Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL516d11ex.5                       3366 END     2           9        0                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012770974 Xl3.1-IMAGE:5513386.5 - 22 ESTs
                                                                       .........-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5513386.5                                        ATCAGTCCAGCGCCCGAGTCCAGCCGAGGAGGGCAACAGCCAGACCCTTATGATGATGATGATGTCATTAACGGCCACTTTGGGGTTCGTGACTCTGATCACCCTGGTGGGATCCATGGAATCTCCATGTTGTTCCTGCACCGCTGGTCTGCCGGGAATTCCCGGAATCTCTGGGAAAGACGGACGAGACGGACGCAGAGGCCCCAAGGGAGAGGCAGGGCCCCCGGCATCATCATTACCCAGAAGCCTGAGAGGAGACAAAGGAGAACCGGGCCCAAGGGGACCTCTCGGAAAAAATGGGCCAAAGGGACCGACAGGACTTGAAGGAGAAAAAGGGGAGCAGGGGGAAGTGGGGGCGACCGGCAGCCCAGGGGACCATAAGCGCCAGTACCAATCGGCCTTTACAGTGGCCAGACTGACCCAAGAGCACCCCCTCAAGAACACCCCCATTCTGTTCACTAAGCAGATCACTAACGACCACCAAGACTACAATGTGACCAGTGGCAAGTTCCAGTGTCGGATCCCCGGCCACTACTTCTTCTCCTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCTCTGGGGGGGTCCTGGTGTCCCTGGCGGGGGGGCAGGAGGTCTGGATGGAGGTCAATGACTACAATGGGATGATTGGCACCGAGGGCAACGACAGCGTTTTCTCTGGGTTCCTTGTGTCTCCTCAATAGACAAGCGGGGGGCTCTTAGCTGCCCCTCATTCATTGGCACAAACCAATGGGAGAATGGGGGGGCTCTGCCAGATTCTTTGGGGTTTTTCTTCTTTTTTTACATGTTTCATTGAGATCCAACATAGGAACCCAGTAAATTGGTTACCCCTCTAGTAATGGAACCAAATCTGCCCATCGTTACCCTCCCCCCCTGGGGAAAGCAACGTCCAATCATGTAGCAGCTTTACCCCCAGCAGCCAATGATCGTGTGTCTATAACATTGTGATCCATTATATACATTATTAAAGGGCAAG
                                                  Xl3.1-CHK-1012689402                                              CCAGCGCCCGAGTCCAGCCGAGGAGGGCAACAGCCAGACCCTTATGATGATGATGATGTCATTAACGGCCACTTTGGGGTTCGTGACTCTGATCACCCTGGTGGGATCCATGGAATCTCCATGTTGTTCCTGCACCGCTGGTCTGCCGGGAATTCCCGGAATCTCTGGGAAAGACGGACGAGACGGACGCAGAGGCCCCAAGGGAGAGGCAGGGCCCCCGGCATCATCATTACCCAGAAGCCTGAGAGGAGACAAAGGAGAACCGGGCCCAAGGGGACCTCTCGGAAAAAATGGGCCAAAGGGACCGACAGGACTTGAAGGAGAAAAAGGGGAGCAGGGGGAAGTGGGGGCGACCGGCAGCCCAGGGGACCATAAGCGCCAGTACCAATCGGCCTTTACAGTGGCCAGACTGACCCAAGAGCACCCCCTCAAGAACACCCCCATTCTGTTCACTAAGCAGATCACTAACGACCACCAAGACTACAATGTGACCAGTGGCAAGTTCCAGTGTCGGATCCCCGGCCACTACTTCTTCTCCTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCTCTGGGGGGGTCCTGGTGTCCCTGGCGGGGGGGCAGGAGGTCTGGATGGAGGTCAATGACTACAATGGGATGATTGGCACCGAGGGCAACGACAGCGTTTTCTCTGGGTTCCTTGTGTCTCCTCAATAGACAAGCGGGGGGCTCTTAGCTGCCCCTCATTCATTGGCACAAACCAATGGGAGAATGGGGGGGCTCTGCCAGATTCTTTGGGGTTTTTCTTCTTTTTTTACATGTTTCATTGAGATCCAACATAGGAACCCAGTAAATTGGTTACCCCTCTAGTAATGGAACCAAATCTGCCCATCGTTACCCTCCCCCCCTGGGGAAAGCAACGTCCAATCATGTAGCAGCTTTACxxCCxxCAGCCAATxxxxGTGTGTCTATAACATTGTGATCCATTATATxxxxxATTAAAGGGCAAGTATTCC
