Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL202o08.3                            2 END     1           4       50                (no blast hit)

 This cluster: approximate FL confidence score = 83%

 1012770942 Xl3.1-XL423c12ex.3 - 21 ESTs
                                                                       ........-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL423c12ex.3                                                                                                                                                     TGATGATACGGTTGTGATTGTAGCACAAAGGGCGCTCACTGTATACTATATGGCTGCTTCATATTTATGTGCGCAGAACTGCCGGTGGCTCGGCCTTTCCAGATTAGTCAGGACAAGTAAGCAAAGAAGCTTTATAGCCCTTAACATGCATACCACAGGAGCAACAATGCAAGTACATCAGGAAGACTTTGAAAAAGCACAAAGTAATCTGAAGTTATTGAAGAATGATCCCGGCAATGAAGTAAAACTGAAACTGTATGCATTGTTTAAGCAGGCTACACAGGGACCTTGTAACGTATCTAAACCAGGTATGTTGGACTTTGTTAATAAAGTGAAATGGGACGCCTGGAATTCTTTAGGAAGTTTGTCAAAGGATGACGCAAGACAGTCCTATGTGGAACTTGTTTCCAGTTTGGTGTCTTCTGAATCTCCCACCAAAAATAATACAGAGCCAAGTATAGGCCATAAGATGTATGAAACTATTCAGGTTTCCTGTGAGGACCGTATTACCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTAAGATGTATGAGGAAATTGGAAAAGCGTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGATTTAAACAATTTTACCAACATCCCACCAGAAGGGAAAGAAAAGATGGCAAATGATAGTGCAGACTTGTTAGAGGCATTTGTTAGTAAATTCATTGATTTTCCAAAGCCTCTAGTTGCCGTTGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGATCTTGTGTATGCAACTGATCGTGCCACATTCCACACTCCATTCAGCCAGCTGGGACAGAGTCCAGAAGGTTGTTCTTCTTACACCTTTCCTAGAATGATGGGTTTAGGAAAAGCCACAGAGATGCTTCTTTTCAACAAGAAGTTGACAGCACATGAAGCTTGCAATTTAGGACTGGTAACTGAAGTTTTCCCTGACAGTTCTTTCCAAAAAGAAGTATGGGAAAGGCTTAAGGAATATGGTACCCTGCCTAAAAATTCACTGGCCTTCTCCAAGCAGCTAATTCGTGTCAATGAAAAGGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAATAGAGCTAAATTGTGAATGAATTTGAAATGTAATGGTCTATTTAATGCAAAGCTGTTATATGCATTTTATTAAAACAGGTTCATGTTTTTCAACTGATACAGTGTTTGAACTGATGCTAACCCTGTCACATCTGGTAGCCATGCACAAATTTTTCTCAGTGAGCATGTATTTTACAAGATTTGTACCAAGCATATCAGAATATACCACTCATTAAATTAGTCTTT
                                                  Xl3.1-CHK-1012689714                                                                                                                                                           TACGGTTGTGATTGTAGCACAAAGGGCGCTCACTGTATACTATATGGCTGCTTCATATTTATGTGCGCAGAACTGCCGGTGGCTCGGCCTTTCCAGATTAGTCAGGACAAGTAAGCAAAGAAGCTTTATAGCCCTTAACATGCATACCACAGGAGCAACAATGCAAGTACATCAGGAAGACTTTGAAAAAGCACAAAGTAATCTGAAGTTATTGAAGAATGATCCCGGCAATGAAGTAAAACTGAAACTGTATGCATTGTTTAAGCAGGCTACACAGGGACCTTGTAACGTATCTAAACCAGGTATGTTGGACTTTGTTAATAAAGTGAAATGGGACGCCTGGAATTCTTTAGGAAGTTTGTCAAAGGATGACGCAAGACAGTCCTATGTGGAACTTGTTTCCAGTTTGGTGTCTTCTGAATCTCCCACCAAAAATAATACAGAGCCAAGTATAGGCCATAAGATGTATGAAACTATTCAGGTTTCCTGTGAGGACCGTATTACCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTAAGATGTATGAGGAAATTGGAAAAGCGTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGATTTAAACAATTTTACCAACATCCCACCAGAAGGGAAAGAAAAGATGGCAAATGATAGTGCAGACTTGTTAGAGGCATTTGTTAGTAAATTCATTGATTTTCCAAAGCCTCTAGTTGCCGTTGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGATCTTGTGTATGCAACTGATCGTGCCACATTCCACACTCCATTCAGCCAGCTGGGACAGAGTCCAGAAGGTTGTTCTTCTTACACCTTTCCTAGAATGATGGGTTTAGGAAAAGCCACAGAGATGCTTCTTTTCAACAAGAAGTTGACAGCACATGAAGCTTGCAATTTAGGACTGGTAACTGAAGTTTTCCCTGACAGTTCTTTCCAAAAAGAAGTATGGGAAAGGCTTAAGGAATATGGTACCCTGCCTAAAAATTCACTGGCCTTCTCCAAGCAGCTAATTCGTGTCAATGAAAAGGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAATAGAGCTAAATTGTGAATGAATTTGAAATGTAATGGTCTATTTAATGCAAAGCTGTTATATGCATTTTATTAAAACAGGTTCATGTTTTTCAACTGATACAGTGTTTGAACTGATGCTAACCCTGTCACATCTGGTAGCCATGCACAAATTTTTCTCAGTGAGCATGTATTTTACAAGATTTGTACCAAGCATATCAGAATATACCACTCATTAAATTAGTCTTTATCAAC
                                                      consensus depths                                                                                                                                                          2     2     3     4     3     4     4     4     4     4     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     9    10     9    10     9    10     9    10     9    11    10    12    11    13    11    13    11    13    11    13    13    15    13    15    14    15    14    15    14    15    13    15    12    14    11    13    11    13    11    12    10    11    10    11    10    11    10    11     9    10     9    10    10    11    11    11    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    11    12    10    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     8     8     8     8     9     9     9     9     9     9     9     9     8     8     7     8     7     8     7     8     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG      41     292                                                                                                                                                     
                                               BLH MIN     128     142                                                                                                                                                     
  5   1   2       bld Ov1  5g                         IMAGE:6318566.5p TACGCGGAAGTCAAGCAACCTCTCCGAATCCAGAACACATGGCAGGGGTCTGACCAATCAGAGTGAGTGTTACAGCTGACGGGAACGTGTTCCTCTTCCAGTTATATCCATTCTTCCTGAGCTTGTGAGCGCCGCTCTCTTGTGGCTCTGATGATACGGTTGTGATTGTAGCACAAAGGGCGCTCACTGTATACTATATGGCTGCTTCATATTTATGTGCGCAGAACTGCCGGTGGCTCGGCCTTTCCAGATTAGTCAGGACAAGTAAGCAAAGAAGCTTTATAGCCCTTAACATGCATACCACAGGAGCAACAATGCAAGTACATCAGGAAGACTTTGAAAAAGCACAAAGTAATCTGAAGTTATTGAAGAATGATCCCGGCAATGAAGTAAAACTGAAACTGTATGCATTGTTTAAGCAGGCTACACAGGGACCTTGTAACGTATCTAAACCAGGTATGTTGGACTTTGTTAATAAAGTGAAATGGGACGCCTGGAATTCTTTAGGAAGTTTGTCAAAGGATGACGCAAGACAGTCCTATGTGGAACTTGTTTCCAGTTTGGTGTCTTCTGAATCTCCCACCCAAAATAATACAGAGCCAAGTATAGGGCCATAAAAATGTATGAAAACTATTCAAGGTTTTCCTGGTGGAAGGACCGGTATTTACCACAaaatattttcctaaaatcggtccctgaaaaagaaaagaaaagcctatttacctctttaaaaatgggaatgaagggaaattctggaaaaaaagacgtttgggaaaaaaacctgggcccaaagaaagGAACTCCCGGGTCTTTTTGGCTGGGCACTTATCCTGGGGCGGGTTAGGCCCGACTTAACTCTTCCGGGCGCAGCGGGGCCAAAGGAGATTTTTAAACAAACTTCTTTTACGCAAACAATTCTCCCCACCCTATAAAAGTGGCAAAAGAGAATAC
  5   1   2       bld Ga15 5g3  in                       XL423c12ex.5p                                                                                                                                                     TGATGATACGGTTGTGATTGTAGCACAAAGGGCGCTCACTGTATACTATATGGCTGCTTCATATTTATGTGCGCAGAACTGCCGGTGGCTCGGCCTTTCCAGATTAGTCAGGACAAGTAAGCAAAGAAGCTTTATAGCCCTTAACATGCATACCACAGGAGCAACAATGCAAGTACATCAGGAAGACTTTGAAAAAGCACAAAGTAATCTGAAGTTATTGAAGAATGATCCCGGCAATGAAGTAAAACTGAAACTGTATGCATTGTTTAAGCAGGCTACACAGGGACCTTGTAACGTATCTAAACCAGGTATGTTGGACTTTGTTAATAAAGTGAAATGGGACGCCTGGAATTCTTTAGGAAGTTTGTCAAAGGATGACGCAAGACAGTCCTATGTGGAACTTGTTTCCAGTTTGGTGTCTTCTGAATCTCCCACCAAAAATAATACAGAGCCAAGTATAGGCCATAAGATGTATGAAACTATTCAGGTTTCCTGTGAGGACCGTATTACCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTAAGATGTATGAGGAAATTGGAAAAGCGTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGATTTAAACAATTTTACCAACATCCCACCANAAGGGAAAGAAAAGATGGCAAATGATAGT
  5   1   2       bld Eye1 5g                         IMAGE:7019897.5p                                                                                                                                                                GGCTGGACCGGTCCGGATTCCCGGGATCTGTATACTATATGGCTGCTTCATATTTATGTGCGCAGAACTGCCGGTGGCTCGGCCTTTCCAGATTAGTCAGGACAAGTAAGCAAAGAAGCTTTATAGCCCTTAACATGCATACCACAGGAGCAACAATGCAAGTACATCAGGAAGACTTTGAAAAAGCACAAAGTAATCTGAAGTTATTGAAGAATGATCCCGGCAATGAAGTAAAACTGAAACTGTATGCATTGTTTAAGCAGGCTACACAGGGACCTTGTAACGTATCTAAACCAGGTATGTTGGACTTTGTTAATAAAGTGAAATGGGACGCCTGGAATTCTTTAGGAAGTTTGTCAAAGGATGACGCAAGACAGTCCTATGTGGAACTTGTTTCCAGTTTGGTGTCTTCTGAATCTCCCACCAAAAATAATACAGAGCCAAGTATAGGCCATAAGATGTATGAAACTATTCAGGTTTCCTGTGAGGACCGTATTACCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTAAGATGTATGAGGAAATTGGAAAAGCGTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGATTTAAACAATTTTACCAACATCCCACCAGAAGGGAAAGAAAAGATGGCAAATGATAGTGCAGACTTGTTAGAGGCATTTGTTAGTAAATTCATTGATTTTCCAAAGCCTCTAGTTGCCGTTGTAAATGGGGCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGATCTTGTGTATGCAACTGATCGTGCCACATTTCCAACTCCATTCAGCCAGCTGGGGACGAAGTCCAGAAGGTTGT
