Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6956437.3                      13 END     7          43       53                Kruppel-like factor 2a [Danio rerio]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6861928.5.5                    19 PI      92          1     1152                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012771020 Xl3.1-IMAGE:6956437.5 - 16 ESTs
                                                                       .-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6956437.5                                                                                                      AGACTACTGCTCCTGCTGCTTCTGGAGTTCTATAGTCGGGCTCCCTGCTTGTAAGTCACCTGCAAGCCTGGTGCTGCTTCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTACAACCAGTGGAAGACAAGCAGCTTGGCATGGTATCGGTCATGGCAATGGAGGAGCTGAGGCCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGCAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGCACGCCGGTAGGACATGGTGGCGCCTACCCATTGCCCGAGACCCCTGAGAGCTGTAGTACCACCTATGATAGCGATGGATCCTACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTAAAGGCCGGCATGCACAGCAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCCATCGGAGCACCTACAGCACCTGAGCCATAGAATTAAAAAGGAGCGACCTGAGCAGTCGTGCATGCTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATCATGGAGCAGAAGGCTGGCATCATGCAAATGCACGGCCAACTCCTTCCCAATCCTGCCTATTCTCAGCACAGGCTCAGCCCCCCAGTACCCACAGAGGATATGCCCCCCAATGACTGCCACATGATCCCTGACATGCACTGCCTGTCCCTTATGTCAATGGCACAGCATTACCCAATGGCAAGCCCCTACCAAACTCATTTTACCAGCCAGCCCAACGTGCAGTTTCATGGACAATTTGGAGTTTACAGAGACCCCATGAAGGTTCACCCATCTATGCATGGAATGATTGTCACCCCTCCCTCCTCCCCCTTGCTCGAGTATTATCCTGCCATGGCTGCCACGGATGACTGCAAACCAAAGAGGGGTCGGAGATCTTGGGCCAAGAAAAGAACTGCCACTCACAGCTGCGAGTACCCGGGCTGCGGCAAAACCTACACCAAGAGCTCCCACCTGAAGGCTCATATGCG
                                                  Xl3.1-CHK-1012691430                                                                                                            CTGCTCCTGCTGCTTCTGGAGTTCTATAGTCGGGCTCCCTGCTTGTAAGTCACCTGCAAGCCTGGTGCTGCTTCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTACAACCAGTGGAAGACAAGCAGCTTGGCATGGTATCGGTCATGGCAATGGAGGAGCTGAGGCCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGCAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGCACGCCGGTAGGACATGGTGGCGCCTACCCATTGCCCGAGACCCCTGAGAGCTGTAGTACCACCTATGATAGCGATGGATCCTACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTAAAGGCCGGCATGCACAGCAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCCATCGGAGCACCTACAGCACCTGAGCCATAGAATTAAAAAGGAGCGACCTGAGCAGTCGTGCATGCTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATCATGGAGCAGAAGGCTGGCATCATGCAAATGCACGGCCAACTCCTTCCCAATCCTGCCTATTCTCAGCACAGGCTCAGCCCCCCAGTACCCACAGAGGATATGCCCCCCAATGACTGCCACATGATCCCTGACATGCACTGCCTGTCCCTTATGTCAATGGCACAGCATTACCCAATGGCAAGCCCCTACCAAACTCATTTTACCAGCCAGCCCAACGTGCAGTTTCATGGACAATTTGGAGTTTACAGAGACCCCATGAAGGTTCACCCATCTATGCATGGAATGATTGTCACCCCTCCCTCCTCCCCCTTGCTCGAGTATTATCCTGCCATGGCTGCCACGGATGACTGCAAACCAAAGAGGGGTCGGAGATCTTGGGCCAAGAAAAGAACTGCCACTCACAGCTGCGAGTACCCGGGCTGCGGCAAAACCTACACCAAGAGCTCCCACCTGAAGGCTCATATGCGAACACA
                                                      consensus depths                                                                                                           8     9     8    10     9    10     9    10     9    11    11    11    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    11    12    12    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    11    13    12    13    10    13    10    13    10    13    10    13     9    13     8    13     9    12     9    12     8    11     9    11     8    11     7    10     6     9     6     9     6     9     5     8     5     7     5     7     5     7     5     6     5     6     5     6     5     6     5     6     5     6     4     5     4     5     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                  -G--------G-
                                               BLH ATG      97     789                                                                                                      