                                                      consensus depths                                             3     3     5     6     7     9     8    10    11    11    12    12    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    13    14    13    14    13    14    13    14    13    15    13    15    13    15    14    15    13    14    13    14    13    14    13    15    12    15    12    15    14    17    15    16    16    16    17    17    17    17    17    17    17    18    19    19    18    19    18    19    17    19    17    19    15    19    15    19    15    19    14    19    11    17    11    17    11    17     9    16     7    14     7    14     7    11     7    11     7     9     7     9     5     9     5     9     8     9     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     3     7
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTCTGCCAGATTCTTTGGGGTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACATGTTTCATTGAGATCCAACATAGGAACCCAGTAAATTGGTTACCCCTCTAGTAATGGAACCAAATCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCCCCCCCTGGGGAAAGCAACGTCCAATCATGTAGCAGCTTTACCCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCAATGATCTCT
                                                                   SNP                                                                                                                                                                ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------GG
                                               BLH MIN      45      71                                        
                                               EST CLI      20       6                                        
  5   1   2       bld Sp1                    IMAGE:4174257-IMAGp.IMAGp GAGTAACTGCCCTGGTGCCACTTTCCCTTGTTTAACTGTATCAGTCCAGCGCCCGAGTCCAGCCGAGGAGGGCAACAGCCAGACCCTTATGATGATGATGATGTCATTAACGGCCACTTTGGGGTTCGTGACTCTGATCACCCTGGTGGGATCCATGGAATCTCCATGTTGTTCCTGCACCGCTGGTCTGCCGGGAATTCCCGGAATCTCTGGGAAAGACGGACGAGACGGACGCAGAGGCCCCAAGGGAGAGGCAGGGCCCCCGGCATCATCATTACCCAGAAGCCTGAGAGGAGACAAAGGAGAACCGGGCCCAAGGGGACCTCTCGGAAAAAATGGGCCAAAGGGACCGACAGGACTTGAAGGAGAAAAAGGGGAGCAGGGGGAAGTGGGGGCGACCGGCAGCCCAGGGGACCATAAGCGCCAGTACCAATCGGCCTTTACAGTGGCCAGACTGACCCAAGAGCACCCCCTCAAGAACACCCCCATTCTGTTCACTAAGCAGATCACTAACGACCACCAAGACTACAATGTGACCAGTGGCAAGTTCCAGTGTCGGATCCCCGGCCACTACTTCTTCTCCTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCTCTgggggggggtcctggtgtccctggcggggggggCCAGGAGGTCTGGATGGAGGTCAATGACTACAATGGGGATGATTGGCACCGAGGGCAACGACAGCGTTTTCTCTGGGATTCCTTGTGTCTCCTCAATAGACAAGCggggggggCTCTTAGCCTGCCCCTCATTCATTGGGCACAACCCAATGGGAGAATGGGGGGGCTCTGCCCAGATTCTTTTGGGGTTTTTCTTT
