Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6877940.3                      40 PI      90        592     1354                hypothetical protein LOC398792 [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012770876 Xl3.1-xl278c14.3 - 32 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl278c14.3 AGAGAGTGCAACTTCCGGGACAGTGTTTCCGGAGAGCGAGATAATAGTCGAAGTTATAGTTTGTGCCGACACCTGTTGTTGGAGCCGCACGGCATTTGCGCCCCTAAGGGCTCCCTTCATCCGTTACGAACATGGCGGACGACGTGAGTGAGTTCCTGGGCCAGAACCCTGAAACAGCTGCCTGGCTGGAGCTTGTCCACGGGGAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAAGGAATTTATTCTACGGAACCTGAGCGATGTGTGCGGGGAAGCAGAGGTCCCGCCGCCCCCTGAGACCAACCACAAGGCCTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCACGTGTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACTCATACAACACGCGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAACCATGCAAAAAGCAAAAATCCAGTGATCATGGGGAAAGAGAAAGCTCTTATATTGAAGACACCATAAGTGATGGTAATGTTCCATCTACTAGTCTAAATAAGAGAGAGGCACGCTTGAGTGCAGCACAAAGGACAGATGTAAACACAGAATTTTACGACAAGTCAAGTAATCGCCGGTCTCTGCCTGTGTCCAATGCTAAATCTAGATTGAATCTCCCAGAAGAAGCAGGATATAAACATGGTGCTACTCAGGGGAGAAAAAGCCATTCTGACATTCGACATCAAACATCAATGAAAGGTCCAGCACAATCCAGCGATAATGCTCTCAAACCTACTCGCCGTTTCACTACAGAACATACCAAGGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAACTACTTAACACCTGTATTGAATCTCTAAAGGCGACTCTAGAGGTTTCTTTTGTTCCACTGACAGACCTGGCAGATTTACCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGTATGGGCTGTGGGAAGACAATGGAGACCGCCAAAGCTGTGGCTTCCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAAAAGAAAATTTAATGGTCGCGACGTGGAGGACTTGGTACTTGTTGATGAGGAATTTCGGCCTGTTAATTTACCTCCAGCAATAAAAAACCCTCAGGAAATTGTGTAACAGATTTCTTTGTTTGGTGGAAAGAAAATTAAAAAGGACTGAATACTTTGTACTTATTAAAACATCAGGTTTTTTATTTGAAATATTTGTATTTATTTTTGAGTTTTACTAGGGACATACCACATACATTCTGCATGTGGTATGCATTCTGCTTCAAAGCATAATAGCTGTTATTGGATTGCCTTAAATTGCTATTTGGGGTTTTATGGAAAAATCATTGGTATGATTTTAGTATGATTTTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATCGCAATCCATAAGTGTATTGCCTATATCCTTTGTATGTTTAGTCTCCTGCAAACAAAGTTGAATCTAATTTAAAATCATAATAAAAATCTAATAATTGATCTCTTTAACACTG
                                                  Xl3.1-CHK-1012687925       TGCAACTTCCGGGACAGTGTTTCCGGAGAGCGAGATAATAGTCGAAGTTATAGTTTGTGCCGACACCTGTTGTTGGAGCCGCACGGCATTTGCGCCCCTAAGGGCTCCCTTCATCCGTTACGAACATGGCGGACGACGTGAGTGAGTTCCTGGGCCAGAACCCTGAAACAGCTGCCTGGCTGGAGCTTGTCCACGGGGAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAAGGAATTTATTCTACGGAACCTGAGCGATGTGTGCGGGGAAGCAGAGGTCCCGCCGCCCCCTGAGACCAACCACAAGGCCTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCACGTGTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACTCATACAACACGCGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAACCATGCAAAAAGCAAAAATCCAGTGATCATGGGGAAAGAGAAAGCTCTTATATTGAAGACACCATAAGTGATGGTAATGTTCCATCTACTAGTCTAAATAAGAGAGAGGCACGCTTGAGTGCAGCACAAAGGACAGATGTAAACACAGAATTTTACGACAAGTCAAGTAATCGCCGGTCTCTGCCTGTGTCCAATGCTAAATCTAGATTGAATCTCCCAGAAGAAGCAGGATATAAACATGGTGCTACTCAGGGGAGAAAAAGCCATTCTGACATTCGACATCAAACATCAATGAAAGGTCCAGCACAATCCAGCGATAATGCTCTCAAACCTACTCGCCGTTTCACTACAGAACATACCAAGGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAACTACTTAACACCTGTATTGAATCTCTAAAGGCGACTCTAGAGGTTTCTTTTGTTCCACTGACAGACCTGGCAGATTTACCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGTATGGGCTGTGGGAAGACAATGGAGACCGCCAAAGCTGTGGCTTCCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAAAAGAAAATTTAATGGTCGCGACGTGGAGGACTTGGTACTTGTTGATGAGGAATTTCGGCCTGTTAATTTACCTCCAGCAATAAAAAACCCTCAGGAAATTGTGTAACAGATTTCTTTGTTTGGTGGAAAGAAAATTAAAAAGGACTGAATACTTTGTACTTATTAAAACATCAGGTTTTTTATTTGAAATATTTGTATTTATTTTTGAGTTTTACTAGGGACATACCACATACATTCTGCATGTGGTATGCATTCTGCTTCAAAGCATAATAGCTGTTATTGGATTGCCTTAAATTGCTATTTGGGGTTTTATGGAAAAATCATTGGTATGATTTTAGTATGATTTTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATCGCAATCCATAAGTGTATTGCCTATATCCTTTGTATGTTTAGTCTCCTGCAAACAAAGTTGAATCTAATTTAAAATCATAATAAAAATCTAATAATTGATCTCTTTA
