGCACCCGTAGATCATCGCACTAGTTTTAAGGATTTACATAGAGCGTTGTCCTTAAAAAAGACAAAATCTTATTTCCCCCCTTACCTTGTTTGGAAAATTTCGCTTTCTCTACTAATGTAATTTTTATTGCATGGTATGCATGATATCAAATAAGTTATTGCTATATTTGTAATATANNCTATTTNNNNNNCCCCCCTCAATGTATAATGTTGCNGNNAA
  3   1   2       bld Neu4 5g3  in                    IMAGE:4085639.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATCCGAATAAACCTCCAACTGTTAGATTTGTATCAAAAATGTTTCACCCAAATGTTTATGCTGATGGCAGCATATGTTTAGATATCCTTCAGAATCGCTGGAGTCCAACATATGATGTATCGTCAATATTAACTTCAATTCAGTCTCTTCTGGATGAACCCAACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTCTTTTTTTTGTTTTTTTGTCTGATTTAAAAATCCATAAAAGACAAACAAGGAGGCACCCGTAGATCATCGCACTAGTTTTAAGGATTTACATAGAGCGTTGTCCTTAAAAAAGACAAAATCTTATTTCCCCCCTTACCTTGTTTGGAAAATTTCGCTTTCTCTACTAATGTAATTTTTATTGCATGGTATGCATGATATCAAATAAGTTATTGCTATATTTGTAATATAGCCTAATTGTATTCCCCCCCCTCAATGTATAATGTTGCTGTGAAGATTTCA
  5   1   2       bld Lu1                             IMAGE:4057265.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACCCAAATAGCCCAGCCAACAGCCAAGCGGCACAACTTTATCAAGAAAACAAGCGAGAGTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTCttttttttttGTCTGATTTAAAAATCCATAAAAGACAAACAAGGAGGCACCCGTAGATCATCGCACTAGTTTTAAGGATTTACATAGAGCGTTGTCCTTAAAAAAGACAAAATCTTATTTCCCCCCTCACCTTGTTTGGAAAATTTCGCTTTCTCTACTAATGTAATTTTTATTGCATGGTATGCATGATATCAAATAAGTTATTGCTATATTTGTAATATAACCTATTTG
  3   1   2       bld Egg1                            IMAGE:3300616.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTACGAGAAAAGGGTCTCTGCGATCGTTGAGCAAAGTTGGAATGATTCCTAACAGATCACTGTTCTTTTTTTTGTTTTTTTGTCTGATTTAAAAATCCATAAAAGACAAACAAGGAGGCACCCGTAGATCATCGCACTAGTTTTAAGGATTTACATAGAGCGTTGTCCTTAAAAAAGACAAAATCTTATTTCCCCCCTCACCTTGTTTGGAAAATTTCGCTTTCTCTACTAATGTAATTTTTATTGCATGGTATGCATGATATCAAATAAGTTATTGCTATATTTGTAATATAACCTATTTGTATTCCCCCCCCTCAATGTATAATGTTGCTGTGAAGATTTCATGGAAAAAAAATATACGCATTTTGTAAAAAAA
  3   1   2       add DMZ  5g3  in                         xl240e09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GNGAAAAGGGTNTTTGCGATCGTTGNGCAAAGTTGGAATGATTCCTAACAGNTCNCTGNTCTTTTTTTTGnTTTTTTGTCTGATTTAAAAATCCNTAAAAGNCNAACNAGGNGGCNCCCGTAGATCATCGCNCTAGTTTTAAGGNTTTACATAGAGCGTTGTCCTTAAAAAAGNCAAAATNTTATTTCCCCCCTTACCTTGTTTGGAAAATTTCGCTTTCTNTACTAATGTAATTTTTATTGCNTGGTATGCNTGATATCAAATAAGTTATTGCTATATTTGTAATATAACCTATTTGTATTCCCCCCCCTCAATGTATAATGNTGCTGNGAAGATTTCNTGGAAAAAAAATATACNCNTTTTGNAAATCTGTAACTTTTTCTCCCCNTCCCCCNCAAAATGGAATGTTTCTTGTTTTTTTGCAGCAAAAGTAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)