  5   1   2       bld FaB                             IMAGE:8070036.5p    TGCTGGATGTGGTTTCGGTGCGGGATTCCCGGGATTATCAGTCCAGCGCCCGAGTCCAGCCGAGGAGGGCGACAGCCGGACCCTTATGATGATGATGATGTCATTAACGGCCACTTTGGGGTTCGTGACTCTGATCACCCTGGTGGGATCCATGGAATCTCCATGTTGTTCCTGCACCGCTGGTCTGCCGGGAATTCCCGGAATCTCTGGGAAAGACGGACGAGACGGACGCAGAGGCCCCAAGGGAGAGGCAGGGCCCCCGGCATCATCATTACCCAGAAGCCTGAGAGGAGACAAAGGAGAACCGGGCCCAAGGGGACCTCTCGGAAAAAATGGGCCAAAGGGACCGACAGGACTTGAAGGAGAAAAAGGGGAGCAGGGGGAAGTGGGGGCGACCGGCAGCCCAGGGGACCATAAGCGCCAGTACCAATCGGCCTTTACAGTGGCCAGACTGACCCAAGAGCACCCCCTCAAGAACACCCCCATTCTGTTCACTAAGCAGATCACTAACGACCACCAAGACTACAATGTGACCAGTGGCAAGTTCCAGTGTCGGATCCCCGGCCACTACTTCTTCTCCTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCTCTGGGGGGGTCCTGGTGTCCCTGGCAGGGGGGCAGGANGTCTGGATGGANGTCCATGACTACAATGGGATGATTGGCAC
  5   1   2       bld FaB                             IMAGE:8071145.5p                                       TATCAGTCCAGCGCCCGAGTCCAGCCGAGGAGGGCAACAGCCAGACCCTTATGATGATGATGATGTCATTAACGGCCACTTTGGGGTTCGTGACTCTGATCACCCTGGTGGGATCCATGGAATCTCCATGTTGTTCCTGCACCGCTGGTCTGCCGGGAATTCCCGGAATCTCTGGGAAAGACGGACGAGACGGACGCAGAGGCCCCAAGGGAGAGGCAGGGCCCCCGGCATCATCATTACCCAGAAGCCTGAGAGGAGACAAAGGAGAACCGGGCCCAAGGGGACCTCTCGGAAAAAATGGGCCAAAGGGACCGACAGGACTTGAAGGAGAAAAAGGGGAGCAGGGGGAAGTGGGGGCGACCGGCAGCCCAGGGGACCATAAGCGCCAGTACCAATCGGCCTTTACAGTGGCCAGACTGACCCAAGAGCACCCCCTCAAGAACACCCCCATTCTGTTCACTAAGCAGATCACTAACGACCACCAAGACTACAATGTGACCAGTGGCAAGTTCCAGTGTCGGATCCCCGGCCACTACTTCTTCTCCTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCtctgggggggtcctggtgtccctggcgggggggCAGGANGTCTGGNNATGGAGTCATGACTACNATGGGATGATTGGGCACGAGGGCACGACAGCGTTTCTCTGGTTCCNTGTGTCTCTCATAGACAGC
  5   1   2       bld FaB                             IMAGE:8074336.5p                                              CCAGCGCCCGAGTCCAGCCGAGGAGGGCAACAGCCAGACCCTTATGATGATGATGATGTCATTAACGGCCACTTTGGGGTTCGTGACTCTGATCACCCTGGTGGGATCCATGGAATCTCCATGTTGTTCCTGCACCGCTGGTCTGCCGGGAATTCCCGGAATCTCTGGGAAAGACGGACGAGACGGACGCAGAGGCCCCAAGGGAGAGGCAGGGCCCCCGGCATCATCATTACCCAGAAGCCTGAGAGGAGACAAAGGAGAACCGGGCCCAAGGGGACCTCTCGGAAAAAATGGGCCAAAGGGACCGACAGGACTTGAAGGAGAAAAAGGGGAGCAGGGGGAAGTGGGGGCGACCGGCAGCCCAGGGGACCATAAGCGCCAGTACCAATCGGCCTTTACAGTGGCCAGACTGACCCAAGAGCACCCCCTCAAGAACACCCCCATTCTGTTCACTAAGCAGATCACTAACGACCACCAAGACTACAATGTGACCAGTGGCAAGTTCCAGTGTCGGATCCCCGGCCACTACTTCTTCTCCTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCTCTGGGGGGGTCCTGGTGTCCCTGGCGGGNGGGCAGGANGTCTGGATGGAGGTCAATGACTACAATGGGATGATTGGCACCGAGGGCAACGACAGCGTTTTCTCTGGGTTCCTGTGTCTCCTCATAGACAGCGGGGGCTCTAGCTGCTCTCATCATT