                                               BLH MIN      97      86                                                                                                      
                                               BLH OVR      97      94                                                                                                      
                                               EST CLI     -12      45                                                                                                      
                                               ORF LNG      97       7                                                                                                      
                                                                                                                                                                                                                                                                                PREDICTED - Cf ---- 1e-011     XP_542040.2 PREDICTED: similar to Kruppel-like factor 1 (erythroid) [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================
                                                                       PROTEIN --- Ci ---- 7e-014     NP_001071866.1 zinc finger protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 6e-014     XP_001177132.1 PREDICTED: similar to blood island enriched kruppel like factor [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Hs ---- 2e-016     NP_057354.1 Kruppel-like factor [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================
                                                                                                                             PROTEIN --- Mm ---- 2e-019     NP_034767.2 Kruppel-like factor 4 (gut) [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PROTEIN --- ?? ---- 2e-019     NP_004226.2 Kruppel-like factor 4 (gut); endothelial Kruppel-like zinc finger protein [Homosapiens] ----------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PROTEIN --- Bt ---- 2e-020     NP_001098855.1 Kruppel-like factor 4 (gut) [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 2e-027     XP_418264.1 PREDICTED: similar to lung enriched kruppel like factor [Gallus gallus] --------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PROTEIN --- Dr ---- 3e-059     NP_571798.1 Kruppel-like factor 4; blood island-enriched Kruppel-like factor [Danio rerio] -------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 0          NP_001039233.1 novel kruppel-like factor family protein [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 0          NP_001079828.1 blood island enriched kruppel like factor [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6956437.5                                                                                                                                                                                                       ATG------------------------------------------------ATG---------ATG---ATG------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------ATG---ATG---------------------------------------------------------------------ATG------------------ATG---------ATG---------------ATG---ATG---------------ATG------------------------------------------------------------------------------ATG---------------ATG------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2       bld Em10 5g                         IMAGE:8319045.5p                                                        CCCGGTAGGACAGCCACAGTTTCGGTCCGGAGTTGCCGGGATCGAGAGACTACTGCTCCGGCTGCTTCGGGAGGTCTATAGTCGGGCTCCCTGCTTGTAAGTGACCTGCAGGCCTGGTGCGGCTTCCGGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTACAACCAGTGGAAGACAAGCAGCTTGGCATGGTATCGGTCATGGCAATGGAGGAGCTGAGGCCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGCAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGCACGCCGGTAGGACATGGTGGCGCCTACCCATTGCCCGAGACCCCTGAGAGCTGTAGTACCACCTATGATAGCGATGGATCCTACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTAAAGGCCGGCATGCACAGCAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCCATCGGAGCACCTACAGCACCTGAGCCATAGAATTAAAAAGGAGCGACCTGAGCAGTCGTGCATGCTGGGTGCCGGCTCCCCTACTTCCCAGAATGTATTAGCCCCATCATGGAGC