                                                      consensus depths      2     2     3     3     3     3     4     4     7     7     7     8     7     8     8     9     8     9     8    10     8    10     8    10     8    10     8    10     8    10     9    11     9    11     9    11     9    11     9    11    10    11    10    11    10    11     9    10     9    10     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    12     9    12     8    11     8    11     8    11     8    11     8    12     9    12    10    13    11    14    11    14    11    14    10    16    10    16    11    16    13    16    13    17    13    17    13    17    12    16    12    16    10    15    10    13    11    13    10    13    10    13    12    15    10    13    10    12    10    12    10    12    12    14    11    14    12    14    12    14    12    14    12    13    11    13    11    13    12    13    11    12    12    12    12    12    12    12    12    12    11    11    11    12    12    12    12    12    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    11    13    12    14    13    14    12    14    12    14    13    14    13    14    13    14    13    14    13    14    13    14    14    14    14    14    12    13    12    13    12    13    10    12     7     7     6     6     6     7     4     7     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     6     5     6     6     6     6     6     6     6     4     6     3     6     4     6     4     6     4     6     4     6     3     6     2     5     2     4     2     4     2     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------A---
                                               BLH ATG     131     312 
                                               BLH MIN     131      71 
                                               BLH OVR     131     382 
                                               ORF LNG     131      71 
  5   1   2       bld DMZ  5g3  in                         xl278c14.5p AGAGAGTGCAACTTCCGGGACAGTGTTTCCGGAGAGCGAGATAATAGTCGAAGTTATAGTTTGTGCCGACACCTGTTGTTGGAGCCGCACGGCATTTGCGCCCCTAAGGGCTCCCTTCATCCGTTACGAACATGGCGGACGACGTGAGTGAGTTCCTGGGCCAGAACCCTGAAACAGCTGCCTGGCTGGAGCTTGTCCACGGGGAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAAGGAATTTATTCTACGGAACCTGAGCGATGTGTGCGGGGAAGCAGAGGTCCCGCCGCCCCCTGAGACCAACCACAAGGCCTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCACGTGTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACTCATACAACACGCGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAACCATGCAAAAAGCAAAAATCCAGTGATCATGGGGAAAGAGAAAGCTCTTATATTGAAGACACCATAAGTGATGGTAATGTTCCATCTACTAGTCTAAATAAGAGAGAGGCACGCTTGAGTGCAGCACAAAGGACAGATGTAAACACAGAATTTTACGACAAGTCAAGTAATCGCCGGTCTCTGCCTGTGTCCATGCTAAATCTAGATNGAATCTCC
  5   1   2       bld DMZ  5g3  in                         xl256k04.5p AGAGAGTGCAACTTCCGGGACAGTGTTTCCGGAGAGCGAGATAATAGTCGAAGTTATAGTTTGTGCCGACACCTGTTGTTGGAGCCGCACGGCATTTGCGCCCCTAAGGGCTCCCTTCATCCGTTACGAACATGGCGGACGACGTGAGTGAGTTCCTGGGCCAGAACCCTGAAACAGCTGCCTGGCTGGAGCTTGTCCACGGGGAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAAGGAATTTATTCTACGGAACCTGAGCGATGTGTGCGGGGAAGCAGAGGTCCCGCCGCCCCCTGAGACCAACCACAAGGCCTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCACGTGTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACTCATACAACACGCGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAA
  5   1   2       bld Ga15      in                       XL488h15ex.5p       TGCAACTTCCGGGACAGTGTTTCCGGAGAGCGAGATAATAGTCGAAGTTATAGTTTGTGCCGACACCTGTTGTTGGAGCCGCACGGCATTTGCGCCCCTAAGGGCTCCCTTCATCCGTTACGAACATGGCGGACGACGTGAGTGAGTTCCTGGGCCAGAACCCTGAAACAGCTGCCTGGCTGGAGCTTGTCCACGGGGAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAAGGAATTTATTCTACGGAACCTGAGCGATGTGTGCGGGGAAGCAGAGGTCCCGCCGCCCCCTGAGACCAACCACAAGGCCTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCACGTGTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACTCATACAACACGCGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAACCATGCAAAAAGCAAAAATCCAGTGATCATGGGGAAAGAGAAAGCTCTTATATTGAAGACACCATAAGTGATTGTAATGTTCCATCTACTAGTCTAAATAAGAGAGAGGCACGCTTGAGTGCAGCACAAAGGACAGATGTAAACACAGAATTTTACGACAAGTCAAGTAATCCGCCCGGTCTCTGCCTGTGTCCAATGCTAAATCTANATTGAATCTCCCA
  5   1   2       bld Emb4 5g                IMAGE:4930105-IMAGp.IMAGp                                     CGAGATAATAGTCGAAGTTATAGTTTGTGCCGACACCTGTTGTTGGAGCCGCACGGCATTTGCGCCCCTAAGGGCTCCCTTCATCCGTTACGAACATGGCGGACGACGTGAGTGAGTTCCTGGGCCAGAACCCTGAAACAGCTGCCTGGCTGGAGCTTGTCCACGGGGAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAAGGAATTTATTCTACGGAACCTGAGCGATGTGTGCGGGGAAGCAGAGGTCCCGCCGCCCCCTGAGACCAACCACAAGGCCTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCACGTGTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACTCATACAACACGCGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGGAACCATGCAAAAAGCAAAAATCCAGTGATCATGGGGAAAGAGAAAGCTCTTATATTGAAGACACCATAAGTGATGGTAATGTTCCATCTACTAGTCTAAATAAGAGAGAGGCATGCTTGAGTGCAGCACAAAGGACAGATGTAAACACAGAATTTTACGACAAGTCAAGTAATCGCCGGGTCTCTGCCTGTGTCCAATGCTAAATCTAGATTGAATCTCCCAGAAGAAGCAGGATATAAACATGGGTGCTACTCAGGGGGAGAAAAAGCCATTCTGACATTCGACATCAAACATCAATGAAAGGTCCAGCACAA
  5   1   2       bld Emb4 5g                         IMAGE:4930105.5p                                      GAGATAATAGTCGAAGTTATAGTTTGTGCCGACACCTGTTGTTGGAGCCGCACGGCATTTGCGCCCCTAAGGGCTCCCTTCATCCGTTACGAACATGGCGGACGACGTGAGTGAGTTCCTGGGCCAGAACCCTGAAACAGCTGCCTGGCTGGAGCTTGTCCACGGGGAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAAGGAATTTATTCTACGGAACCTGAGCGATGTGTGCGGGGAAGCAGAGGTCCCGCCGCCCCCTGAGACCAACCACAAGGCCTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCACGTGTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACTCATACAACACGCGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGGAACCATGCAAAAAGCAAAAATCCAGTGATCATGGGGAAAGAGAAAGCTCTTATATTGAAGACACCATAAGTGATGGTAATGTTCCATCTACTAGTCTAAATAAGAGAGAGGCATGCTTGAGTGCAGCACAAAGGACAGATGTAAACACAGAATTTTACGACAAGTCAAGTAATCGCCGGTCTCTGCCTGTGTCCAATGCTAAATCTAGATTGAATCTCCCAGAAGAAGCAGGATATAAACATGGTGCTACTTCGGGGGAGAAAAAGCCATTCTGACATTCGACATCAAACATTCAATGAAAAGGTCCAGCACCATCCCAGCGATAATGGCTCTCAAAACTTACTCCCCCGGTTCCCCTACCGAAACATACCCAAGGGAAAAGGCAGCCCTTTTCTTTTAACCAGACTTCAACCCAAAAAGGGGG
  5   1   2       bld Em10 5g                         IMAGE:8321297.5p                                        GATAATAGTCGAAGTTATAGTTTGTGCCGACACCTGTTGTTGGAGCCGCACGGCATTTGCGCCCCTAAGGGCTCCCTTCATCCGTTACGAACATGGCGGACGACGTGAGTGAGTTCCTGGGCCAGAACCCTGAAACAGCTGCCTGGCTGGAGCTTGTCCACGGGGAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAAGGAATTTATTCTACGGAACCTGAGCGATGTGTGCGGGGAAGCAGAGGTCCCGCCGCCCCCTGAGACCAACCACAAGGCCTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCACGTGTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACTCATACAACACGCGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCATACGAAGGGGTAGAAGAGGAACCATGCAAAAAGCAAAAATCCAGTGATCATGGGGAAAGAGAAAGCTCTTATATTGAAGACACCATAAGTGATGGTAATGTTCCATCTACTAGTCTAAATAAGAGAGAGGCATGCTTGAGTGCAGCACAAAGGACAGATGTAAACACAGAATTTTTACGACAAGTCAAGTAATCGCCGGTCTCTG