  5   1   2       bld Sp1       in                    IMAGE:4174444.5p                                               CCGAGTCCAGCCGAGGAGGGCAACAGCCAGACCCTTatgatgatgatgatgatgatgTCATTAACGGCCACTTTGGGGTTCGTGACTCTGATCACCCTGGTGGGATCCATGGAATCTCCGTGTTGTTCCTGCACCGCTGGTCTGCCGGGAATTCCCGGAATCTCTGGGAAAGACGGACGAGACGGACGCAGAGGCCCCAAGGGAGAGGCAGGGCCCCCGGCATCATCATTACCCAGAAGCCTGAGAGGAGACAAAGGAGAACCGGGCCCAAGGGGACCTCTCGGAAAAAATGGGCCAAAGGGACCGACAGGACTTGAAGGAGAAAAAGGGGAGCAGGGGGAAGTGGGGGCGACCGGCAGCCCAGGGGACCATAAGCGCCAGTACCAATCGGCCTTTACAGTGGCCAGACTGACCCAAGAGCACCCCCTCAAGAACACCCCCATTCTGTTCACTA
  5   1   2       bld Sp1                             IMAGE:5513386.5p                                                    CCCGAGTCCAGCCGAGGAGGGCAACAGCCAGACCCTTATGATGATGATGATGTCATTAACGGCCACTTTGGGGTTCGTGACTCTGATCACCCTGGTGGGATCCATGGAATCTCCATGTTGTTCCTGCACCGCTGGTCTGCCGGGAATTCCCGGAATCTCTGGGAAAGACGGACGAGACGGACGCAGAGGCCCCAAGGGAGAGGCAGGGCCCCCGGCATCATCATTACCCAGAAGCCTGAGAGGAGACAAAGGAGAACCGGGCCCAAGGGGACCTCTCGGAAAAAATGGGCCAAAGGGACCGACAGGACTTGAAGGAGAAAAAGGGGAGCAGGGGGAAGTGGGGGCGACCGGCAGCCCAGGGGACCATAAGCGCCAGTACCAATCGGCCTTTACAGTGGCCAGACTGACCCAAGAGCACCCCCTCAAGAACACCCCCATTCTGTTCACTAAGCAGATCACTAACGACCACCAAGACTACAATGTGACCAGTGGCAAGTTCCAGTGTCGGATCCCCGGCCACTACTTCTTCTCCTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCTCTGGGGGGGTCCTGGTGTCCCTGGCGGGNGGGCAGGAGGTCTGGATGGAGGTCAATGACTACTATGGGATGATTGGCACCGAGGGCAACGACAGCGTTTTCTCTGGGTTCCTTGTGTCTCCTCATAGACAAGCNGGGGGCTCCTAGCTGCCCCTA
  5   1   2       bld Lmb1                            IMAGE:8533441.5p                                                        GAGTACTAAATANATTCGTCCCGCCAGACCCTTATGATGATGATGATGTCATTAACGGCCACTTTGGGGTTCGTGACTCTGATCACCCTGGTGGGATCCATGGAATCTCCATGTTGTTCCTGCACCGCTGGTCTGCCGGGAATTCCCGGAATCTCTGGGAAAGACGGACGAGACGGACGCAGAGGCCCCAAGGGAGAGGCAGGGCCCCCGGCATCATCATTACCCAGAAGCCTGAGAGGAGACAAAGGAGAACCGGGCCCAAGGGGACCTCTCGGAAAAAATGGGCCAAAGGGACCGACAGGACTTGAAGGAGAAAAAGGGGAGCAGGGGGAAGTGGGGGCGACCGGCAGCCCAGGGGACCATAAGCGCCAGTACCAATCGGCCTTTACAGTGGCCAGACTGACCCAAGAGCACCCCCTCAAGAACACCCCCATTCTGTTCACTAAGCAGATCACTAACGACCACCAAGACTACAATGTGACCAGTGGCAAGTTCCAGTGTCGGATCCCCGGCCACTACTTCTTCTCCTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCtctgggggggtcctggtgtccctggcgggggggCAGGAGGTCTGGATGGAGGTCAATGACTACAATGGGATGATGGGCCCGAGGGGCACGACAGCGTTTTCTCTGGGTTCTTGTGTCTCCTCATAGACAAggggggggTCTAGCTGCCCTCATTCTTGGCACAACCATGGAGATGGGGGG
  5   1   2       bld FaBN                            IMAGE:8076708.5p                                                            