Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012770963 Xl3.1-xlk140f15ex.3 - 32 ESTs
                                                                       -170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk140f15ex.3                                                                                                                                                                           CAAGAGCCACGCTCTAGTACACCGGGTGTTAGCGGAATGCCCGGTGACCAAGGCGCGGGCGTGTGAGTTACAGATGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTAGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATTCGCTGGTTGGATCGATGTATTGCCGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGCAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGGCTTTGCTATTGGTGGCCTGAGCGGAGGAGAAGAGAAAGATCACTTCTGGAGGATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGGTACGCTACTGACCTTGTGGTATGTGTAGCTCTGGGCTGTGATATGTTCGACTGCGTTTTCCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTGCAGCTAAAGAGCAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACTTGTCAAAGGTACAGCCGGTCCTATATCAATGCCTTGTTTAAAAGTGACACTGCTGCTATGCACCACATTACAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTCTGTGAGGGAGAGTATCCTGCAGGGTCGTTTCCCCCAGTTTGTGCAGGACTTTATGAAAACCATGTATGGCAGCAAAGACAAGTATCCCCAATGGGCTGTGGCTGCTCTGGAGACAGTCGGCATCACCCTGCAGTGACGTCTGTACTTTACTCTGGCCACTGAGGAATAAGGAGCAAAACATGAAATCTGCCTCTTTATATTGTAGACTTCACACTGAACGGAGACTCTGCGCCAGACACAATAGCCCTCAATGGGCTTATAACTTATTGGCAAAAATCTTGTGTTCATAGTTCCGTTTTTATGAATTACCTCTTATTTTTTTTTTTTAAACTTTTAAATAAAAGGCCAAGTTTTTAACAA
                                                  Xl3.1-CHK-1012687826                                                                                                                                                                                 CCACGCTCTAGTACACCGGGTGTTAGCGGAATGCCCGGTGACCAAGGCGCGGGCGTGTGAGTTACAGATGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTAGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATTCGCTGGTTGGATCGATGTATTGCCGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGCAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGGCTTTGCTATTGGTGGCCTGAGCGGAGGAGAAGAGAAAGATCACTTCTGGAGGATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGGTACGCTACTGACCTTGTGGTATGTGTAGCTCTGGGCTGTGATATGTTCGACTGCGTTTTCCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTGCAGCTAAAGAGCAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACTTGTCAAAGGTACAGCCGGTCCTATATCAATGCCTTGTTTAAAAGTGACACTGCTGCTATGCACCACATTACAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTCTGTGAGGGAGAGTATCCTGCAGGGTCGTTTCCCCCAGTTTGTGCAGGACTTTATGAAAACCATGTATGGCAGCAAAGACAAGTATCCCCAATGGGCTGTGGCTGCTCTGGAGACAGTCGGCATCACCCTGCAGTGACGTCTGTACTTTACTCTGGCCACTGAGGAATAAGGAGCAAAACATGAAATCTGCCTCTTTATATTGTAGACTTCACACTGAACGGAGACTCTGCGCCAGACACAATAGCCCTCAATGGGCTTATAACTTATTGGCAAAAATCTTGTGTTCATAGTTCCGTTTTTATGAATTACCTCTTATTTTTTTTTTTTAAACTTTTAAATAAAAGGCCAAGTTTTTAACAAAAAAAA
                                                      consensus depths                                                                                                                                                                                8     8    10    11    11    13    11    13    12    13    13    14    13    15    13    15    13    15    13    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    16    16    16    16    16    16    16    17    17    18    16    18    16    18    17    18    17    18    17    18    17    18    17    19    19    19    18    19    17    19    18    19    18    19    18    19    17    19    18    19    18    19    18    19    17    19    18    20    15    20    18    20    20    22    16    22    20    24    17    20    15    19    15    20    15    19    13    17    12    17    10    15    11    15    10    15    11    14    11    14    12    15    12    15    13    16    12    14    12    14    12    14    12    14    12    14    12    14    13    15    13    14    12    14    13    14    13    13    14    14    12    14    11    16    13    16    15    16    15    17    15    17    15    17    14    15    14    15    14    15    14    15    14    15    14    15    14    15    13    15    14    15    11    14    12    14    12    14    13    13    13    13    13    13    13    13    13    13    11    13    13    13    10    13    10    13    10    13     9    12     9    12     7    10     5     6     2     3     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------T-