  5   1   2       bld Emb4 5g                         IMAGE:4724669.5p                                           AATAGTCGAAGTTATAGTTTGTGCCGACACCTGTTGTTGGAGCCGCACGGCATTTGCGCCCCTAAGGGCTCCCTTCATCCGTTACGAACATGGCGGACGACGTGAGTGAGTTCCTGGGCCAGAACCCTGAAACAGCTGCCTGGCTGGAGCTTGTCCACGGGGAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAAGGAATTTATTCTACGGAACCTGAGCGATGTGTGCGGGGAAGCAGAGGTCCCGCCGCCCCCTGAGACCAACCACAAGGCCTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCACGTGTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACTCATACAACACGCGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAACCATGCAAAAAGCAAAAATCCAGTGATCATGGGGAAAGAGAAAGCTCTTATATTGAAGACACCATAAGTGATGGTAATGTTCCATCTACTAGTCTAAATAAGAGAGAGGCACGCTTGAGTGCAGCACAAAGGACAGATGTAAACACAGAATTTTACGACAAGTCAAGTAATCGCCGGTCTCTGCCTGTGTCCAATGCTAAATCTAGATTGAATCTCCCAGAAGAAGCAGGATATAAACATGGTGCTACTCAGGGGGAGAAAAAGCCATTCTGACATTCGACATCAAACATCAATGAAAGGTCCAGCACAATCCAGCGATAATGCTCTCAAACCTACTCGCCGTTTCACTACAGAACATACCCAGGAAAGGCAGCCTTTTCTTTACAGACTCTAACAAACGTGGGCTTGGAAACTTGAATCTGGTGGGGGGGTTTCAT
  5   1   2       bld Ga18      in                      xlk164n18ex.5p                                                     TCGAAGTTATAGTTTGTGCCGACACCTGTTGTTGGAGCCGCANNNNTTGCGCCCCTANNNNNCCTTTATCCGTTACGAACATGGCGGACGACGTGAGNGAGTTCCTGGGCCAGAACCCTGAAACAGCTGCCTGGNTGGAGCTTGTCCACGGGGAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTANGAATTTATTCTACGGAACCTGAGCGATGTGTGCGGGGAAGCAGAGGTCCCGCCGCCCCCTGAGACCAACCACAAGGCCTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCACGTGTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACTCATACAACACGCGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAACCATGCAAAAAGCAAAAATCCAGTGATCATGGGGAAAGAGAAAGCTCTTATATTGAAGACACCATAAGTGATGGTAATGTTCCATCTACTAGTCTAAATAAGAGAGAGNNATGCTTGAGTGCAGNACAAAGGACAGATGTAAACACAGAATTTTACGACAAGNCAAGTAATCGCCGGTCTCTGCCTGTGTCCAATGCTAAATCTAGATTGAATCTCCCAGAAGAAGCAGNNNATAAACATGNTGCTACTCAGGGGAGAAAAAGNCATTCTGACATTCGACATCAAACATCANGAAAGG
  5   1   2       bld Ga15 5g3  in                       XL474n08ex.5p                                                                            TTGTTGGAGCCGCACGGCATTTGCGCCCCTAAGGGCTCCCTTCATCCGTTACGAACATGGCGGACGACGTGAGTGAGTTCCTGGGCCAGAACCCTGAAACAGCTGCCTGGCTGGAGCTTGTCCACGGGGAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAAGGAATTTATTCTACGGAACCTGAGCGATGTGTGCGGGGAAGCAGAGGTCCCGCCGCCCCCTGAGACCAACCACAAGGCCTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCACGTGTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACTCATACAACACGCGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAACCATGCAAAAAGCAAAAATCCAGTGATCATGGGGAAAGAGAAAGCTCTTATATTGAAGACACCATAAGTGATGGTAATGTTCCATCTACTAGTCTAAATAAGAGAGAGGCACGCTTGAGTGCAGCACAAAGGACAGATGTAAACACAGAATTTTACGACAAGTCAAGTAATCGCCGGTCTCTGCCTGTGTCCAATGCTAAATCTAGATTGAATCTCCCANAAGAAGCAGGATATAAACATGGTGCTACTCAGGGGAGAAAAAGCCATTCTGACATTCNAC
  5   1   2       bld DMZ  5g3  in                         xl241l17.5p                                                                                                          GTTGTTGGAGCCGCACGGCATTTGCGCCCCTAAGGGCTCCCTTCATCCGTTACGAACATGGCGGACGACGTGAGTGAGTTCCTGGGCCAGAACCCTGAAACAGCTGCCTGGCTGGAGCTTGTCCACGGGGAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAAGGAATTTATTCTACGGAACCTGAGCGATGTGTGCGGGGAAGCAGAGGTCCCGCCGCCCCCTGAGACCAACCACAAGGCCTTGGACCGACTGCTCGCCTACTCTATGGTGTGGGCCAATCACGTGTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACTCATACAACACACGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGGAACCATGCAAAAAGCAAAAATCCAGTGATCATGGGGAAAGAGAAAGCTCTTATATTGAAGACACCATAAGTGATGGTAATGTTCCATCTACTAGTCTAAATAAGAGAGAGGCACGCTTGAGTGCAGCACAAAGGACAGATGTAAACACAGAATTTTACGACAAGTCAAGTAATCGCCGGTCTCTGCCTGTGTCCAATGCTAAATCTAGATTGAATCTCACAGAAGAAGCAGGATATAAACATGGTGCTACTCAGGGGAGAAAAAGCCATTCTGACATTC
  5   1   2       bld Tbd7      in                         XL083e18.5p                                                                                                                                                                              ACAGCTGCCTGGCTGGAGCTTGTCCACGGGGAGTGCGAGTCGGACAAGTTGTGGCGGTACCGTAAGGAATTTATTCTACGGAACCTGAGCGATGTGTGCGGGGA