  5   1   2       bld Emb9 5g3  out                   IMAGE:7976250.5p                                                                                          GAAAGTTTCTAGAGACTACTGCTCCGGCTGCTTCGGGAGTTCTATAGTCGGGCTCCCTGCTTGTAAGTCACCTGCAAGCCTGGTGCTGCTTCCGGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTACAACCAGTGGAAGACAAGCAGCTTGGCATGGTATCGGTCATGGCAATGGAGGAGCTGAGGCCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGCAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGCACGCCGGTAGGACATGGTGGCGCCTACCCATTGCCCGAGACCCCTGAGAGCTGTAGTACCACCTATGATAGCGATGGATCCTACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTTGACTAAAGGCCGGCATGCACAGCAGGGAAGTCACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCCATCGGAGCACCTTCAGCACCTGAGCATAAAATTTAAAAGAGCCACCTTAACTTCTGGATGCTTGGTGCCGGTCCCTATTCCCCAACGTATTACCCTCATGAACGAAGGTGGCTCTGAAATCACGGCAATCTTCCAACTGCTATTTGCAAGGTCGCCCCAGACCAAAGGATGCCCCAAGCGCCATGCCTAAGCAGCCTCCTTGTAGGCACTACCTGACCTC
  5   1   2       bld Ga15 5g3  out                      XL468b17ex.5p                                                                                           AAAGTTTCTAGAGACTACTGCTCCTGCTGCTTCTGGAGTTCTATAGTCGGGCTCCCTGCTTGTAAGTCACCTGCAAGCCTGGTGCTGCTTCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTACAACCAGTGGAAGACAAGCAGCTTGGCATGGTATCGGTCATGGCAATGGAGGAGCTGAGGCCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGCAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGCACGCCGGTAGGACATGGTGGCGCCTACCCATTGCCCGAGACCCCTGAGAGCTGTAGTACCACCTATGATAGCGATGGATCCTACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTAAAGGCCGGCATGCACAGCAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCCATCGGAGCACCTACAGCACCTGAGCCATAGAATTAAAAAGGAGCGACCTGAGCAGTCGTGCATGCTGGGTGCCGGCTCCCCTACTTCCCCANACTGTATTANCCCCATCATGGAGCANAAGGCTGGCATCATGCAAATGCACGGCCAACTCCTTCCCAATCCTGCCCTATTCTCANCAC
  5   1   2       chi Em10                            IMAGE:7980258.5p                                                                                           GAAGTTTCTAGAGACTACTGCTCCGGCTGCTTCGGGAGTTCTATAGTCGGGCTCCCTGCTTGTAAGTCACCTGCAGGCCTGGTGCTGCTTCCGGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTACAACCAGTGGAAGACAAGCAGCTTGGCATGGTATCGGTCATGGCAATGGAGGAGCTGAGGCCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGCAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGCACGCCGGTAGGACATGGTGGCGCCTACCCATTGCCCGAGACCCCTGAGAGCTGTAGTACCACCTATGATAGCGATGGATCCTACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTAAAGGCCGGCATGCACAGCAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCCATCGGAGCACCTACAACACTTGAGCCATAGAATTAAAAAGAGCGACCTGACAGTCGTGCATGCTGGGTGCCGGCTCCCCTACTTCCCAGACGGATTAGCCCTTCATGAGCAAAAGTTGCATCAGCAATGCCAGCCAACTCTCCCATCTGCTATCTCTGAAGCCTACCCCCATACCCAAAGATGCCCCCATGACTGCCAGATCCTGATGCCTGCTTCTTTGTATGGAACTACCATG
  5   1   2      seed Ga15 5g3  out                      XL510a19ex.5p                                                                                            AAGTTTCTAGAGACTACTGCTCCTGCTGCTTCTGGAGTTCTATAGTCGGGCTCCCTGCTTGTAAGTCACCTGCAAGCCTGGTGCTGCTTCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTACAACCAGTGGAAGACAAGCAGCTTGGCATGGTATCGGTCATGGCAATGGAGGAGCTGAGGCCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGCAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGCACGCCGGTAGGACATGGTGGCGCCTACCCATTGCCCGAGACCCCTGAGAGCTGTAGTACCACCTATGATAGCGATGGATCCTACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTAAAGGCCGGCATGCACAGCAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCCATCGGAGCACCTACAGCACCTGAGCCATAGAATTAAAAAGGAGCGACCTGAGCAGTCGTGCATGCTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATCATGGAGCAGAAGGCTGGCATCATGCAAATGCACGGCCAACTCCTTCCCAATCCTGCCTATTCTCAGCACAGGCTCAGC