                                                                                                                                                                                                                                                                 PROTEIN --- Gg ---- 3e-021     NP_001025952.1 queuine tRNA-ribosyltransferase domain containing 1 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 7e-117     NP_502268.1 TRNA Guanine Transglycosylase TGT-1 (tgt-1) [Caenorhabditis elegans] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Sp ==== 2e-119     XP_784456.2 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                              PROTEIN --- Os ---- 2e-128     NP_001063434.1 Os09g0469900 [Oryza sativa (japonica cultivar-group)] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- ?? ---- 1e-131     XP_629936.1 queuine tRNA-ribosyltransferase [Dictyostelium discoideum AX4] -----------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN === Ag ==== 7e-138     XP_313382.2 ENSANGP00000011864 [Anopheles gambiae str. PEST] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN --- Dm ---- 4e-139     NP_608585.1 CG4947-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                    PROTEIN --- Mm ---- 4e-171     NP_068688.2 queuine tRNA-ribosyltransferase 1 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                    PROTEIN --- Hs ---- 2e-173     NP_112486.1 tRNA-guanine transglycosylase [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PREDICTED = Cf ==== 1e-177     XP_868118.1 PREDICTED: similar to queuine tRNA-ribosyltransferase 1 (tRNA-guanine transglycosylase) isoform 2 [Canis familiaris] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PROTEIN --- Dr ---- 0          NP_957304.1 similar to queuine tRNA-ribosyltransferase 1 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN --- Xt ---= 0          CAJ81982.1 queuine tRNA-ribosyltransferase 1 (tRNA-guanine transglycosylase) [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PREDICTED - Xl ==== 0          NP_001089529.1 hypothetical protein LOC734584 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xl3.1-xlk140f15ex.3                                                                                                                                                                                                                                                    ATG------------------------------ATG---------------------ATG------------------------------------------------------------------------ATG------------------ATG---------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------ATG------ATG---------------------------------------------------------------------TGA------------------------------TAA---------------------------------TAG---------TGA------------------------TAG------ATG------TAA---------------------------------------TGA------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2       chi Egg3                            IMAGE:6870413.5p                                                                                                                                    GTCGATTCCCGGGCCGCGTTTCGAGCTCATGGCGGCGACCAAGAGCCACGCTCTAGTACACCGGGTGTTAGCGGAATGCCCGGTGACCAAGGCGCGGGCGTGTGAGTTACAGATGCCCCATGGCCAGGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTAGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGGTTGGATCGATGTATTGCGGCCCAAGGGAAACCCCGATCGGGAAAAATCTGGTTTGGCATTAATCCAAAGGGGGGCCTGGGATGCTTAACCTGGCCCAAGCCAATGTTTTGCCCGGAAAATTACCttaacggggatggcccccggggttttggcattatggggggccccttaaccggggggaaaaaaaaaaaaaaattcctcttttgggggggggggggggACCCCTCCAAACCTTGGACCATTTTTTCCCCCGGGGGAAAAAAACCTCCTTTTACCTTTTTggggggggggggggggaaccccactagggacccttgtggggggaatgggggaacacccctgcgggggggtgggaaaatatttttcccacctggcctttttttccccccccAAAGGAGAACACCCTTTGGGTTGGCCGCCAACACCACCCCGCGGGCCCA