CAGCCGAGGAGGGCAACAGCCAGACCCTTATGATGATGATGATGTCATTAACGGCCACTTTGGGGTTCGTGACTCTGATCACCCTGGTGGGATCCATGGAATCTCCGTGTTGTTCCTGCACCGCTGGTCTGCCGGGAATTCCCGGAATCTCTGGGAAAGACGGACGAGACGGACGCAGAGGCCCCAAGGGAGAGGCAGGGCCCCCGGCATCATCATTACCCAGAAGCCTGAGAGGAGACAAAGGAGAACCGGGCCCAAGGGGACCTCTCGGAAAAAATGGGCCAAAGGGACCGACAGGACTTGAAGGAGAAAAAGGGGAGCAGGGGGAAGTGGGGGCGACCGGCAGCCCAGGGGACCATAAGCGCCAGTACCAATCGGCCTTTACAGTGGCCAGACTGACCCAAGAGCACCCCCTCAAGAACACCCCCATTCTGTTCACTAAGCAGATCACTAACGACCACCAAGACTACAATGTGACCAGTGGCAAGTTCCAGTGTCGGATCCCCGGCCACTACTTCTTCTCCTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCtctgggggggtcctggtgtccctggcgggggggCAGGAGTCTGGATGGAGGTCATGACTANATGGGATGATTGGCACGAGGCAACGACAGCGTTTCTCTGGGTTCTTGTGTCTCTCATAGACAG
  5   1   2       add Sp1       in                    IMAGE:4962909.5p                                                               CCGAGGAGGGCAACAGCCAGACCCTTATGATGATGATGATGTCATTAACGGCCACTTTGGGGTTCGTGACTCTGATCACCCTGGTGGGATCCATGGAATCTCCGTGTTGTTCCTGCACCGCTGGTCTGCCGGGAATTCCCGGAATCTCTGGGAAAGACGGACGAGACGGACGCAGAGGCCCCAAGGGAGAGGCAGGGCCCCCGGCATCATCATTACCCAGAAGCCTGAGAGGAGACAAAGGAGAACCGGGCCCAAGGGGACCTCTCGGAAAAGATGGGCCAAAGGGACCGACAGGACTTGAAGGAGAAAaaggggagcaggggggaagggggggCGACCGGCAGCCCAGGGGGACATAAGCGCCAGTACCAATCGGCCTTTACAGTGGCCAGACTGACCCAAGAACACCCCCCTCAGAACCCCCCTTTCTGTTCACTAAGCAGATCACTAACGACCACCAAGACTACCATGGGACCAGTGGGCAAGTTCCAGTGTCCGATCCCCGGCCACTATTTTTTTCTC
  5   1   2      seed Sp1                             IMAGE:4965215.5p                                                                       GGCAACAGCCAGACCCTTATGATGATGATGATGTCATTAACGGCCACTTTGGGGTTCGTGACTCTGATCACCCTGGTGGGATCCATGGAATCTCCATGTTGTTCCTGCACCGCTGGTCTGCCGGGAATTCCCGGAATCTCTGGGAAAGACGGACGAGACGGACGCAGAGGCCCCAAGGGAGAGGCAGGGCCCCCGGCATCATCATTACCCAGAAGCCTGAGAGGAGACAAAGGAGAACCGGGCCCAAGGGGACCTCTCGGAAAAAATGGGCCAAAGGGACCGACAGGACTTGAAGGAGAAAAAGGGGAGCAGGGGGAAGTGGGGGCGACCGGCAGCCCAGGGGACCATAAGCGCCAGTACCAATCGGCCTTTACAGTGGCCAGACTGACCCAAGAGCACCCCCTCAAGAACACCCCCATTCTGTTCACTAAGCAGATCACTAACGACCACCAAGACTACAATGTGACCAGTGGCAAGTTCCAGTGTCGGATCCCCGGCCACTACTTCTTCTCCTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCtctgggggggtcctggtgtccctggcgggggggCAGGAGGTCTGGATGGAGGTCAATGACTACAATGGGATGATTGGCACCGAGGGCAACGACAGCGTTTTCTCTGGGTTCT
  5   1   2       bld FaB                             IMAGE:8071159.5p                                                                             CGCCAGACCCTTATGATGATGATGATGTCATTAACGGCCACTTTGGGGTTCGTGACTCTGATCACCCTGGTGGGATCCATGGAATCTCCGTGTTGTTCCTGCACCGCTGGTCTGCCGGGAATTCCCGGAATCTCTGGGAAAGACGGACGAGACGGACGCAGAGGCCCCAAGGGAGAGGCAGGGCCCCCGGCATCATCATTACCCAGAAGCCTGAGAGGAGACAAAGGAGAACCGGGCCCAAGGGGACCTCTCGGAAAAAATGGGCCAAAGGGACCGACAGGACTTGAAGGAGAAAAAGGGGAGCAGGGGGAAGTGGGGGCGACCGGCAGCCCAGGGGACCATAAGCGCCAGTACCAATCGGCCTTTACAGTGGCCAGACTGACCCAAGAGCACCCCCTCAAGAACACCCCCATTCTGTTCACTAAGCAGATCACTAACGACCACCAAGACTACAATGTGACCAGTGGCAAGTTCCAGTGTCGGATCCCCGGCCACTACTTCTTCTCCTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCtctgggggggtcctggtgtccctggcgggggggCAGGANGTCTGGATGGAGGTCAATGACTACAATGGGATGATTGGCACCGAGGGCACGACAGCGTTTTCTCTGGGTTCTTGTGTCTCCTCATAGACAGCGGGGGGCTCTTAGCTGCCCCTCATCATGGCACAAC