  5   1   2       bld Ov1  5g3  in                    IMAGE:8328068.5p                                                                                                                                                                 TGTGATTGTAGCACAAAGGGCGCTCACTGTATACTATATGGCTGCTTCATATTTATGTGCGCAGAACTGCCGGTGGCTCGGCCTTTCCAGATTAGTCAGGACAAGTAAGCAAAGAAGCTTTATAGCCCTTAACATGCATACCACAGGAGCAACAATGCAAGTACATCAGGAAGACTTTGAAAAAGCACAAAGTAATCTGAAGTTATTGAAGAATGATCCCGGCAATGAAGTAAAACTGAAACTGTATGCATTGTTTAAGCAGGCTACACAGGGACCTTGTAACGTATCTAAACCAGGTATGTTGGACTTTGTTAATAAAGTGAAATGGGACGCCTGGAATTCTTTAGGAAGTTTGTCAAAGGATGACGCAAGACAGTCCTATGTGGAACTTGTTTCCAGTTTGGTGTCTTCTGAATCTCCCACCAAAAATAATACAGAGCCAAGTATAGGCCATAAGATGTATGAAACTATTCAGGTTTCCTGTGAGGACCGTATTACCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTAAGATGTATGAGGAAATTGGAAAAGCGTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGATAATGTTNNNNNNNTTTTNCCNACNTCCCNCCAAAAGGGAAA
  5   1   2       bld DMZ       in                         xl261k20.5p                                                                                                                                                                                                        GGCTGCTTCATATTTATGTGCGCAGAACTGCCGGTGGCTCGGCCTTTCCAGATTAGTCAGGACAAGTAAGCAAAGAAGCTTTATAGCCCTTAACATGCATACCACAGGAGCAACAATGCAAGTACATCAGGAAGACTTTGAAAAAGCACAAAGTAATCTGAAGTTATTGAAGAATGATCCCGGCAATGAAGTAAAACTGAAACTGTATGCATTGTTTAAGCAGGCTACACAGGGACCTTGTAACGTATCTAAACCAGGTATGTTGGACTTTGTTAATAAAGTGAAATGGGACGCCTGGAATTCTTTAGGAAGTTTGTCAAAGGATGACGCAAGACAGTCCTATGTGGAACTTGTTTCCAGTTTGGTGTCTTCTGAATCTCCCACCAAAAATAATACAGAGCCAAGTATAGGCCATAAGATGTATGAAACTATTCAGGTTTCCTGTGAGGACCGTATTACCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTAAGATGTATGAGGAAATTGGAAAAGCGTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGATTTAAACAATTTTACCAACATCCCACCAGAAGGGAAAGAAAAGATGGCAAATGATAGTGCAGACTTGTTAGAGGCATTTGTTAGTAAATTCATTGATTTTC
  5   1   2       bld Ga12      in                         XL147b19.5p                                                                                                                                                                                                                                                             GCAAAAGGACAAGTAAGCAAAGAAGCTTTATAGCCCTTAACATGCATACCACAGGAGCAACAATGCAAGTACATCAGGAAGACTTTGAAAAAGCACAAAGTAATCTGAAGTTATTGAAGAATGATCCCGGCAATGAAGTAAAACTGAAACTGTATGCATTGTTTAAGCAGGCTACACAGGGACCTTGTAACGTATCTAAACCAGGTATGTTGGACTTTGTTAATAAAGTGAAATGGGACGCCTGGAATTCTTTAGGAAGTTTGTCAAAGGATGACGCAAGACAGTCCTATGTGGAACTTGTTTCCAGTTTGGTGTCTTCTGAATCTCCCACCAAAAATAATACAGAGCCAAGTATAGGCCATAAGATGTATGAAACTATTCAGGTTTCCTGTGAGGACCGTATTACCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTAAGATGTATGAGGAAATTGGAAAAGCGTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGATTTAAACAATTTTACCAAC
  5   1   2       bld Kid                             IMAGE:7008255.5p                                                                                                                                                                                                                                                                                                                                                 NTCCGAAAGCACAAAGTAATCTGAAGTTATTGAAGAATGATCCCGGCAATGAAGTAAAACTGAAACTGTATGCATTGTTTAAGCAGGCTACACAGGGACCTTGTAACGTATCTAAACCAGGTATGTTGGACTTTGTTAATAAAGTGAAATGGGACGCCTGGAATTCTTTAGGAAGTTTGTCAAAGGATGACGCAAGACAGTCCTATGTGGAACTTGTTTCCAGTTTGGTGTCTTCTGAATCTCCCACCAAAAATAATACAGAGCCAAGTATAGGCCATAAGATGTATGAAACTATTCAGGTTTCCTGTGAGGACCGTATTACCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTAAGATGTATGAGGAAATTGGAAAAGCGTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGATTTAAACAATTTTACCAACATCCCACCAGAAGGGAAAGAAAAGATGGCAAATGATAGTGCAGACTTGTTAGAGGCATTTGTTAGTAAATTCATTGATTTTCCAAAGCCTCTAGTTGCCGTTGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGATCTTGTGTATGCAACTGATCGTGCCACATTCCACACTCCATTCAGCCAGCTGGGACAGAGTCCAGAAGGTGTTCTTCTTACACCTTTCTAGATGATAGGTTTAG
  5   1   2       bld He1       in                    IMAGE:4409243.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAATTCTTTAGGAAGTTTGTCAAAGGATGACGCAAGACAGTCCTATGTGGAACTTGTTTCCAGTTTGGTGTCTTCTGAATCTCCCACCAAAAATAATACAGAGCCAAGTATAGGCCATAAGATGTATGAAACTATTCAGGTTTCCTGTGAGGACCGTATTACCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTAAGATGTATGAGGAAATTGGAAAAGCGTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGATTTAAACAATTTTACCAACATCCCACCAGAAGGGAAAGAAAAGATGGCAAATGATAGTGCAGACTTGTTAGAGGCATTTGTTAGTAAATTCATTGATTTTCCAAAGCCTCTAGTTGCCGTTGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGATCTTGTGTATGCAACTGATCGTGCCACATTCCACACTCCATTCAGCCAGCTGGGACAGAGTCCAGAAGGTTGTTCTTCTTACACC
  5   1   2       bld Ga12      in                         XL150g05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGTTTGTCAAANGATGACGCAAGACAGTCCTATGTGGAACTTGTTTCCAGTTTGGTGTCTTCTGAATCTCCCACCAAAAATAATACAGAGCCAAGTATAGGCCATAAGATGTATGAAACTATTCAGGTTTCCTGTGAGGACCGTATTACCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTAAGATGTATGAGGAAATTGGAAAAGCGTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGAT
  5   1   2       bld Ga12                                 XL143e05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGATGTATGAAACTATTCAGGTTTCCTGTGAGGACCGTATTACCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTAAGATGTATGAGGAAATTGGAAAAGCGTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGATTTAAACAATTTTACCAACATCCCACCAGAAGGGAAAGAAAAGATGGCAAATGATAGTGCAGACTTGTTAGAGGCATTTGTTAGTAAATTCATTGATTTTCCAAAGCCTCTAGTTGCCGTTGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGATCTTGTGTATGCAACTGATCGTGCCACATTCCACACTCCATTCAGCCAGCTGGGACAGAGTCCAGAAGGTTGTTCTTCTTACACCTTTCCTAGAATGATGGGTTTAGGAAAAGCCACAGAGATGCTTCTTTTCAACAAGAAGTTGACAGCACATGAAGCTTGCAATTTAGGACTGGTAACTGAAGTTTTCCCTGACAGTTCTTTCCAAAAAGAAGTATGGGAAAGGCTTAAGGAATATGGTACCCTGCCTAAAAATTCACTGGCCTTCTCCAA