  5   1   2       bld Neu2                            IMAGE:2942243.5p                                                                                                                                                               GATGGCGGCGACCAAAAGCCACGCTCTAGTACACCGGGTGTTAGCGGAATGCCCGGTGACCAAGGCTCGGGCGTGTGAGTTACAGATGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTTCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTGGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATTCGCTGGTTGGATCGATGTATTGCCGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGGATGCTGACTGCGCAAGANATGTATGCAGGAGATGACTGAACGGGATGTCCCTGGCTCTGCTATTGGTGGCCTGAGCAGACGAGAAGAGAAA
  5   1   2       bld Em10                            IMAGE:7983577.5p                                                                                                                                                                    CGGCGACCAAGAGCCACGCTCTAGTACACCGGGTGTTAGCGGAATGCCCGGTGACCAAGGCGCGGGCGTGTGAGTTACAGATGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTAGGCTCTGATATCATGATGCAACTGGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATTCGCTGGTTGGATCGATGTATTGCCGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGAAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGGCTTTGCTATTGGTGGCCTGAGCGGAGGAGAAGAAAAGATCACTTCTGGAGGATGGTGACCCTCAGCACTGACCATT
  5   1   2      seed Emb4                   IMAGE:5570408-IMAGp.IMAGp                                                                                                                                                                      GCGACCAAGAGCCACGCTCTAGTACACCGGGTGTTAGCGGAATGCCCGGTGACCAAGGCGCGGGCGTGTGAGTTACAGATGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTAGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCGGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGCAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGGCTTTGCTATTGGTGGCCTGAGCGGAGGAGAAGAGAAAGATCACTTCTGGAGGATGGTGACCCTCAGCACTG
  5   1   2       bld Ov1                    IMAGE:6316037-IMAGp.IMAGp                                                                                                                                                                      GCGACCAAGAGCCACGCTCTAGTACACCGGGTGTTAGCGGAATGCCCGGTGACCAAGGCGCGGGCGTGTGAGTTACAGATGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTAGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCGGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGCAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGGCTTTGCTATTGGTGGCCTGAGCGGAGGAGAAGAGAAAGATCACTTCTGGAGGATG
  5   1   2       bld Em10      in                    IMAGE:7981590.5p                                                                                                                                                                       CGACCAAGAGCCACGCTCTAGTACACCGGGTGTTAGCGGAATGCCCGGTGACCAAGGCGCGGGCGTGTGAGTTACAGATGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTGGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATTCGCTGGTTGGATCGATGTATTGCCGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGAAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGGCTTTGCTATTGGTGGCCTGAGCGGAGGAGAAGAGAAAGATCACTTCTGGAGGATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAACC
  5   1   2       bld Ov1                             IMAGE:6316037.5p                                                                                                                                                                        GACCAAGAGCCACGCTCTAGTACACCGGGTGTTAGCGGAATGCCCGGTGACCAAGGCGCGGGCGTGTGAGTTACAGATGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTAGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCGGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGCAATGTTTGCAGGAGATGACTAAACGGGATGTCCCCTGGCTTTGCTATTGGTGGCCTGAGCGGAGGAGAAGAGAAAGATCACTTCTGGAGGATGGTGACCCTCAGCACTGACCATTTGCCTTCGGGAAAAACCTCGTTACCCTTATGGGAAGGGGGGGAACGCTACTTGACCTTGTGGGAATTGGGTAACCTCTTGGGCTGGGGATATGGTTCCCACTGGCCGTTTTTCCCCAACAAAGGAACAAGCTTAGGGTTTCGGGATCCAGCGGCTTGGGTTCCCCTTGGGGGGTTCCCCTTGCAGTCTTAAAGAAC
  5   1   2       bld DMZ       in                         xl309k11.5p                                                                                                                                                                           CAAGAGCCACGCTCTAGTACACCGGGTGTTAGCGGAATGCCCGGTGACCAAGGCGCGGGCGTGTGAGTTACAGATGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTAGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCGGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGCAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGGCTTTGCTATTGGTGGCCTGAGCGGA
  5   1   2       bld Ga18      in                      xlk139i09ex.5p                                                                                                                                                                            ACCAAGAGCCACGNTCTAGTACACCGGGTGTTAGCGGAANNNNGGTGACCAAGGCGCGNNNNGTGAGTTACAGATGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGNCGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTGGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATTCGCTGGTTGGATCGATGTATTGCCGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGAAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGGCTTTNNTATTGGTGGNCTGAGCGGAGGAGAAGAGAAAGATCACTTCTGGAGGATGGTGACCCTCAGCACTGACCATTTGCCTNGGACAAACCTC
  5   1   2       bld Ga12      in                         XL189o10.5p                                                                                                                                                                                      CTCTAGTACACCGGGTGTTAGCGGAATGCCCGGTGACCAAGGCGCGGGCGTGTGAGTTACAGATGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCTACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTGGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATTCGCTGGTTGGATCGATGTATTGCCGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGAAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGGCTTTGCTATTGGTGGCCTGAGCGGAGGA
  5   1   2       bld Emb9                            IMAGE:7977102.5p                                                                                                                                                                                      CTCTAGTACACCGGGTGTTAGCGGAATGCCCGGTGACCAAGGCGCGGGCGTGTGAGTTACAGATGCCCCATGGCCAGGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTAGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCGGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGCAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGGCTTTGCTATTGGTGGCCTGAGCGGAGGAGAAGAGAAAGATCACTTCTGGGAGATGGTGACCCTCAGCACTGGACCATTTGCCTCGGGACAAACCTCGTTACCTTTATGGGAGTGGGGTACGCTACTGACCTTGTTGG
  5   1   2       bld Ga12      in                         XL220f11.5p                                                                                                                                                                                             GAGGCGGGTGTTAGCGGAATGCCCGGTGACCAAGGCGCGGGCGTGTGAGTTACAGATGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATTCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTAGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCGGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGCAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGGCTTTGCTATTGGTGGCCTGAGCGGA