  5   1   2       bld Sp1                             IMAGE:5435267.5p                                                                                          TGATGATGATGATGTCATTAACGGCCACTTTGGGGTTCGTGACTCTGATCACCCTGGTGGGATCCATGGAATCTCCATGTTGTTCCTGCACCGCTGGTCTGCCGGGAATTCCCGGAATCTCTGGGAAAGACGGACGAGACGGACGCAGAGGCCCCAAGGGAGAGGCAGGGCCCCCGGCATCATCATTACCCAGAAGCCTGAGAGGAGACAAAGGAGAACCGGGCCCAAGGGGACCTCTCGGAAAAAATGGGCCAAAGGGACCGACAGGACTTGAAGGAGAAAAAGGGGAGCAGGGGGAAGTGGGGGCGACCGGCAGCCCAGGGGACCATAAGCGCCAGTACCAATCGGCCTTTACAGTGGCCAGACTGACCCAAGAGCACCCCCTCAAGAACACCCCCATTCTGTTCACTAAGCAGATCACTAACGACCACCAAGACTACAATGTGACCAGTGGCAAGTTCCAGTGTCGGATCCCCGGCCACTACTTCTTCTCCTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCtctgggggggtcctggtgtccctggcgggggggCAGGAGGTCTGGATGGAGGTCAATGACTACAATGGGATGATTGGCACCGAGGGCAACGACAGCGTTTTCTCTGGGTTCCTTGTGTCTCCTCATAGACNAGCGGGGGGCTCTTAGCTGCCCCTCATTCATTGGCACAACCAATGGAA
  5   1   2       bld FaBN                            IMAGE:8077946.5p                                                                                                          ATTAACGGCCACTTTGGGGTTCGTGACTCTGATCACCCTGGTGGGATCCATGGAATCTCCGTGTTGTTCCTGCACCGCTGGTCTGCCGGGAATTCCCGGAATCTCTGGGAAAGACGGACGAGACGGACGCAGAGGCCCCAAGGGAGAGGCAGGGCCCCCGGCATCATCATTACCCAGAAGCCTGAGAGGAGACAAAGGAGAACCGGGCCCAAGGGGACCTCTCGGAAAAAATGGGCCAAAGGGACCGACAGGACTTGAAGGAGAAAAAGGGGAGCAGGGGGAAGTGGGGGCGACCGGCAGCCCAGGGGACCATAAGCGCCAGTACCAATCGGCCTTTACAGTGGCCAGACTGACCCAAGAGCACCCCCTCAAGAACACCCCCATTCTGTTCACTAAGCAGATCACTAACGACCACCAAGACTACAATGTGACCAGTGGCAAGTTCCAGTGTCGGATCCCCGGCCACTACTTCTTCTCCTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACTGTCCAGCAGTCCCAGGTGGCCTCTGGAGGGTCCTGGTGTCCTGGCGGGGGGCAGGAGTCTGGATGGAGTCATGACTACATGGATGTTGGCCCGAGGCAACACACGTTTCTCTGGTTCTTGTTCCCTCAAAACAGCGGGGCTTTACTCCCTCTTCTTGCCAACATGGGAAGGG
  5   1   2       bld Sp1       out                   IMAGE:4964543.5p                                                                                                                                                                                        TGGTCTGCCGGGAATTCCCGGAATCTCTGGGAAAGACGGACGAGACGGACGCAGAGGCCCCAAGGGAGAGGCAGGGCCCCCGGCATCATCATTACCCAGAAGCCTGAGAGGAGACAAAGGAGAACCGGGCCCAAGGGGACCTCTCGGAAAAAATGGGCCAAAGGGACCGACAGGACTTGAAGGAGAAAAAGGGGAGCAGGGGGAAGTGGGGGCGACCGGCAGCCCAGGGGACCATAAGCGCCAGTACCAATCGGCCTTTACAGTGGCCAGACTGACCCAAGAGCACCCCCTCAAGAACACCCCCATTCTGTTCACTAAGCAGATCACTAACGACCACCAAGACTACAATGTGACCAGTGGCAAGTTCCAGTGTCGGATCCCCGGCCACTACTTCTTCTCCTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCtctgggggggtcctggtgtccctggcgggggggCAGGAGGTCTGGATGGAGGTCAATGACTACCATGGGATGATTGGC
