Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL489n16ex.5                         53 END     13         38       24                (no blast hit)
     2   2.0    0Xl3.1-xlk117k03ex.3                         7 END     1           2       14                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012770924 Xl3.1-XL489n16ex.3 - 34 ESTs
                                                                       ..-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL489n16ex.3                                                                                   GCATTTGATTTTTACATGGGGTCAGTGACCCCCATTTGAAAATTGTAAAGAGTTAGAGGAAGAGGCCATAATCAAAAAAATACAGAAAAATAACCCAGAAAAAATGAAGGCCAATTCAAATGTTGCTTAGAATTCACCATTCTATACAATACTAAAATATGATTTAAAGATAATTCACCTTTAAGTTAAGACCCCTCCCAAACGTCACTGCTGTCTCCAGTACAGTCCTGTTTGCTCTACCTGTTCCCAAATAGCAGAGTAGCACAGCAGGGGTTGAGGGTGTAGGCAATCATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGCTGTATTCCTCTGTCGTTTGGATCGTTTGGAAACACAATAGGTAGGATAGGTAGGGTCCTTGCCTAATGAAATGACATTCATATTTCCATATTCCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTAATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCTTGCCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTTGACAGCACGCTTTGTAACCAAAATAAATATTGATTGTTCTGTAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012687688                                                                                         GATTTTTACATGGGGTCAGTGACCCCCATTTGAAAATTGTAAAGAGTTAGAGGAAGAGGCCATAATCAAAAAAATACAGAAAAATAACCCAGAAAAAATGAAGGCCAATTCAAATGTTGCTTAGAATTCACCATTCTATACAATACTAAAATATGATTTAAAGATAATTCACCTTTAAGTTAAGACCCCTCCCAAACGTCACTGCTGTCTCCAGTACAGTCCTGTTTGCTCTACCTGTTCCCAAATAGCAGAGTAGCACAGCAGGGGTTGAGGGTGTAGGCAATCATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGCTGTATTCCTCTGTCGTTTGGAxxxxxxxxxxxCACAATAGGxAxxATAGGTAGGGTCCTTGCCTAATGAAATGACATTCATATTTCCxxATTxxTxTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTAATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCTTGCCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTTGACAGCACGCTTTGTAACCAAAATAAATATTGATTGTTCTGTAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                        3     6     3     6     3     6     3     6     4     7     4     8     4     8     4     9     4     9     5    10     5    10     5    10     6    11     7    12     8    13     9    14    10    14    10    14    10    16     9    16     9    16    10    17    10    20    10    20    10    20    10    21    10    21     9    22    10    22    11    22    11    24    11    25    13    28    13    29    14    29    14    29    15    29    15    29    15    29    15    29    16    30    16    30    17    31    18    31    18    30    18    31    30    31    30    31    31    32    28    33    26    33    28    33    28    33    28    33    26    33    28    33    29    33    29    33    29    32    28    32    29    31    18    31    18    31    18    31    18    30    18    30    15    30    14    29    15    29    14    29    14    29    12    28    12    28    12    25     9    21     7    16     6     9     5     9     4     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                   TTGCTCTACCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                           AGAGTAGTACAGCAGGGGTTGAGGGTGTAGGCAATCATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTACTCTTCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACAGGTAGGGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGTAGGGCACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCCGTCCTGTGTATTGACAAATAACGTCAGGTAACTTGTAATTGGTATATAAGGGTGTTTTTTGTTAAAGACTGTACTAGTGATTTGGGCTTGTCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                   --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---G-------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --TT--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------T-----
                                                    Xl3.1-XL489n16ex.3                                                                                                  ATG------------------TGA------TAA------------------------------------------TAA------------------------------------------------------------------TGA------------------------TAA---------------------------------------------------------------------------------------------TAG---------TGA---------TGA---ATG---------------------------------------------------TAG---------------------------------TAATGA------------------------------------------------------------------------------------------------------------------------------TAATAA---------------------------------TAG------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------TAA------------------------------------------------------------------------------------------------------------------TGA------------TAA------TAA---------------TAA