  5   1   2       bld Egg3                            IMAGE:6326699.5p                                                                                                                                                                                               GGCCCGGGTGTTATCCGATGCCCGGTGACAAGGCGCGGGCGTGTGAGTTACAGATGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAATTAGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCGGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGCAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGGCTTTGCTATTGGTGGCCCTGAGCGGGAGGAGAAGAGAAAAGATCNCTTTCTGGGAGGAATGGGTGGACCCCTTCACCACCTGAACCATTTTTGCCCCTCGGGGAAACAAACCCCTCCGTTTTACCCCTTTAAtgggggaaattgggggggTTAACCCCCTTTAACCTTGGACCCTCTTTGGGTGGGGGTTAATAC
  5   1   2       bld Egg6                            IMAGE:4435457.5p                                                                                                                                                                                                                              GGATCGGGTGTGTGAGTTACAGATGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGAAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAAGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGTGGCGGGTTTCAGATGGTTTCCCTGGAGAAGCTGTACAAGGTGACGGAACAACGGGTGCAATTCACATCTCCCTACGATGGGAAACAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTGGATGATGTATAGAGCAGCACAATCTCACGGCCCCGTGTGGAGGAAGCCATGCACAGGTCTATTCGCTGGTTGGATCTATGTATTGCCGCCTACGTGAACCCCGATCGGCAGAATCTGCTTGCCATAATCCAAGGTGGTCTGTATGCTGAACTGCTCAATAAATGTTTGCATGAGATGACTACACCGGATGTCCCTGGCTTTGCTATTGGTGGCCTGAGC
  5   1   2       bld Ga18      in                      xlk140f15ex.5p                                                                                                                                                                                                                                               TTACAGATGCCCCATGGNCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGNCGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTGGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATTCGCTGGTTGGATCGATGTATTGCCGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGAAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGGCTTTNNTATTGGTGGCCTGAGCGGAGGAGAAGAGAAAGATCACTTCTGGAGGATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGNTACCTTATGGGAGTGGGNNNNNNTACTGACCTTGTGGNATGTGTAGCTCTGGGCTGTGANATGTTCGACTGCGTTTTCCCAACAAGGNCAGCTAGGT
  5   1   2       bld DMZ       in                         xl340c14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTAGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCGGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGCAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGGCTTTGCTATTGGTGGCCTGAGCGGAGGAGAAGAGAAAGATCACTTCTGGAGGATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGGTACGCTACTGACCTTGTGGTATGTGTAGCTCTGGGCTGTGATATGTTCGACTGCGTTTTCCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTGCAGCTAAAGAGCAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACTTGTCAAAGGTACAGCCGGTCCTATATCAATGCCTTGTTTAAAGTGACACTGCTGCTATGCACCACATTACAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTCTGTGAGGGAGAGTATCCTGCAG