  5   1   2       bld Kid                             IMAGE:7007996.5p                                                                                                                                                                                                                                                                                                                                       CTGCTCGCCTACTCTATGGTGTGGGCCAATCACGTGTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACGCATACAACACGCGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAACCATGGAAAAAGCAAAAATCCAGTGATCATGGGGAAAGAGAAAGCTCTTACATTGAAGACACCATAAGTGATGGTAATGTTCCATCTACTAGTCTAAATAAGAGAGAGGCACGCTCGAGTGCAGCACAAAGGACAGATGTAAACAAAGAATTTTACGAAAAGTCAAGTAATCGCCGGTCTCTGCCTGTGTCCAATGCTAAATCTAGATTGAATCTCCCAGAAGAAGCAGGATATAAACATGGTGCTACTCAGGGGAGAAAAAGCCATTCTGACATTCGACATCAAACATCAGTTAAAGGTCCATCACAATCCAGCGATAATGCTCTCAAACCTACTCGCCGTTTCACTACAGAACATACCAAGGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTTGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCCTCAACACGAAGAACTACTTAAACACTGTATTTGATCTCTNAAGGCGACTCTAG
  5   1   2       bld Bla1      in                    IMAGE:3379557.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAACCATGCAAAAAGCAAAAATCCAGTGATCATGGGGAAAGAGAAAGCTCTTATATTGAAGACACCATAAGTGATGGTAATGTTCCATCTACTAGTCTAAATAAGAGAGAGGCACGCTTGAGTGCAGCACAAAGGACAGATGTAAACACAGAATTTTACGACAAGTCAAGTAATCGCCGGTCTCTGCCTGTGTCCAATGCTAAATCTAGATTGAATCTCACAGAAAGAA
  5   1   2       bld DMZ  5x3  out                        xl279b14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCTGATCTCAGAGAAAGCTCTTATATTGAAGACACCATAAGTGATGGTAATGTTCCATCTACTAGTCTAAATAANANAGAGGCACGCTTGAGTGCANCACAAAGGACAGATGTAAACACAGAATTTTACGACAAGTCAAGTAATCGCCGGTCTCT
  3   1   2       bld Ga15      in                       XL488h15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGCTCTTATATNGAAGACACCATAAGTGATTGTAATGTTCCATCTACTAGTCTAAATAAGAGAGAGGCACGCTTGAGTGCAGCACAAAGGACAGATGTAAACACAGAATTTTACGACAAGTCAAGTAATCGCCGGTCTCTGCCTGTGTCCAATGCTAAATCTAGATTGAATCTCCCAGAAGAAGCAGGATATAAACATGGTGCTACTCAGGGGAGAAAAAGCCATTCTGACATTCGACATCAAACATCAATGAAAGGTCCAGCACAATCCAGCGATAATGCTCTCAAACCTACTCGCCGTTTCACTACAGAACATACCAAGGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAACTACTTAACACCTGTATTGAATCTCTAAAGGCGACTCTAGAGGTTTCTTTTGTTCCACTGACAGACCTGGCAGATTTACCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGTATGGGCTGTGGGAAGACAATGGAGACCGCCAAAGCTGTGGCTTCCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAAAAGAAAATTTAATGGTCGCGACGTGGAGGACTTGGTACTTGTTGATGAGGAATTTCGGCCTGTTAATTTACCTCCAGCAATAAAAAACCCTCAGGAAATG
  3   1   2      seed DMZ  5g3  in                         xl278c14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCATAAGTGATGGTAATGTTCCATCTACTAGTCTAAATAAGAGAGAGGCACGCTTGAGTGCAGCACAAAGGACAGATGTAAACACAGAATTTTACGACAAGTCAAGTAATCGCCGGTCTCTGCCTGTGTCCAATGCTAAATCTAGATTGAATCTCCCAGAAGAAGCAGGATATAAACATGGTGCTACTCAGGGGAGAAAAAGCCATTCTGACATTCGACATCAAACATCAATGAAAGGTCCAGCACAATCCAGCGATAATGCTCTCAAACCTACTCGCCGTTTCACTACAGAACATACCAAGGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAACTACTTAACACCTGTATTGAATCTCTAAAGGCGACTCTAGAGGTTTCTTTTGTTCCACTGACAGACCTGGCAGATTTACCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGTATGGGCTGTGGGAAGACAATGGAGACCGCCAAAGCTGTGGCTTCCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAAAAGAAAATTTAATGGTCGCGACGTGGAGGACTTGGTACTTGTTGATGAGGAATTTCGGCCTGTTAATTTACCTCCAGCAATAAAAAACCCTCAGGAAATTGTGTAACAGATTTCTTTGTTTGGTGGAAAGAAAATAAAAAGGAC
  3   1   2       bld Ga15 5g3  in                       XL474n08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGAGAGGCACGGCTTGAGTGCAGCACAAAGGGACAGATGTAAACACAGAATTTTACGACAAGTCAAGTAATCGCCGGTCTCTGCCTGTGTCCAATGCTAAATCTAGATTGAATCTCCCAGAAGAAGCAGGATATAAACATGGTGCTACTCAGGGGAGAAAAAGCCATTCTGACATTCGACATCAAACATCAATGAAAGGTCCAGCACAATCCAGCGATAATGCTCTCAAACCTACTCGCCGTTTCACTACAGAACATACCAAGGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAACTACTTAACACCTGTATTGAATCTCTAAAGGCGACTCTAGAGGTTTCTTTTGTTCCACTGACAGACCTGGCAGATTTACCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGTATGGGCTGTGGGAAGACAATGGAGACCGCCAAAGCTGTGGCTTCCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAAAAGAAAATTTAATGGTCGCGACGTGGAGGACTTGGTACTTGTTGATGAGGAATTTCGGCCTGTTAATTTACCTCCAGCAATAAAAAACCCTCAGGAAATTGTGTAACAGATTTCTTTGTTTGGTGGAAAGAAAATTAAAAAGGACTGAATACTT