  3   1   2       bld Sp1                             IMAGE:4174255.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCGGCCTTTACAGTGCCAGGCTGACCAAAGAGCACCCCTCAAGGACCCCCCATTTCGTTCATAAAGCAGATCACTAAGACCCACAAAGATTACAATGTGACAAGTGGCAAGTTCAAGTGCGGGATCCCGGCCCACTACTCTTCTCTTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGTTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCTCTGGGGGGGTCCTGGTGTCCCTGGCGGGGGGGCAGGAGGTCTGGATGGAGGTCAATGACTACAATGGGATGATTGGCCTCGAGGGCAATGACAGCGTTTTCTCTGGGTTCCTTGTGTCTCCTCAATAGACAAGCGGGGGGCTCTTAGCTGCCCCTCATTCATTGGCACAAACCAATGGGAGAATGGGGGGGGGGCTCTGCCAGATTCTTTGGGGTTTTTCTTCTTTTTTTACATGTTTCATTGAGATCCAACATAGGAACCCAGTAAATTGGTTACCCCTCTAGTAATGGAACCAAATCTGCCCATCGTTACCCTCCCCCCCTGGGGAAAGCAACGTCCAATCATGTAGCAGCTTTACCCCCAGCCAATGATCTCTGTGTGTCTATAACATTGTGATCCATTATATACATTAAAGGGCAAGTATTCCTAAA
  3   1   2       bld Sp1                             IMAGE:4174257.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATTGCAATGTGACTAGTGGCAAGTTCAAGTGTCGGATCCCCGGCAACTACTCTTCTCATTCCACTGGTCCCACTCGGCCAATCTCTGCGCCGCCTTCTATGTGGATGGAAAGGCCTCGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCAAGGTGGCCTCTGGGGGGGTCCTGGTGTCCCTGACGTGGGGGCAGGAGGTCTGGATGGAGGTCAATGACTACAATGGGATGATTGGCACTGAGGGCAACGACAGCGTTTTCTCTGGATTCCTTGTGTCTCCTCAATAGACAAGCGGGGGGCTCTTAGCTGCCCCTCATTCATTGGCACAAACCAATGGGAGAATGGGGGGGCTCTGCCAGATTCTTTGGGGTTTTTCTTCTTTTTTTACATGTTTCATTGAGATCCAACATAGGAACCCAGTAAATTGGTTACCCCTCTAGTAATGGAACCAAATCTGCCCATCGTTACCCTCCCCCCCTGGGGAAAGCAACTGTCCAATTCATGTAGCAGCTTNTACCCCCAGCCAATGATCTTCTNGTGTGTCTACTAACATTGTGATCCATTATATACATTAAAGGGCAAGTATTCCTATCC
  5   1   2       bld Sp1       in                    IMAGE:4963573.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATCCCCGGTCACTACTTCTTCTCCTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCtctgggggggtcctggtgtccctggcgggggggCAGGAGGTCTGGATGGAGGTCAATGACTACAATGGGATGATTGGCACCGAGGGCAACGACAGCGTTTTCTCTGGGTTCCTTGTGTCTCCTCAATATACAAGCGGGGGGCTCTTAGCTGCCCCTCATTCATTGGCACAAACCAATGGGAGAATGGGGGGGCTCTGCCAGATTCTTTGGGGtttttcttctttttttACATGTTTCATTGAGATCCAACATAGGAACCCAGTAAATTGGTTACCCCTCTAGTAATGGAACCAAATCTGCCCATCGTTACCCTCCCCCCCTGGGGAAAGCAACGTCCAATCATGTAGCAGCTTTACCCCCAGCCAATGATCTCTGTGTGTCTATAACATTGTGATCCATTATATACATTAAA
  3   1   2       bld Sp1  5x3  out                   IMAGE:4964542.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCNCCGGCCACTACTTCTTCTCCTTCCACTCGTCCCACTCGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCTCTGGGGGGGTCCTGGTGTCCCTGGCGGGGGGGCAGGAGGTCTGGATGGAGGTCAATGACTACAATGGGATGATTGGCACCGAGGGCAACGACAGCGTTTTCTCTGGGTTCCTTGTGTCTCCTCAATAGACAAGCGGGGGGCTCTTAGCTGCCCCTCATTCATTGGCACAAACCAATGGGAGAATGGGGGGGGGGCTCTGCCAGATTCTTTGGGGTTTTTCTTCTTTTTTTACATGTTTCATTGAGATCCAACATAGGAACCCAGTAAATTGGTTACCCCTCTAGTAATGGAACCAAATCTGCCCCTCGTTACCCTCCCCCCCTGGGGAAAGCAACGTCCAATCATGTAGCAGCTTTACCCCCAGCCAATGATCTCTGTGTGTCTATAACATTGTGATCCATTATATACATTAAAGGGCAAGTATTCCTAA