  3   1   2       bld Ga15 5g3  in                       XL423c12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTACCAAAATATTTCTAAATCGTCCCAGAAAAGAAAAATGCTATTACTCTTAAGATGTATGAGGAAATTGGAAAAGCGTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGATTTAAACAATTTTACCAACATCCCACCAGAAGGGAAAGAAAAGATGGCAAATGATAGTGCAGACTTGTTAGAGGCATTTGTTAGTAAATTCATTGATTTTCCAAAGCCTCTAGTTGCCGTTGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGATCTTGTGTATGCAACTGATCGTGCCACATTCCACACTCCATTCAGCCAGCTGGGACAGAGTCCAGAAGGTTGTTCTTCTTACACCTTTCCTAGAATGATGGGTTTAGGAAAAGCCACAGAGATGCTTCTTTTCAACAAGAAGTTGACAGCACATGAAGCTTGCAATTTAGGACTGGTAACTGAAGTTTTCCCTGACAGTTCTTTCCAAAAAGAAGTATGGGAAAGGCTTAAGGAATATGGTACCCTGCCTAAAAATTCACTGGCCTTCTCCAAGCAGCTAATTCGTGTCAATGAAAAGGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAATAGAGCTAAATTGTGAATGAATTTGAAATGTAATGGTCTATTTAATGCAAAGCTGTTATAT
  3   1   2       bld Ga15                               XL416g18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAATCGTCCAGAAAAGAAAAATGCTATTTACTCTTAAGATGTATGGAGGAAATTGGAAAAGCGTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGATTTAAACAATTTTACCAACATCCCACCAGAAGGGAAAGAAAAGATGGCAAATGATAGTGCAGACTTGTTAGAGGCATTTGTTAGTAAATTCATTGATTTTCCAAAGCCTTTAGTTGCCGTTGTAAATGGGCCAGCAACTGGNATCTCTGTGACTATATTAGGATTATTTGATCTTGTGTATGCANCTGATCGTGCCACATTCCACACTCCATTCAGCCAGCTGGGNCAGAGTCCAGAAGGTTGTTCTTCTTACACCTTTCCTAGAATGATGGGTTTAGGAAAAGCCACAGAGATGCTTCTTTTCAACAAGAAGTTGACAGCACATGAAGCTTGCAATTTAGGACTGGTAACTGAAGTTTTCCCTGACAGTTCTTTCCAAAAAGAAGTATGGGAAAGGCTTAAGGAATATGGTACCCTGCCTAAAAATTCACTGGCCTTCTCCAAGCAGNTAATTCGTGTCAATGAAAAGGAAAAACTTCATGCNGTAAATATTCAAGAGTGTGAACNCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAATAGAGCTAAATTGTGAATGAATTTGAACATGTAAATGGTCTATTTAATGCAAAGCTGT
  3   1   2      seed DMZ       in                         xl261k20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAAAAGAAAAATGCTATTACTCTTAAGATGTATGAGGAAATTGGAAAAGCGTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGATTTAAACAATTTTACCAACATCCCACCAGAAGGGAAAGAAAAGATGGCAAATGATAGTGCAGACTTGTTAGAGGCATTTGTTAGTAAATTCATTGATTTTCCAAAGCCTCTAGTTGCCGTTGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGATCTTGTGTATGCAACTGATCGTGCCACATTCCACACTCCATTCAGCCAGCTGGGACAGAGTCCAGAAGGTTGTTCTTCTTACACCTTTCCTAGAATGATGGGTTTAGGAAAAGCCACAGAGATGCTTCTTTTCAACAAGAAGTTGACAGCACATGAAGCTTGCAATTTAGGACTGGTAACTGAAGTTTTCCCTGACAGTTCTTTCCAAAAAGAAGTATGGGAAAGGCTTAAGGAATATGGTACCCTGCCTAAAAATTCACTGGCCTTCTCCAAGCAGCTAATTCGTGTCAATGAAAAGGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAATAGAGCTAAATTGTGAATGAATTTGAAATGTAATGGTCTATTTAATGCAAAGCTGTTATATGC