  3   1   2       bld DMZ  5g3  in                         xl241l17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAGAGAGGCACGCNTGAGTGCAGCACCAAGGACAGATGTAAACACAGAATTTTACGACAAGTCAAGTAATCGCCGGTCTCTGCCTGTGTCCAATGCTAAATCTAGATTGAATCTCACAGAAGAAGCAGGATATAAACATGGTGCTACTCAGGGGAGAAAAAGCCATTCTGACATTCGACATCAAACATCAATGAAAGGTCCAGCACAATCCAGCGATAATGCTCTCAAACCTACTCGCCGTTTCACTACAGAACATACCAAGGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCAGGGGGTTTCAATGCCAACCTCAACCATGAAGAACTACTTAACACCTGTATTGAATCTCTAAAGGCGACTCTAGAGGTTTCTTTTGTTCCACTGACAGACCTGGCAGATTTACCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGTATGGGCTGTGGGAAGACAATGGAGACCGCCAAAGCTGTGGCTTCCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAAAAGAAAATTTAATGGTCGCGACGTGGAGGACTTGGTACTTGTTGATGAGGAATTTCGGCCTGTTAATTTACCTCCAGCAATAAAAAACCCTCAGGAAATTGTGTAACAGATTTCTTTGTTTGGTGGAAAGAAAATAAAAAGGACTGAATA
  3   1   2       bld DMZ  5g3  in                         xl256k04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTAAACACAGACTTTTNCGACANGTCAAGTAATCGCCGGTCTCTGCCTGTGTNCAATGCTAAATCTAGATTGAATCTCCCAGAAGAAGCAGGATATAAACATGGTGCTACTCAGGGGAGAAAAAGCCATTCTGACATTCGACATCAAACATCAATGAAAGGTCCAGCACAATCCAGCGATAATGCTCTCAAACCTACTCGCCGTTTCACTNCAGAACATACCAAGGAAAGGCAGCCTTTCTTTAACAGACTNTACAAAACAGTGGCTNGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAACTACTTAACACCTGTATTGAATCTCTAAAGGCGACTCTAGAGGTTTCTTTTGTTCCACTGACAGACCTGGCAGATTTACCCCAAAACAAAACCTCTCAGGAGANTACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGTATGGGCTGTGGGAAGACAATGGAGACCGCCAAAGCTGTGGCTTCCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTNGTAGTTNGAATATGCAAAAGAAAATTTAATGGTCGCGACGTGGAGGACTTGGTACTTNTTGATGAGGAATTTCGGCCTGTTAATTTACCTCCAGCAATAAAAAACCCTCACGGAAATNGTGTNACAGATTTCTTTGTTTGGTGGAAAGAAAATAAAAAGGACT
  5  -1   2       bld Em10                            IMAGE:8317613.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCAAGTATTCGCCGGTCTCTGCCTGTGTCCAATGCTAAATCTAGATTGATTCTCACAGAGGAAGCAGGATATAAACATGGTGCTATTCAGGGGAGAAAAAGCCATTCTGACATTCGACATCAAACATCAATGAAAGGTCCAGCACAATCCAGCGATAATGCTCTCAAACCTACTCGCCGTTTCATTACAGAACATACCAAGGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATTTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAACTACTTAACACCTGTATTGAATCTCTAAAGGCGACTCTAGAGGTTTCTTTTGTTCCACTGACAGACCTGGCAGATTTACCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGTATGGGCTGTGGGAAGACAATGGAGACCGCCAAAGCTGTGGCTTCCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAAAAGAAAATTTAATGGTCGCGACGTGGAGGACTTGGTACTTGTTGATGAGGAATTTCGGCCTGTTAATTTACCTCCAGCAATAAAAAACCCTCAGGAAATTGTGTAACAGATTTCTTTGTTTGGTGGAAAGAAAATTAAAAAGGACTGAATACTTTGTACT
  3   1   2       bld Bla1      in                    IMAGE:3379557.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCATTCTGACATTCGACATCAAACATCAATGAAAGGTCCAGCACAACCCAGCGATAATGCTCTCAAACCTACTCGCCGTTTCACTACAGAACATACCAAGGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCAGGGGGTTTCAATGCCAACCTCAACCATGAAGAACTACTTAACACCTGTATTGAATCTCTAAAGGCGACTCTAGAGGTTTCTTTTGTTCCACTGACAGACCTGGCAGATTTACCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGTATGGGCTGTGGGAAGACAATGGAGACCGCCAAAGCTGTGGCTTCCCG