  5   1   2       bld Ga15                               XL426f11ex.5p actgcagtatgaattggagaaggcctgcatagaaagatgagtaataaaagtagcaatgacaataaatgtgtagccttacagagcatttgattttTACATGGGGTCAGTGACCCCCATTTGAAAATTGTAAAGAGTTAGAGGAAGAGGCCATAATCaaaaaaatacagaaaaataacccagaaaaaaTGAAGGCCAATTCAAATGTTGCTTAGAATTCGCCATTCTATACAATACTAAAATATGATTTAAAGATAATTCACCTTTAAGTTAAGACCCCTCCCAAACGTCACTGCTGTCTCCAGTACAGTCCTGTTTGCTCTACCTGTTCCCAAATAGCAGAGTAGCACAGCAGGGGTTGAGGGTGTAGGCAATTATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGCTGTATTCCTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTACCTAATGAAATGACATTAATATTCCATTCATATTTCCATTTTTCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTTATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGAAATGGGGGACTCCTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGCGATTANAAAGATTTATAACAAATCTTTAATGTTGAGGTTTATTTGCTGATC
  5   1   2       chi Eye1      out                   IMAGE:6948758.5p           ATACAGGATAAGAAGAGGGTGAAGAGACAATCCGGGCCGNTGCTGGTCCGGTCCGGAATTCTCCGGATCAGAGCATTTGATTTTTACATGGGGTCAGTGACCCCCATTTGAAAATTGTAAAGAGTTAGAGGAAGAGGCCATAATCaaaaaaatacagaaaaataacccagaaaaaaTGAAGGCCAATTCAAATGTTGCTTAGAATTCACCATTCTATACAATACTAAAATATGATTTAAAGATAATTCACCTTTAAGTTAAGACCCCTCCCAAACGTCACTGCTGTCTCCAGTACAGTCCTGTTTGCTCTACCTGTTCCCAAATAGCAGAGTAGCACAGCAGGGGTTGAGGGTGTAGGCAATCATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGCTGTATTCCTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGCCCTTACCTAATGAAATGACATTcatattccattcaaatttccatttttctttttaaatgggatattttacacacatttattttACATGCATGGGTTCATAAACCAGTATTATATAAAGGTCCCTTGTTCAACTTAAAGCCTTCCAGTTTTTGCTACTCAGTGATAAATAAAAAACAACTGTAATTAACAACCTTTACACCATTTAGAAAAACTCCTTAACTACCGCAAAAAGTAAAGGGGGGGACCCCCTTTTCCCAAGTCCTTGGAATACCCACTTGGAAAATATTAGGGGAAGTCCATTTACCCAACCGATTCCACCAGCAAGAACCCCTTAATTCCTTGCACTCTTAAATTGACACCAATCACATAGATTTCTACAAAAGAGCCCGAAAAACCCCTTACCAAAGGCTGACCAAGCCCACCGGGGAAAATATGCTACTAAAAAAACTCTCCCAGGAAACACCCTCACGTAGTTCTACGAACCAATAACATGCGGAGGGGGTTGCTTGCAGAGTCAAAAAGCCCTGCGCGAATTATCTGAAAATTTGTGGCACCCCCGCATCTAATG
  5   1   2       bld Ga12      in                         XL152c13.5p                                                              GatttttctgtttngcaatctggttgctattgtctcaattaccctaacaaccattcattgatttgaacatgagactgcagtatgaattggagaaggcctgcatagaaagatgagtaataaaagtagcaatgacaataaatgtgtagccttacagagcatttgattttTAGTCAGGGTCAGTGACCCCCATTTGAAAATTGTAAAGAGTTCGAGGAAGAGGCCATAATTaaaaaaaaaaatacagaaaaaaccccagaaaaaaTGAAGGCCAATTGAAATGTTGCTTANAATTAGCCTTTCTATACAATACTAAAATATGATTTAAAGATGAATCACCTTTAAGTTAAGACCCCTCCCAAACTGCACTGCTGTACTCTTCTGTCGTTTGGAAACAGGTGGGGCACAATAGGTAGGGTCCTTGCCTAATGAAATGACATTCATATTTCCATATTCCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTAATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCT
  3   1   2       bld Bone      in                    IMAGE:8740393.3p                                                              GGTGTGCAGTGTACTGAATGCCTTTATACACTTCCCTGCAAGATCGTCTCTCGAGACATAAGAGCTGGGTTGCAGAGTGGCCAGGATTGATCGGTCGAGAGGAGCTTCGTTGCTGTTGTTCGTCTCAAGCGGCAGGGTCTGTCCCCATGTGCCTGTGGTCCCCCAGTCTAGGCAGAGAAAAGATAATTTAAAGATGAATCACCTTAAGTAAGACCCCTCCAAACTGCACTGCTGTCTCCAGTACAGTCTGTTGCTCTACTGTTCCCAGAAAAGCAGAGTAGCACAGCAGGGGTTGAGGGTGTAGGCAATCATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGCTGTGCTCCTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTACCTAATGAAATGACATTCATATTCCATTCATATTTCCATTTTCCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTTATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTTTTTTGTTAAAGGCTGTATTAGTGATTTGGGCTTGTCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAACGGGCGAG
  5   1   2       bld Eye1      out                   IMAGE:6948374.5p                                                                   ATTCTCCAGAATAGGAGCATTTGATTTTTACATTGGCTCAATGACCCCCATTTGAAAATTGTAAAGAGTTAGAGGAAGAGGCCATAATCcaaaaaatacagaaaaataacccagaaaaaaTGAAGGCCAATTCAAATGTTGCTTAGAATTCACCATTCTATACAATACTAAAATATGATTTAAAGATAATTCACCTTTAAGTTAAGACCCCTCCCAAACGTCACTGCTGTCTCCAGTACAGTCCTGTTTGCTCTACCTGTTCCCAAATAGCAGAGTAGCACAGCAGGGGTTGAGGGTGTAGGCAATCATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGCTGTATTCCTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTACCTAATGAAATgacattcatattccattcatatttccatttttctttttaatgggatattttacacacatttATTTACATGCTTGGTTCATAAACCAGTTTATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACCGAATGGGGGGGACTCCTTTCCCAGTCTTGAGATACACTGGGAATATAAGGGGAAAGCGATTTAGAAAGATTTTTTAACAAAATCTTTTAATGGTGGAGGTTTATTTGGCTGATCCCAAATTATAAAATATTGCCCCAAAATCTGGTTAAGGAACCCGCTCCCGGGGGGAATTGAACAAATTAACCTTCCGGGGAAAACTTGGCAATTTGGGAATAAAAAGGGGTGtttttttttGTTAAAAAACCGGCGCCCAAAAGGAATTTGGGGCGCTTGGTCCCCGGCAT