  5   1   2       bld Emb4                   IMAGE:4959708-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGATTTAAACAATTTTACCAACATCCCACCAGAAGGGAAAGAAAAGATGGCAAATGATAGTGCAGACTTGTTAGAGGCATTTGTTAGTAAATTCATTGATTTTCCAAAGCCTCTAGTTGCCGTTGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGATCTTGTGTATGCAACTGATCGTGCCACATTCCACACTCCATTCAGCCAGCTGGGACAGAGTCCAGAAGGTTGTTCTTCTTACACCTTTCCTAGAATGATGGGTTTAGGAAAAGCCACAGAGATGCTTCTTTTCAACAAGAAGTTGACAGCACATGAAGCTTGCAATTTAGGACTGGTAACTGAAGTTTTCCCTGACAGTTCTTTCCAAAAAGAAGTATGGGAAAGGCTTAAGGAATATGGTACCCTGCCTAAAAATTCACTGGCCTTCTCCAAGCAGCTAATTCGTGTCAATGAAAAGGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAATAGAGCTAAATTGTGAATGAATTTGAAATGTAATGGTCTAATTAATGCAAAGCTGTTATATGCATT
  5   1   2       bld Emb4      in                    IMAGE:4959708.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGATTTAAACAATTTTACCAACATCCCACCAGAAGGGAAAGAAAAGATGGCAAATGATAGTGCAGACTTGTTAGAGGCATTTGTTAGTAAATTCATTGATTTTCCAAAGCCTCTAGTTGCCGTTGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGATCTTGTGTATGCAACTGATCGTGCCACATTCCACACTCCATTCAGCCAGCTGGGACAGAGTCCAGAAGGTTGTTCTTCTTACACCTTTCCTAGAATGATGGGTTTAGGAAAAGCCACAGAGATGCTTCTTTTCAACAAGAAGTTGACAGCACATGAAGCTTGCAATTTAGGACTGGTAACTGAAGTTTTCCCTGACAGTTCTTTCCAAAAAGAAGTATGGGAAAGGCTTAAGGAATATGGTACCCTGCCTAAAAATTCACTGGCCTTCTCCAAGCAGCTAATTCGTGTCAATGAAAAGGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAA
  3   1   2       bld Ga12      in                         XL147b19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTTGCCGTTGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGATCTTGTGTATGCAACTGATCGTGCCACATTCCACACTCCATTCAGCCAGCTGGGACAGAGTCCAGAAGGTTGTTCTTCTTACACCTTTCCTAGAATGATGGGTTTAGGAAAAGCCACAGAGATGCTTCTTTTCAACAAGAAGTTGACAGCACATGAAGCTTGCAATTTAGGACTGGTAACTGAAGTTTTCCCTGACAGTTCTTTCCAAAAAGAAGTATGGGAAAGGCTTAAGGAATATGGTACCCTGCCTAAAAATTCACTGGCCTTCTCCAAGCAGCTAATTCGTGTCAATGAAAAGGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAATAGAGCTAAATTG
  3   1   2       bld He1       in                    IMAGE:4409243.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGATCTTGTGTATGCAACTGATCGTGCCACATTCCACACTCCATTCAGCCAGCTGGGACAGAGTCCAGAAGGTTGTTCTTCTTACACCTTTCCTAGAATGATGGGTTTAGGAAAAGCCACAGAGATGCTTCTTTTCAACAAGAAGTTGACAGCACATGAAGCTTGCAATTTAGGACTGGTAACTGAAGTTTTCCCTGACAGTTCTTTCCAAAAAGAAGTATGGGAAAGGCTTAAGGAATATGGTACCCTGCCTAAAAATTCACTGGCCTTCTCCAAGCAGCTAATTCGTGTCAATGAAAAGGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAATAGAGCTAAATTGTGAATGAATTTGAAATGTAATGGTCTATTTAATGCAAAGCTGTTATATGCATTTTATTAAAACAGGTTCATGTTTTTCAACTGAAA