  3   1   2       bld Ga18      in                      xlk140f15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CANTTCAGNNCNNCCTNCGATGGGAAAGAGNNCCTNCTCACCCNANNNAAATCCATTGAAATCNAAAATGCATTGGGCTCTGATATCATGATGCAACTGGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAANCCATGCACAGNTCTATTCGCTGGTTGGATCGATGTATTGCCGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCNAGAAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGNNTTTGCTATTGGTGGCCTGAGCGGAGGAGAAGAGAAAGATCACTTCTGGAGGATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAANCCTCGTTACCTTATGGGAGTGGGGTACGCTACTGACCTTGTGGTATGTGTAGCTCTGGGCTGTGATATGTTCGNCTGCGTTTTCCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTGCAGCTAAAGAGCAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACTTGTCAAAGGTACAGCCGGTCCTATATCAATGCCTTGTTTAAAAGTGACACTGCTNCTATGCACCACATTACAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTCTGTGAGGGAGAGTATCCTGCAGGGTCGTTTCCCCCAGTTTGTGCAGGACTTTATGAAAACCATGTATGGCAGCAAAGACAAGTATCCCCAATGGGCTGTGGCTGCTCTGGAGACAGTCGGCATCACCCTGCAGTGACGTCTGTACTTTACTCTGGCCACTGAGGAATAAGGAGCAAAACATGAAATCTGCCTCTTTATATTGTAGACTTCACACTGAACGGAGACTCTGCGCCAGACACAATNNNCTCAATGGGCTTATAACTTATTGGCAAAAATCTTGTGTTCATAGTTCCGTTTTTATGAATNCCTCTTATTTNNTTTTTNA
  3   1   2       bld Ga18      in                      xlk139i09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCTACGATGGAAAGAGNNCCTGCTCNCCCCANNAGAAATCCATTGAAATCCCAAAATGCATNNGGCTCTGATATCATGATGCANCTGGATGATGTAGTGAGCAGCANAATCTCAGGNCCCCGTGTGGAGGAANNCATGCACAGGTCTATTCGCTGGTTGGATCGATGTATTGCCGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGAAATGTTTGCAGGAGATGNCTAAACGGGATGTCCCTGNCTTTGCTATTGGTGGCCTGAGCGGAGGAGAAGAGAAAGATCACTTCTGGAGGATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGGTACGCTACTGACCTTGTGGTATGTGTAGCTCTGGGCTGTGATATGTTCGNCTGCGTTTTCCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTGCAGCTAAAGAGCAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACTTGTCAAAGGTACAGCCGGTCCTATATCAATGCCTTGTTTAAAAGTGACACTGCTNCTATGCACCACATTACAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTCTGTGAGGGAGAGTATCCTGCAGGGTCGTTTCCCCCAGTTTGTGCAGGACTTTATGAAAACCATGTATGGCAGCAAAGACAAGTATCCCCAATGGGCTGTGGCTGCTCTGGAGACAGTCGGCATCACCCTGCAGTGACGTCTGTACTTTACTCTGGCCACTGAGGAATAAGGAGCAAAACATGAAATCTGCCTCTTTATATTGTAGACTTCACACTGAACGGAGACTCTGCGCCAGACACAATNNCCTCAATGGGCTTATAACTTATTGGCAAAAATCTTGTGTTCATAGTTCCGTTTTTATGAANNCCTCTTATTTTNTTTT
  5   1   2       bld Ov1                             IMAGE:5074684.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCACGCGTCCGGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATTCGCTGGTTGGATCGATGTATTGCCGCCAACGGTAACCCCGATCGGCAGAATCTGTTTGCCATAATCCAAGGTGGTCTGGATGCTGAACTGCGCAAGAAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGGCTTTGCTATTGGTGGCCTGAGCGGAGGAGAAGAGAAAGATCACTTCTGGAGGATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGGTACGCTACTGACCTTGTGGTATGTGTAGCTCTGGGCTGTGATATGTTCGACTGCGTTTTCCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTGCAGCTAAAGAGCAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACTTGTCAAAGGTACAGCCGGTCCTATATCAATGCCTTGTTTAAAAGTGACACTGCTGCTATGCACCACATTACAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTCTGTGAGGGAGAGTATCCT
  3   1   2       bld Em10      in                    IMAGE:7981590.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTGGATGCTGAACTGCGCAAGGAATGTTTGCAGGAGATGACTAAACGGGATGTCCCTGGCTTTGCTATTGGTGGCCTGAGCGGAGGAGAAGAGAAAGATCACTTCTGGAGGATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGGTACGCTACTGACCTTGTGGTATGTGTAGCTCTGGGCTGTGATATGTTCGACTGCGTTTTCCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTGCAGCTAAAGAGCAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACTTGTCAAAGGTACAGCCGGTCCTATATCAATGCCTTGTTTAAAAGTGACACTGCTGCTATGCACCACATTACAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTCTGTGAGGGAGAGTATCCTGCAGGGTCGTTTCCCCCAGTTTGTGCAGGACTTTATGAAAACCATGTATGGCAACAAAGACAAGTATCCCCAATGGGCTGTGGCTGCTCTGGAGACAGTCGGCATCACCCTGTAGTGACGTCTGTACTTTACTCTGGCCACTGAGGAATAAGGAGCAAAACATGAAATCTGCCTCTTTATATTGTAGACTTCACACTGAACGGAGACTCTGCGCCAGACACAATAGCCCTCAATGGGCTTATAACTTATTGGCAAAAATCTTGTGTTCATAGTTCCGTTTTTATGAATTACCTCTTATTTTTTTTTTTT