  3   1   2       bld Tail                            IMAGE:8543060.3p                                                                     ATGCCAATTGAACAAATAAAATGTGTTAGCCTTAACAGAGCATTGATTTAAGTCAAGTTCAGTGAACCCCCATTGGAAATGTAAAGAGTAGAGAGAGCATATAAAAAAAAATCAGAAAAAAACAGAAAAATGAGTCCATTGAAATGTGCTTAGAATTTAGCCTTTCTATACAATACTAAAAGATAATTTAAAGATGAATCACTTTAAGTTAAGACCCCTCCCAAACTGCACTGCTGTCTGCAGTACAGTCGTGTTTGCTCTACCTGTTCCCAAATAGCAGAGTAGCACAGCAGGGGTTGAGGGTGTAGGCAATCATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGCTGTGCTCCTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTACCTACTGAAATTACATTCATATTTCCATATTCTTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTTATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGTGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATCTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCTTGCCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTGACAACCCGCTTTGTAACCAAATTATAACGCCG
  3   1   2       bld Ga15      out                      XL439j05ex.3p                                                                                                                                 AAAGAGTTAGAGGAAGAGGCCATAATCAAAAAAATACAGAAAAATAACCCAGAAAAAATGAAGGCCAATTCAAATGTTGCTTAGAATTCGCCATTCTATACAATACTAAAATATGATTTAAAGATAATTCACCTTTAAGTTAAGACCCCTCCCAAACGTCACTGCTGTCTCCAGTACAGTCCTGTTTGCTCTACCTGTTCCCAAATAGCAGAGTAGCACAGCAGGGGTTGAGGGTGTAGGCAATTATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGCTGTATTCCTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTACCTAATGAAATGACATTCATATTCCATTCATATTTCCATTTTTCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTTATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGAATGGGGGACTCCTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGCGATTAGAAAGATTTATAACAAATCTTTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAAGGATCCGTCCTGTGTATTGACAAATAACGTCAGGTAACTTGTAATTGGTATATAAGGGTGTTTTTTGTTAAAGACTGTACTAGTGATTTGGGCTTGTCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTGACAACACGCTT
  5   1   2       bld Brn3                            IMAGE:8537990.5p                                                                                                                                         ATAAATNNNNCCACATCTGCGNNGNAGAGCCNTCGATATGAATTCGTCCCTGAAGGCCAATTCAAATGTTGCTTAGAATTCACCATTCTATACAATACTAAAATATGATTTAAAGATAATTCACCTTTAAGTTAAGACCCCTCCCAAACGTCACTGCTGTCTCCAGTACAGTCCTGTTTGCTCTACCTGTTCCCAGGTAGCAGAGTAGCACAGCAGGGGTTGAGGGTGTAGGCAATCATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAGCCCCTGCTGTGTTCCTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTACCTAATGAAATGACAttcatattccattcatatttccatttttctttttaatgggatattttacacacatttatttACATGCTTGGTTCATAAACCAGTTTATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGAATGGGGGACTCCTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGCGATTAGAAAGATTTATAACAAATCTTTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAAGGATCCGTCCTGTGTATTGACAAATAACGTCAGGTAACTTGTAATTGGTATATAAGGGTGTTTTTTGTTAAAGACTGTACTAGT
  3   1   2       bld Ga15 5g3  out                      XL489n16ex.3p                                                                                                                                                             AATTTAAAAAAAAAAATCCAGAAAAAACCCCAGAAAAAATGAAGGCCAATTGAAATGTTGCTTAGAATTAGCCTTTCTATACAATACTAAAATATGATTTAAAGATGAATCACCTTTAAGTTAAGACCCCTCCCAAACTGCACTGCTGTCTCCAGTACAGTCCTGTTTGCTCTACCTGTTCCCAAGTAGCAGAGTAGTACAGCAGGGGTTGAGGGTGTAGGCAATCATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGCTGTGCTCTTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTGCCTAATGAAATGACATTCATATTTCCATATTCCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTAATATACAGGTCCTTTCCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAAATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTATTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCTTGCCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTGACAGCACGCTT
  3   1   2       bld Ga18 5g3  out                      xlk53d19ex.3p                                                                                                                                                                                           CCCNNAAAAATGAAGGCCAATTGAANTNTNCTTNNANTNAGCCTTTCTATNNAATNCTAAAATATGATTTAAAGATGANTCACCTTTAAGTTAAGNCCCCTCCCAAACTNNACTGCTGTCTCCAGTACAGTCCTGTTTGCTCTACCTGTTCCCGGGTAGCAGGGTAGTACAGCAGGGGTTGAGGGTGTAGGCAATCATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTNNTGTGCTCTTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTGCCTAATGAAATGACATTCATATTTCCATATTCCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAANCCAGTTAATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAAATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTATTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCNTCCCTGCATTTCTGGTACATTTCATTTCTTGTAGNNNNAGGGCACATGTAATTTATGTTG
  3   1   2       bld DMZ                                 rxl315k20.3p                                                                                                                                                                                                                               TCTATACAATACTAAAATATGATTTAAAGATAATTCACCTTTAAGTTAAGACCCCTCCCAAACGTCACTGCTGTCTCCAGTACAGTCCTGTTTGCTCTACCTGTTCCCAAATAGCAGAGTAGCACAGCAGGGGTTGAGGGTGTAGGCAATCATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGCTGTATTCCTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTACCTAATGAAATGACATTCATATTCCATTCATATTTCCATTTTTCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTTATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGAATGGGGGACTCCTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGCGATTAGAAAGATTTATAACAAATCTTTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAAGGATCCGTCCTGTGTATTGACAAATAACGTCAGGTAACTTGTAATC
  3   1   2       bld DMZ       out                        xl261h23.3p                                                                                                                                                                                                                                              AATATGATTTAAAGATAATTCACCTTTAAGTTAAGACCCCTCCCAAACGTCACTGCTGTCTCCAGTACAGTCCTGTTTGCTCTACCTGTTCCCAAATAGCAGAGTAGCACAGCAGGGGTTGAGGGTGTAGGCAATCATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGCTGTATTCCTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTACCTAATGAAATGACATTCATATTCCATTCATATTTCCATTTTTCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTTATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGAATGGGGGACTCCTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGCGATTAGAAAGATTTATAACAAATCTTTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAAGGATCCGTCCTGTGTATTGACAAATAACGTCAGGTAACTTGTAATTGGTATATAAGGGTGTTTTTTGTTAAAGACTGTACTAGTGATTTGGGCTTGTCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACCATGTAATTTATGTG
  3   1   2       bld Neu7      out                        XL013g24.3p                                                                                                                                                                                                                                                  TGATTTAAAGATAATTCACNTTTAAGTTAAGACCCCTCCCAAACGTCACTGCTGTCTCCAGTACAGTCCTGTTTGCTCTACCTGTTCCCAAATAGCAGAGTAGCACAGCAGGGGTTGAGGGTGTAGGCAATTATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGCTGTATTCCTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTACCTAATGAAATGACATTCATATTCCATTCATATTTCCATTTTTCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTTATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGAATGGGGGACTCCTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGCGATTAGAAAGATTTATAACAAATCTTTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATANGCACAAAATCTGTTAAGGATCCGTCCTGTGTATTGACAAATAACGTCAGGTAACTTGTAATTGGTATATAAGGGTGTTTTCTTGTTAAAGACTGTACTAGTGATTTGGGCTGGTCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTNACAACACGCTTTAGACCAAAATAAATAT
  3   1   2       bld Tbd7      out                        XL107m16.3p                                                                                                                                                                                                                                                                      TTTAAGTTAAGACCCCTCCCAAACGTCACTGCTGTCTCCAGTACAGTCCTGTTTGCTCTACCTGTTCCCAAATAGCAGAGTAGCACAGCAGGGGTTAAGGGTGTAGGCAATTATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGCTGTACTCCTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTACCTAATGAAATGACATTCATATTCCATTCATATTTCCATTTTTCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTTATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGAATGGGGGACTCCTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGCGATTAGAAAGATTTATAACAAATCTTTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAAGGATCCGTCCTGTGTATTGACAAATAACGTCAGGTAACTTGTAATTGGTATATAAGGGTGTTTTTTGTTAAAGACTGTACTAGTGATTTGGGCTTGTCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTGACAACACGCTTT
  5  -1   2       bld Bone      in                    IMAGE:8740393.5p                                                                                                                                                                                                                                                                                                   CAAAGGAGTTCCTTGGGGTACTTTAGGATCCTTCGAGTGAGCCTCAGCCGGCTTCCCGAGCACGTCGTGTGTTTACGTCCCCGAAACGAGTGCACCACGGTTGAGGTTGGCCATCCTTTAGAAGCTTTGTTTCAGGTGGGCCACACCCTGCGTGGCTCCTGTGGTGGAACAGGTAGGCAAATAGTAGGTCCTACCTATGATGACATCATTCCATCATATTTCCATTTCCTTTTATGGGATATTTTACACCACATTTATTTACATGCTGTCATAAACCAGTTTATTATACAGGTCCTTTTCACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTTTTTTGTTAAAGGCTGTATTAGTGATTTGGGCTTGTCCTGCATTTTTGGTACATTTCATTTCTTGTAGAGGCCCAAACGGCACATGTAATTTATGTTGACAGCACGCTTTGTAACCAAAATAAATATTGATTGTTCTGTaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGCGG
  3   1   2       bld Neu7      out                        XL047m14.3p                                                                                                                                                                                                                                                                                                      GTCTCCAGTACAGTCCTGTTTGCTCTACCTGTTCCCAGGTAGCAGAGTAGCACAGCAGGGGTTGAGGGTGTAGGCAATCATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCCTGCTGTGTTCCTCTGTCGTTTGGAAACAGGTGGGGCACAATAGGTAGGGTCCTTACCTAATGAAATGACATTCATATTCCATTCATATTTCCATTTTTCCTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTTATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGAATGGGGGACTCCTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGCGATTAGAAAGATTTATAACAAATCTTTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAAGGATCCGTCCTGTGTATTGACAAATAACGTCAGGTAACTTGTAATTGGTATATAAGGGTGTTTTTTGTTAAAGACTGTACTAGTGATTTGGGCTTGTCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTGACAACACGCTTTAGACCAAAATAAATAT
  3   1   2       bld Ov1       out                   IMAGE:8328515.3p                                                                                                                                                                                                                                                                                                                                      GTTCCAAGTTGCAGAGTAGCACAGCAGGGGTTGAGGGTGTAGGCCATCATTTGAAGAGATGATTGAGTGATGCAAGATGGAGCCAACAACACATGCTGTATTCCTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCTTTACCTAATGAAATGACATTCATATTCCATTCATATTTCCATTTTTCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTTATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGAATGGGGGACTCCTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGCGATTAGAAAGATTTATAACAAATCTTTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAAGGATCCGTCCTGTGTATTGACAAATAACGTCAGGTAACTTGTAATTGGTATATAAGGGTGTTTTTTGTTAAAGACTGTACTAGTGATTTGGGCTTGTCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTTGACAACACGCTTTGTGACCAAAATAAATATTGATTGTTCTGTAAAAAAAAAAAAAAAAAG
  5   1   2      seed Ga15      in                       XL463d23ex.5p                                                                                                                                                                                                                                                                                                                                                         GCAGAGTAGTACAGCAGGGGTTGAGGGTGTAGGCAATCATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGCTGTACTCTTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTGCCTAATGAAATGACATTCATATTTCCATATTCCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTAATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAAATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTATTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCTTGCCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTTGACAGCACGCTTTGTAACCAAAATAAATATTGATTGTTCTGTAA