  3   1   2       bld Sp1       in                    IMAGE:4963573.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCCACTGGGCCAATCTCTGCGCCGCCCTCTATGTGGATGGAAAGGCCACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCTCTGGGGGGGTCCTGGTGTCCCTGGCGGGGGGGCAGGAGGTCTGGATGGAGGTCAATGACTACAATGGGATGATTGGCACCGAGGGCAACGACAGCGTTTTCTCTGGGTTCCTTGTGTCTCCTCAATAGACAAGCGGGGGGCTCTTAGCTGCCCCTCATTCATTGGCACAAACCAATGGGAGAATGGGGGGGCTCTGCCAGATTCTTTGGGGTTTTTCTTCTTTTTTTACATGTTTCATTGAGATCCAACATAGGAACCCAGTAAATTGGTTACCCCTCTAGTAATGGAACCAAATCTGCCCATCGTTACCCTCCCCCCCTGGGGAAAGCAACGTCCAATCATGTAGCAGCTTTACCCCCAGCCAATGATCTCTGTGTGTCTATAACATTGTGATCCATTATATACATTAAAGGGCAAGTATTCCTATCCTGA
  5   1   2       bld Sp1                             IMAGE:5512855.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACGAGCAGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCtctgggggggtcctggtgtccctggcgggggggCAGGAGGTCTGGATGGAGGTCAATGACTACAATGGGATGATTGGCACCGAGGGCAACGACAGCGTTTTCTCTGGGTTCCTTGTGTCTCCTCAATAGACAAGCGGGGGGCTCTTAGCTGCCCCTCATTCATTGGCACAAACCAATGGGAGAATggggggggggctctgccagattctttggggtttttcttctttttttACATGTTTCATTGAGATCCAACATAGGAACCCAGTAAATTGGTTACCCCTCTAGTAATGGAACCAAATCTGCCCCTCGTTACCCTCCCCCCCTGGGGAAAGCAACGTCCAATCATGTAGCAGCTTTACCCCCAGCCAATGATCTCTGTGTGTCTATAACATTGTGATCCATTATATACATTAAAGGGCAAGTATTCCTaaaaaaaaaaaaaaaaGG
  3   1   2       bld Sp1       in                    IMAGE:4962909.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCTTCTGTGACCACATGTCCAGCAAGTCCCAGGTGGCCTCTGGGGGGGTCCTGGTGTCCCTGGCGGGGGGGCAGGAGGTCTGGATGGAGGTCAATGACTACAATGGGATGATTGGCACCGAGGGCAATGACAGCGTTTTCTCTGGGTTCCTTGTGTCTCCTCAATAGACAAGCGGGGGGCTCTTAGCTGCCCCTCATTCACTGGCACAAACCAATGGGAGAATGGGGGGGCTCTGCCAGATTCTTTGGGGTTTTTCTTCTTTTTTTACATGTTTCATTGAGATCCAACATAGGAACCCAGTAAATTGGTTACCCCTCTAGTAATGGAACCAAATCTGCCCCTCGTTACCCTCCCCCCCTGGGGAAAGCAACGTCCAATCATGTAGCAGCTTTACCCCCAGCCAATGATCTCTGTGTGTCTATAACATTGTGATCCATTATATACATTAAAGGGCAAGTATTCCTATCCTGAAAAAAAAAA
  3   1   2       bld Sp1       in                    IMAGE:4174444.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCATTCATTGGCACAAACCAATGGGAGAATGGGGGGGGGGCTCTGCCAGATTCTTTGGGGTTTTTCTTCTTTTTTTACATGTTTCATTGAGATCCAACATAGGAACCCAGTAAATTGGTTACCCCTCTAGTAATGGAACCAAATCTGCCCATCGTTACCCTCCCCCCCTGGGGAAAGCAACGTCCAATCATGTAGCAGCTTTACCCCCAGCCAATGATCTCTGTGTGTCTATAACATTGTGATCCATTATATACATTAAAGGGCAAGTATTCCTATA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)