  5   1   2       bld Ga15      in                       XL489h07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCATTCTGACATTCGACATCAAACATCAATGAAAGGTCCAGCACAATCCAGCGATAATGCTCTCAAACCTACTCGCCGTTTCACTACAGAACATACCAAGGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAACTACTTAACACCTGTATTGAATCTCTAAAGGCGACTCTAGAGGTTTCTTTTGTTCCACTGACAGACCTGGCAGATTTACCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGTATGGGCTGTGGGAAGACAATGGAGACCGCCAAAGCTGTGGCTTCCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAAAAGAAAATTTAATGGTCGCGACGTGGAGGACTTGGTACTTGTTGATGAGGAATTTCGGCCTGTTAATTTACCTCCAGCAATAAAAAACCCTCAGGAAATTGTGTAACAGATTTCTTTGTTTGGTGGAAAGAAAATTAAAAAGGACTGAATACTTTGTACTTATTAAAACATCAGGTTTTTTATTTGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL489h07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCATTCTGACATTCGACATCAAACATCAATGAAAGGTCCAGCACAATCCAGCGATAATGCTCTCAAACCTACTCGCCGTTTCACTACAGAACATACCAAGGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAACTACTTAACACCTGTATTGAATCTCTAAAGGCGACTCTAGAGGTTTCTTTTGTTCCACTGACAGACCTGGCAGATTTACCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGTATGGGCTGTGGGAAGACAATGGAGACCGCCAAAGCTGTGGCTTCCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAAAAGAAAATTTAATGGTCGCGACGTGGAGGACTTGGTACTTGTTGATGAGGAATTTCGGCCTGTTAATTTACCTCCAGCAATAAAAAACCCTCAGGAAATTGTGTAACAGATTTCTTTGTTTGGTGGAAAGAAAATTAAAAAGGACTGAATACTTG
  5   1   2       bld Ga15      in                       XL469g21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCAAACCTACTCGCCGTTTCACTACAGAACATACCAAGGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAACTACTTAACACCTGTATTGAATCTCTAAAGGCGACTCTAGAGGTTTCTTTTGTTCCACTGACAGACCTGGCAGATTTACCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGTATGGGCTGTGGGAAGACAATGGAGACCGCCAAAGCTGTGGCTTCCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAAAAGAAAATTTAATGGTCGCGACGTGGAGGACTTGGTACTTGTTGATGAGGAATTTCGGCCTGTTAATTTACCTCCAGCAATAAAAAACCCTCAGGAAATTGTGTAACAGATTTCTTTGTTTGGTGGAAAGAAAATTAAAAAGGACTGAATACTTTGTACTTATTAAAACATCAGGTTTTTTATTTGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL469g21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCAAACCTACTCGCCGTTTCACTACAGAACATACCAAGGAAAGGCAGCCTTTCTTTAACAGACTCTACAAAACAGTGGCTTGGAAACTTGTATCTGCTGGGGGTTTCAATGCCAACCTCAACCATGAAGAACTACTTAACACCTGTATTGAATCTCTAAAGGCGACTCTAGAGGTTTCTTTTGTTCCACTGACAGACCTGGCAGATTTACCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGTATGGGCTGTGGGAAGACAATGGAGACCGCCAAAGCTGTGGCTTCCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAAAAGAAAATTTAATGGTCGCGACGTGGAGGACTTGGTACTTGTTGATGAGGAATTTCGGCCTGTTAATTTACCTCCAGCAATAAAAAACCCTCAGGAAATTGTGTAACAGATTTCTTTGTTTGGTGGAAAGAAAATTAAAAAGGACTGAATACTTG
  3   1   2       bld Neu7                                 XL046j08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCCACTGACCAGACCTGGCAGATTTACCCCAAAACAAAACCTCTCAGGAGAATACAGTTTGTGAATTAAGGTGCAAATCTGTTTATTTAGGTATGGGCTGTGGGAAGACAATGGAGACCGCCAAAGCTGTGGCTTCCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAAAAGAAAATTTAATGGTCGCGACGTGGAGGACTTGGTACTTGTTGATGAGGAATTTCGGCCTGTTAATTTACCTCCAGCAATAAAAAACCCTCAGGAAATTGTGTAACAGATTTCTTTGTTTGGTGGAAAGAAAATTAAAAAGGACTGAATACTTTGTACTTATTAAAACATCAGGTTTTTTATTTGAAATATTTGTATTTATTTTTGAGTTTTACTAGGGACATACCACATACATTCTGCATGTGGTATGCATTCTGCTTCAAAGCATAATAGCTGTTATTGGATTGCCTTAAATTGCTATTTGGGGTTTTATGGAAAAATCATTGGTATGATTTTAGTATGATTTTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATCGCAATCCATAAGTGTATTGCCTATATCCTTTGTATGTTTAGTCTCCTGCAAACAAAGTTAATCTAATTTAAAATCATAATAAAAATCTAATAA
  3   1   2       bld Ov1                             IMAGE:8329120.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCCTTTCGTGGTATGTTCTGTAGTGAAACGGCGAGTAGGTTTGAGAGCATTATCGCTGGATTGTGCAGGACTTTTCATTGATGTTTGATGTCGAATGTCAGAATGGCTTTTTTTCCCCTGAGTAGCACCATGTTTATATCCTGCTTCTTTTGGGAGATTCAATCTAGATTTAGCATTGGACACAGGCAGAGACCGGCGATTACTTGACTTGTCGTAAAATTCTGTGTTTACATCCAGCAATAAAAAACCCTCAGGAAATTGTGTAACAGATTTCTTTGTTTGGTGGAAAGAAAATTAAAAAGGACTGAATACTTTGTACTTATTAAAACATCAGGTTTTTTATTTGAAATATTTGTATTTATTTTTGAGTTTTACTAGGGACATACCACATACATTCTGCATGTGGTATGCATTCTGCTTCAAAGCATAATAGCTGTTATTGGATTGCCTTAAATTGCTATTTGGGGTTTTATGGAAAAATCATTGGTATGATTTTAGTATGATTTTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATCGCAATCCATAAGTGTATTGCCTATATCCTTTGTATGTTTAGTCTCCTGCAAACAAAGTTGAATCTAATTTAAAATCATAATAAAAATCTAATAATTGATCTCTTTAACACTGTAAAAAAAAAAAAAAAG