  3   1   2       bld Ga15                               XL463d15ex.3p                                                                                                                                                                                                                                                                                                                                                         GCAGAGTAGTACAGCAGGGGTTGAGGGTGTAGGCAATCATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGCTGTACTCTTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTGCCTAATGAAATGACATTCATATTTCCATATTCCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTAATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAAATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTATTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCTTGCCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTGACAGCACGCTT
  3   1   2       bld Ga15      in                       XL463d23ex.3p                                                                                                                                                                                                                                                                                                                                                         GCAGAGTAGTACAGCAGGGGTTGAGGGTGTAGGCAATCATTTGAAGAGAAGATTGAGTGATGCAAGATGGAGCCAACAACCCCTGCTGTACTCTTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTGCCTAATGAAATGACATTCATATTTCCATATTCCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTAATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAAATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTATTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCTTGCCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTGACAGCACGCTT
  3   1   2       bld Ga12                                 XL220j10.3p                                                                                                                                                                                                                                                                                                                                                                                            CATTTGAAGGAGAAGATTGAGTGATGCAAGATGGAGCCANCAACCCCTGCTGTGCTCTTNCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTGCCTAATGAAATGACATTCATATTTCCATATTCCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTAATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAAATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCTTGCCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTTGACAGCACGCTTT
  3   1   2       bld Egg2                            IMAGE:5278745.3p                                                                                                                                                                                                                                                                                                                                                                                                               TTTAAGTTAAGACCCCTCCCAAACTGCACTGCTGTACTCTTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTGCCTAATGAAATGACATTCATATTTCCATATTCCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTAATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAAATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCTTGCCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTTGACAGCACGCTTTGTAACCAA
  3   1   2       bld Neu7                                 XL010a15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCTTCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTGCCTAATGAAATGACATTCATATTTCCATATTCCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTAATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAAATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCTTGCCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTGACAGCACGNCTTGTAACCAAAATAAATAT
  3   1   2       bld Ga12      out                        XL206n01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTGTCGTTTGGAAACAGGTAGGGCACAATAGGTAGGGTCCTTGCCTAATGAAATGACATTCATATTTCCATATTCCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTAATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAAATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCTTGCCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTTGACAGCACGCTTGTAACCAAAATAAATAT
  5   1   2       bld Ov1                             IMAGE:5048577.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACAATAGGTAGGGTCCTTACCTCTGAAATTAcattcatattccattcatatttccatttttctttttaatgggatattttacacacatttatttACATGCTTGGTTCATAAACCAGTTTATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGAATGGGGGACTCGTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGCGATTAGAAAGATTTATAACAAATCTTTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTTTTTTGTTAAAGACTGTACTAGTGATTTGGGCTTGTCCTGCATTTCTGGTACATTTCATTTCTTGTA