  3   1   2       bld DMZ       in                         xl309k11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGAGATGACTAAACGGGATGTCCCTGGCTTTGCTATTGGTGGCCTGAGCGGAGGAGAAGAGAAAGATCACTTNTGGAGGATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGGTACGCTACTGACCTTGTGGTATGTGTAGCTCTGGGCTGTGATATGTTCGACTGCGTTTTCCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTGCAGCTAAAGAGCAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACTTGTCAAAGGTACAGCCGGTCCTATATCAATGCCTTGTTTAAAAGTGACACTGCTGCTATGCACCACATTACAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTCTGTGAGGGAGAGTATCCTGCAGGGTCGTTTCCCCCAGTTTGTGCAGGACTTTATGAAAACCATGTATGGCAGCAAAGACAAGTATCCCCAATGGGCTGTGGCTGCTCTGGAGACAGTCGGCATCACCCTGCAGTGACGTCTGTACTTTACTCTGGCCACTGAGGAATAAGGAGCAAAACATGAAATCTGCCTCTTTATATTGTAGACTTCACACTGAACGGAGACTNTGCGCCAGACACAATAGCCCTCAATGGGCTTATAACTTATTGGCAAAAATCTTGTGTTCATAGTTCCGTTTTTATGAATTACCTCT
  3   1   2       bld DMZ       in                         xl340c14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTAAACGGGATGTCCCTGGCTTTGCTATTGGTGGCCTGAGCGGAGGAGAAGAGAAAGATCACTTNTGGAGGATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGGTACGCTACTGACCTTGTGGTATGTGTAGCTCTGGGCTGTGATATGTTCGACTGCGTTTTCCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTGCAGCTAAAGAGCAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACTTGTCAAAGGTACAGCCGGTCCTATATCAATGCCTTGTTTAAAAGTGACACTGCTGCTATGCACCACATTACAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTCTGTGAGGGAGAGTATCCTGCAGGGTCGTTTCCCCCAGTTTGTGCAGGACTTTATGAAAACCATGTATGGCAGCAAAGACAAGTATCCCCAATGGGCTGTGGCTGCTCTGGAGACAGTCGGCATCACCCTGCAGTGACGTCTGTACTTTACTCTGGCCACTGAGGAATAAGGAGCAAAACATGAAATCTGCCTCTTTATATTGTAGACTTCACACTGAACGGAGACTNTGCGCCAGACACAATAGCCCTCAATGGGCTTATAACTTATTGGCAAAAATCTTGTGTTCATAGTTCCGTTTTTATGAATTACCTCTT
  3   1   2       bld Ga18      in                      xlk135e15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTGNNTTTGCTATTGGTGGCCTGAGCGGAGGAGAAGAGAAAGATCACTTCTGGAGGATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGGTACGCTACTGACCTTGTGGTATGTGTAGCTCTGGGCTGTGATATGTTCGNCTGCGTTTTCCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTGCAGCTAAAGAGCAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACTTGTCAAAGGTACAGCCGGTCCTATATCAATGCCTTGTTTAAAAGTGACACTGCTNCTATGCACCACATTACAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTCTGTGAGGGAGAGTATCCTGCAGGGTCGTTTCCCCCAGTTTGTGCAGGACTTTATGAAAACCATGTATGGCAGCAAAGACAAGTATCCCCAATGGGCTGTGGCTGCTCTGGAGACAGTCGGCATCACCCTGCAGTGACGTCTGTACTTTACTCTGGCCACTGAGGAATAAGGAGCAAAACATGAAATCTGCCTCTTTATATTGTAGACTTCACACTGAACGGAGACTCTGCGCCAGACACAANNNNCTCAATGGGCTTATAACTTATTGGCAAAAATCTTGTGTTCATAGTTCCGTTTTTATGAANNCCTCTTAT
  5   1   2       bld Ga18      in                      xlk135e15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGNTNNNNNTTGGTGGNCTGAGCGGAGGAGAAGAGAAAGATCACTTCTGGAGGATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGGTACGCTACTGACCTTGTGGTATGTGTAGCTCTGGGCTGTGATATGTTCGACTGCGTTTTCCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTGCAGCTAAAGAGCAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACTTGTCAAAGGTACAGCCGGTCCTATATCAATGCCTTGTTTAAAAGTGACACTGCTGCTATNNACCACATTACAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTCTGTGAGGGAGAGTATCCTGCAGGGTCGTTTCCCCCAGTTTGTGCAGGACTTTATGAAAACCATGTATGGCAGCNAAGACAAGTATCCCCAATGGGCTGTGNNTGCTCTGGAGACAGTCGGCATCACCCTGCAGNGACGNCTGTACTTTACTCTNGNCACTGAGG
  5   1   2       bld Egg1                               PBX0101B07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACTTCTGGAGGATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGGTACGCTACTGACCTTGTGGTATGTGTAGCTCTGGGCTGTGATATGTTCGACTGCGTTTTCCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTGCAGCTAAAGAGCAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACTTGTCAAAGGTACAGCCGGTCCTATATCAATGCCTTGTTTAAAAGTGACACTGCTGCTATGCACCACATTACAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTCTGTGAGGGAGAGTATCCTGCAGGGTCGTTTCCCCCAGTTTGTGCAGGACTTTATGAAAACCATGTATGGCAACAAAGACAAGTATCCCCAATGGGCTGTGGCTGCTCTGGAGACAGTCGGCATCACCCTGCAGTGACGTCTGTACTTTACTCTGGCCACTGAGGAATAAGGAGCAAAACATGAAATCTGCCTCTTTATATTGTAGACTTCACACTGAACGGAGACTCTGCGCCAGACACAATAGCCCTCAATGGGCTTATAACTTATTGGCAAAAATCTTG