  5   1   2       bld Ga15      in                       XL440o01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCCGCCGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCNAAAGAAAATTTAATGGTCGCGACGTGGAGGACTTGGTACTTGTTGATGAGGAATTTCGGCCTGTTAATTTACCTCCAGCAATAAAAAACCCTCAGGAAATTGTGTAACAGATTTCTTTGTTTGGTGGAAAGAAAATTAAAAAGGACTGAATACTTTGTACTTATTAAAACATCAGgttttttatttgaaatatttgtatttatttttgagttttACTAGGGACATACCACATACATTCTGCATGTGGTATGCATTCTGCTTCAAAGCATAATAGCTGTTATTGGATTGCCTTAAATTGCTATTTGGGGTTTTATGGAAAAATCATTGGTATGATTTTAGTATGAtttttttttAATTAAAATGGTCTTTAACCTTGTAAATGATCGCAATCCATAAGTGTATTGCCTATATCCTTTGTATGTTTAGTCTCCTGCAAACAAAGTTGAATCTAATTTAAAATCATAATAAAAATCTAATAATTGATCTCTTTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL440o01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGTAAANCNGTTTCNGAAAAAGAAAGTNGTAGTTAGAATANGCAAAAGAAAATTTAATGGTCGCGACGTGGAGGNCTTGGTACTTGTTGATGAGGAATTTCGGCCTGTTAATTTACCTCCAGCAATAAAAAACCCTCAGGAAATTGTGTAACAGATTTCTTTGTTTGGTGGAAAGAAAATTAAAAAGGACNGAATACTTTGTACTTATTAAAACATCAGGTTTTTTATTTGAAATATTTGTATTTATTTTTGAGTTTTACTAGGGACATACCACATACATTCTGCATGTGGTATGCATTCTGCTTCAAAGCATAATAGCTGTTATTGGATTGCCTTAAATTGCTATTTGGGGTTTTATGGAAAAATCATTGGTATGATTTTAGTATGATTTTTTTTTAATTAAAATGGTCTTTAACCTTGTAAATGATCGCAATCCATAAGTGTATTGCCTATATCCTTNGTATGTTTAGTCTCCTGCAAACAAAGTGAATCTAATT
  3   1   2       chi Ga18      in                      xlk164n18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAANNNCNNTTTTTNTTGAAATNNTNNTATTTATTTTTGANTTTNCTAGGGACNNNCACANACNTTCTGCATNTGGTATNNATTCTNCTTNNAAGCNNNNNAGCTGTTATTGGATTGCCTTAAATTGCTATTTGGGGTTTTATGGAAAAATCATTGGTATGATTTTAGTATGATTTTTTTAATTAAAATGGTCTTTANCCTTGTAAATGATCGCAATCCATAAGTGTATTGCCTATATCCTTTGTATGTTTANTCTCCTGCAAACAAAGTTGAATCTAATTTAAAATCATAATAAAAATCTAATAATTGATCTCTTTAACACTGTAACCAAGCAGTGGTTTAATTCATACTGCAAAGTAGGTTGGCAATGGTAAAAGAAAAGGCTGGTTTTGTTGTATGTACTTAAAGGGGAACTCCAGCTTCCAAACCAAAATTTTATAAAGAGGCCCACATAACACAGATACCCCTAATATACCCATCATAGTTACCTGTTTCTTCAAAAGGTATGAGTAAATGCCATTTTATATGCTGAAATCCAGCTGTTTCAGAGTTTTTCTCTTTCTGCATCATTTGAAATCCTGGCAGGGAAGGAGGAACTAAACACTGATGTTACAAATTGTAACAACTTCTCCACGGCTTACAGACAGCATGCAGGAACTACATAACCCACAATGCATTGCACTGTGATGTTCTGTTCCTTATTAAAATCACTTGTGCAGGGAATTGTGTGGTTTGGAGGATACAGTCTAAGGACAGATGGCTGCTGAAACAAAGTAACAGTAGTCAGCCANCTCAGCAACGTAGTCAGAAAGATCAGCAGAAGAGCAGGGGGCTAGGTTTGGGGAANNNCAAA
  3   1   2       bld Tbd7      in                         XL083e18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGCCTTAAATTGCTATTTGGGGTTTTATGGAAAAATCCATTGGTATGATTTTAGTATGATTTTTTTAATTAAAATGGTCTTTAACTTTGTAAATGATCGCAATCCATAAGTGTATTGCCTATATCCTTTGTATGTTTAGTNTNCCTGCAAACAAAGTTG
  5   1   0       chi Skin                            IMAGE:8641140.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTAACCAGCAGTGGTTTAATTCATACTGCAAAGTAGGTTGGCAATGGTAAAAGAAAAGGCTGGTTTTGTTGTATGTACTTAAAGGGGAACTCCAGCTTCCAAACCAAAATTTTATAAAGAGGCCCACATAACACAGATACCCCTAATATACCCATCATAGTTACCTGTTTCTTCAAAAGGTATGAGTAAATGCCATTTTATATGCTGAAATCCAGCTGTTTCAGAGTTTTTCTCTTTCTGCATCATTTGTTTCATCACACTGATGTTACAAATTGTAACAACTTCTCCACGGCTTACAGACAGAATGCAGGAACTACATAACCCACAATGCATTGCACTGTGATGTTCTGTTCCTTATTAAAATCACTTGTGCAGGGAATTGTGGGGTTTGGAGGATACAGTCTAAGGACAGATGGCTGCTGAAACAAAGTAACAGTAGTCAGCCAGCTCAGCAACGTAGTCAGAAAGATCAGCAGAAGAGCAGGGGGCTAGGTTTGGGGAACTGTCAAAAACCATTAAAAATATTGCAAAGTTGCTTGAAATTATGTTTACTTTTCAAAAAGCTTATGTTTTTGTGGAATTCCCCTTTAAGATTTTAGTTGCATTGCTTTTCCAGTTTTAGCAAGTTATTGGATTAGTTCCATGCCAACACAGATACTCTCTCAGAATGTTANCAATAACATCATTAAAGGTTTTTGCATTTTGTGTaaaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)