  5   1   2       bld Ga12      out                        XL202o08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGGATCTCTGTGACTATATTAGGATTATTTGATCTTGTGTATGCAACTGATCGTGCCACATTCCACACTCCATTCAGCCAGCTGGGACAGAGTCCAGAAGGTTGTTCTTCTTACACCTTTCCTAGAATGATGGGTTTAGGAAAAGCCACAGAGATGCTTCTTTTCAACAAGAAGTTGACAGCACATGAAGCTTGCAATTTAGGACTGGTAACTGAAGTTTTCCCTGACAGTTCTTTCCAAAAAGAAGTATGGGAAAGGCTTAAGGAATATGGTACCCTGCCTAAAAATTCACTGGCCTTCTCCAAGCAGCTAATTCGTGTCAATGAAAAGGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAATAGAGCTAAATTGTGAATGAATTTGAAATGTAATGGTCTATTTAATGCAAAGCTGTTATATGCATTTTATTAAAACAGGTTCATGTTTTTCAACTGATACAGTGTTTGAACTGATGCTAACCCTGTCACATCTGGTAGCCATGCACAAATTTTTCTCAGTGAGCATGTATT
  3   1   2       bld Ga12      in                         XL150g05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCTGTGACTATATTAGGATTATTTGATCTTGTGTATGCAACTGATCGTGCCACATTCCACACTCCATTCAGCCAGCTGGGACAGAGTCCAGAAGGTTGTTCTTCTTACACCTTTCCTAGAATGATGGGTTTAGGAAAAGCCACAGAGATGCTTCTTTTCAACAAGAAGTTGACAGCACATGAAGCTTGCAATTTAGGACTGGTAACTGAAGTTTTCCCTGACAGTTCTTTCCAAAAAGAAGTATGGGAAAGGCTTAAGGAATATGGTACCCTGCCTAAAAATTCACTGGCCTTCTCCAAGCAGCTAATTCGTGTCAATGAAAAGGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAATAGAGCTAAATTGTGAATGAATTTGAAATGTAATGGTCTATTTAATGCAAAGCTGTTATATGCATTTTATTAAAACAGGTTCATGTTTTTCAACTGATACAGTGTTTGAACTGATGCTAACCCTGTCACATCTGGTAGCCATGCACAAATTTTTCTCAGTGAGCATGTATTTTACAAGATTTGTACCAAGCATATCAGAATATACCACTCATTAAATTAGTCTTTATCAACCT
  3   1   2       bld Ov1  5g3  in                    IMAGE:8328068.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAATAGAGCTAAATTGTGAATGAATTTGAAATGTAATGGTCTATTTAATGCAAAGCTGTTATATGCATTTTATTAAAACAGGTTCATGTTTTTCAACTGATACAGTGTTTGAACTGATGCTAACCCTGTCACATCTGGTAGCCATGCACAAATTTTTCTCAGTGAGCATGTATTTTACAAGATTTGTACCAAGCATATCAGAATATACCACTCATTAAATTAGTCTTTATCAACCTTTATGTGCCTAGGCCAAACATATTTATAGTCAACAACCAGACCTCCCCATTTGTAAAATCACTTTGAAATGACATTTAGCTGTATAGTTTTTTGTAAATAGTATCATTATACTTCTATATATTGCATCCACTGGAATACAGTAGCTGACACTTGACACTGATAAAATGTGCGAAGAAGTAGTAGTAGCTACTGGCATGTGTTTTGTTTTGTCAGCAAATCTCACATTTCAGGCTGGCCTTGCAGATAAATGATAAACTGAGAACACTCTCAGACATTTAAAGAGGTTGAAGGAAGTTGAACATTTGGGATTTCTTCCTCGTTTAAAGCTTCAAGAAGATCATGTAAAATCAAAATAGAACATATACCTAAGTACACACACATCTCTTAAATAAATGCTTTGTGATCAAAAAAAAAAAAAAAG
  3   1   0       add Emb4      in                    IMAGE:4959708.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTGTAAATAGTACCATTATACTTCTATATATTGCATCCACTGGAATACAGTAGCTGACACTTGACACTGATAAAATGTGCAAAGAAGTAGTAGTAGCAGCTACTGGCATGTGTTAGAGACATGGTATTTGTTTTGTCAGCAAATCTCACATTTCAGGCTGGCCTTGCAAATAAATGATAAACTGAGAATGCTCTCAGACATTTAAAGAGGTTGAAGGAAGTTGAACATTTGGGATTTCTTCCTCGTTTAAAGCTTCAAGAAGATCATGTAAAATAAAAATAGAACATATACCTAAGTACACACACATCTCTTAAATTAATGCTTTGTTGATCAAGAGCTGTACTGACTTTTTTTCTGACTTTTCATTACGTTTGGCAGTTGTCTTCTAAAGCCATTAGTGTTACACTTATGGTAGAACCTAATCACTAATACTGTCAATCATAGAAGAACTTGTGAGGCAAAACCCATATTCTTTCTCTGTTCCCCTTTATGGGGACCTATCACCTTAAGAAATAATTTCAAATCCTATTTTATGATGTTAGTCAAATAAAATAAACTTCACTTGCACTATAAAATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)