  3   1   2       bld Ga12      in                         XL189o10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGGCTGTGATATGTTCGACTGCGTTTTCCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTGCAGCTAAAGAGCAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACTTGTCAAAGGTACAGCCGGTCCTATATCAATGCCTTGTTTAAAAGTGACACTGCTGCTATGCNCCNCATTACAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTNTGTGAGGGAGAGTATCCTGCAGGGTCGTTTCCCCCAGTTTGTGCAGGACTTTATGAAAACCATGTATGGCAGCAAAGACAAGTATCCCCAATGGGCTGTGGCTGCTNTGGAGACAGTCGGCATCACCCTGCAGTGACGTCTGTACTTTACTNTGGCCACTGAGGAATAAGGAGCAAAACATGAAATNTGCCTNTTTATATTGTAGACTTCACACTGAACGGAGACTTTGCGCCAGACACAATAGCCCTCAATGGGCTTATAACTTATTGGCAAAAATCTTGTGTTCATAGTTCCGTTTTTATGAATT
  3   1   2       bld Ga12      in                         XL220f11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGTTTTCCCAACAAGGACAGCTAGGTTNGGATCAGCGNTGGTTCCCTGGGGTTCCCTGCAGCTAAAGAGCAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTNCCNCTTGTCAAAGGTACAGCCGGTCCTATATCAATGCCTTGTTTAAAAGTGACNCTGCTGNTATGCNCCNCATTNCAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTNTGTGAGGGAGAGTATCCTGCAGGGTNGTTTCCCCCAGTTTGTGCAGGACTTTATGAAAACCATGTATGGCAGCAAAGACAAGTATCCCCAATGGGCTGTGGCTGCTNTGGAGACAGTNGGCATCNCCCTGCAGTGACGTNTGTACTTTACTTTGGCCNCTGAGGAATAAGGAGCAAAACATGAAATNTGCCTNTTTATATTGTAGACTTCACACTGAACGGAGACTTTGCGCCAGACACAATAGCCCTCAATGGGCTTATAACTTATTGGCAAAAATCTTGTGTTCATAGTTCCGTTTTTATGAATTACCTCTTATTTTTTTTTTTTAAACT
  3   1   2       bld Egg5      in                    IMAGE:3430793.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATTTCCAGCCCATATGCTAGAACTGTGATTGTCCCACTTGTCAAAGGTACAGCCGGTCGTATATCAATGCCTTGTTTAAAAGTGTCACTGCTGCTATGCACCACATTGCAATGCATAACATTGCCTATCAGCTGAACCTTATGCGCTCTGTGAGGGAGAGTATCCTGCAGGGTCGTTTCCCCCAGTTTGTGCAGGACTTTATGAAAACCATGTATGGCAACAAAGACAAGTATCCCCAATGGGCTGTGGCTGCTCTGGAGACAGTCGGCATCACCC
  5   1   2       bld Egg5      in                    IMAGE:3430793.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAATGCCTTGTTTAAAAGTGACACTGCTGCTATGCACCACATTACAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTCTGTGAGGGAGAGTATCCTGCAGGGTCGTTTCCCCCAGTTTGTGCAGGACTTTATGAAAACCATGTATGGCAACAAAGACAAGTATCCCCAATGGGCTGTGGCTGCTCTGGAGACAGTCGGCATCACCCTGTAGTGACGTCTGTACTTTACTCTGGCCACTGAGGAATAAGGAGCAAAACATGAAATCTGCCTCTTTATATTGTAGACTTCACACTGAACGGAGACTCTGCGCCAGACACAATAGCCCTCAATGGGCTTATAACTTATTGGCAAAAATCTTGTGTTCATAGTTCCGTTTTTATGAATTACCTCTTAttttttttttttaaacttttaaataaaaggccaagtttttaacaaaaaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL433f11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGACACTGCTGCTATGCACCACATTACAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTCTGTGAGGGAGAGTATCCTGCAGGGTCGTTTCCCCCAGTTTGTGCAGGACTTTATGAAAACCATGTATGGCAGCAAAGACAAGTATCCCCAATGGGCTGTGGCTGCTCTGGAGACAGTCGGCATCACCCTGCAGTGACGTCTGTACTTTACTCTGGCCACTGAGGAATAAGGAGCAAAACATGAAATCTGCCTCTTTATATTGTAGACTTCACACTGAACGGAGACTCTGCGCCAGACACAATAGCCCTCAATGGGCTTATAACTTATTGGCAAAAATCTTGTGTTCATAGTTCCGTTTTTATGAATTACCTCTTAttttttttttttaaacttttaaataaaaggccaagtttttaacaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL433f11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGACNCTGCTGCTATGCNCCNCATTACAATACATAACATTGCCTATCAGCTGAACCTTATGCGCTNTGNGAGGGAGAGTATCCTGCAGGGTNGTTTCCCCCAGTTTGTGCAGGACTTTATGAAAACCATGTATGGCAGCAAAGACAAGTATCCCCAATGGGCTGTGGCTGCTNTGGAGACAGTCGGCATCNCCCTGCAGNGACGTNTGTACTTTACTNTGGCCNCTGAGGAATAAGGAGCAAAACATGAAATNTGCCTNTTTATATTGTAGACTTCACNCTGAACGGAGACTTTGCGCCAGACACAATAGCCCTCAATGGGCTTATAACTTATTGGCAAAAATCTTGNGTTCATAGTTCCGTTTTTA
  5   1   2       bld Egg1                               PBX0157B05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAACATTGCTATAGCTGAACCTTATGCGCTCTGTGAGGGAGAGATCCTGCAGGTCGTTTCCCCAGTTGTGCGGACTTTATGAAAACCATGTATGGCAACAAAGACAAGTATCCCAATGGGCTGGGCTGCTCTGGAGACAGTCGGATCACCCTGCAGTGACGTCTGTACTTTACTCTGGCCACTGAGGAATAAGGAGCAAAACATGAAATCTGCCTCTTTATATTGTAGACTTCACACTGAACGGAGACTCTGCGCCAGACACAATAGCCCTCAATGGGCTTATAACTTATTGGCAAAAATCTTGTGTTCATAGTTCCGTTTTTATGAATTACCTCTTAtttttttttttAAACTTTTAAATAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)