  5   1   2       bld Ov1                             IMAGE:5048576.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACAATAGGTAGGGTCCTTACCTCTGAAATTAcattctattccattcatatttccatttttctttttaatgggatattttaccctttatttACATGCTTGGTCTAAACCAGTTTATATACAGGTCCTTTTCAACTTAGNGCCTCCANGTTTTGCTTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGAATGGGGGACTCGTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGCGATTAGAAAGATTTATAACAAATCTTTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTTTTTTGTTAAAGACTGTACTAGTGATTTGGGCTTGTCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGT
  3   1   2       bld Ga12      in                         XL152c13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGGGCACAATAGGTAGGGTCCTTGCCTAATGAAATGACATTCATATTTCCATATTCCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTAATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTNTATTATCTACTTACACAATTAGAATATTNTGATTAATGCNNACAGGATGAGGGACTCGTTTCCCAGTCTTGAAATACACTGGAATATAAGGGAAGCGNATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACANAATCTGTTAATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGNCTGNACTAGTGATTTGGGCTTGCCCTGCATTTNTGGCACATTTCATTTACTTGTATAGGCCCAAAGGGCACATGTAATTTATGTGACAGCACGCTTTGAACCAAAATAAAAA
  3   1   2       bld Ooc2                            IMAGE:3746013.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAGGTAGGGTCCTTGCCTAATGAAATGACATTCATATTTCCATATTCCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTAATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAAATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTATTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCTTGCCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCCAAGGGCACATGTAATTTATGTTGACAGCACGCTTTGTAACCAAAATAAATATTGATTGTTCTGTAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ov1       out                   IMAGE:5048826.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATGAAATGACATTCATATTCCATTCATATTTCCATTTTTCTTTTTAATGGGATATTTTACACACATTTATTTACATGCTTGGTTCATAAACCAGTTTATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGAATGGGGGACTCCTTTCCCAGTCTTGAGATACACTGGAATATAAGGGAAGCGATTAGAAAGATTTATAACAAATCTTTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAAGGATCCGTCCTGTGTATTGACAAATAACGTCAGGTAACTTGTAATTGGTATATAAGGGTGTTTTTTGTTAAAGACTGTACTAGTGATTTGGGCTGGTCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTTGACAACACGCTTTATGACCAAAATAAATATGGATTGTTCTGTAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Ooc2 5g3  out                   IMAGE:3747049.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAACCAGTTAATATACAGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAAATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTATTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCTTGCCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTTGACAGCACGCTTTGTAACCAAAATAAATATTGATTGTTCTGTAAAAAAAAAAA
  3   1   2       bld Egg3 5g3  out                   IMAGE:3378106.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGTCCTTTTCAACTTAGGCCTCCAGTTTTGCTTTCTGTAATAATATAAACTGTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAAATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCTTGCCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTTGACAGCACGCTTTGTAACCAAAATAAATATTGATTGTTTTAAAAAAAAAAAA
  3   1   2       bld Ga15      out                      XL454p03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTAATAATATAAACTATTCTATTATCTACTTACACAATTAGAATATTCTGATTAANNCAAACAGAANGGGGGGACTCCTTTCCCAGTCTNGAGATACACNGGAATATAAGGGNAAGCCGATTAGAAAGATTTATAACAAATCTTTAANGTNGAGGTTTATTTGCCNGATCAGAATTATAAATANNCACAAAATC
  3   1   2       bld Tbd5      out                   IMAGE:3580401.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAATTAGAATATTCTGATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAAATACACTGGAATATAAGGGAAGCGAATAGAAAGATTTATAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCTTGCCCTGCATTTCTGGTACATTTCATTTCTTGTAGAGGCCCAAAGGGCACATGTAATTTATGTTGACAGCACGCTTTGTAACCAAAATAAATATTGATTGTTCTGTAAA
  3   1   2       bld Tbd7                                 XL063h07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTAATGCAAACAGGATGAGGGACTCGTTTCCCAGTCTTGAAATACACTGGAATATAAGGGAAGCGAATAGAAAGAAAANANAACAAATCGGTAATGTTGAGTTTATTTGCTGATCAGAATTATAAATATGCACAAAATCTGTTAATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTAACTTGTAATTGGTATATAAGGGTGTGTTTTTGTTAAAGGCTGTACTAGTGATTTGGGCTTGCCCTGCATTTCTGGTACATTTCATTTCAAAAGAGGCCCAAAGGGCACATGTAATTTATGTGACAGCAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)