  5   1   2       bld Emb4 5g                IMAGE:5537481-IMAGp.IMAGp                                                                                             AGTTTCTAGAGACTACTGCTCCTGCTGCTTCTGGAGTTCTATAGTCGGGCTCCCTGCTTGTAAGTCACCTGCAAGCCTGGTGCTGCTTCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTACAACCAGTGGAAGACAAGCAGCTTGGCATGGTATCGGTCATGGCAATGGAGGAGCTGAGGCCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGCAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGCACGCCAGTAGGACATGGTGGCGCCTACCCATTGCCCGAGACCCCTGAGAGCTGTAGTACCACCTATGATAGCGATGGATCCTACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTAAAGGCCGGCATGCACAGCAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCCATCGGAGCACCTACAGCACCTGAGCCATAGAATTAAAAAGGAGCGACCTGAGCAGTCGTGCATGCTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATCATGGAGCAGAAGGCTGGCATCAT
  5   1   2       bld Emb4 5g                         IMAGE:5537481.5p                                                                                              GTTTCTAGAGACTACTGCTCCTGCTGCTTCTGGAGTTCTATAGTCGGGCTCCCTGCTTGTAAGTCACCTGCAAGCCTGGTGCTGCTTCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTACAACCAGTGGAAGACACGCAGCTTGGCATGGTATCGGTCATGGCAATGGAGGAGCTGAGGCCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGCAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGCACGCCAGTAGGACATGGTGGCGCCTACCCATTGCCCGAGACCCCTGAGAGCTGTAGTACCACCTATGATAGCGATGGATCCTACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTANAGGCCGGCATGCACAGCAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCCATCGGAGCACCTACAGCACCTGAGCCATAGAATTAAAAAGAGCGACCTGAGCAGTCGTGCATGCTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATCATGGAGCAGAAGGCTGGCATCATGCAAATGCACGGGCCAACTCCTTTCCCATCCCTGCCTATTCTCAGCACAGGGCTCAGccccccccAGTGCCCACAGAGGGAAATGCCCCCCAATGGACTGGCACCATGATCCCCTGACATTGCACTGGCCTGGCCCTTCCTGTTCAATGGGAACGGAATTTACCCAATGNGAAAGGCCCCTTCCCAACTTCCTTTTTTCCCGGCCCGGCCCCAACGGGGCAGGTTTTCTTGC
  5   1   2       bld Emb1 5x3  out                   IMAGE:3402341.5p                                                                                                TTTCTAGAGACTACTGCTCCTGCTGCTTCTGGAGTTCTATAGTCGGGCTCCCTGCTTGTAAGTACCTGCAAGCCTGGTGCTGCTTCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTACAACCAGTGGAAGACAAGCAGCTTGGCATGGTATCGGTCATGGCAATGGAGGAGCTGAGGCCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGCAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGCACGCCGGTAGGACATGGTGGCGCCTACCCATTGCCCGAGACCCCTGAGAGCTGTAGTACCACCTATGATAGCGATGGATCCTACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATGTGCCCTGCAT
  5   1   2       bld Brn1 5g3  out                   IMAGE:6956437.5p                                                                                                    AGAGACTACTGCTCCTGCTGCTTCTGGAGTTCTATAGTCGGGCTCCCTGCTTGTAAGTCACCTGCAAGCCTGGTGCTGCTTCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTACAACCAGTGGAAGACAAGCAGCTTGGCATGGTATCGGTCATGGCAATGGAGGAGCTGAGGCCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGCAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGCACGCCGGTAGGACATGGTGGCGCCTACCCATTGCCCGAGACCCCTGAGAGCTGTAGTACCACCTATGATAGCGATGGATCCTACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTAAAGGCCGGCATGCACAGCAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCCATCGGAGCACCTACAGCACCTGAGCCATAGAATTAAAAAGGAGCGACCTGAGCAGTCGTGCATGCTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATCATGGAGCAGAAGGCTGGCATCATGCAAATGCACGGCCAACTCCTTCCCAATCCTGCCTATTCTCAGCACAGGCTCAGCCCCCCAGTACCCACAGAGGATATGCCCCCCAAATGACTGCCACATGGATCCCCTGACAGTGCACTGGCCTGGTCCCCTTATGTTC
  5   1   2       bld Ga12 5g3  out                        XL198d17.5p                                                                                                                GAGGGCTGCTTCTGGAGTTCTATAGTCGGGCTCCCTGCTTGTAAGTCACCTGCAAGCCTGGTGCTGCTTCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTACAACCAGTGGAAGACAAGCAGCTTGGCATGGTATCGGTCATGGCAATGGAGGAGCTGAGGCCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGCAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGCACGCCGGTAGGACATGGTGGCGCCTACCCATTGCCCGAGACCCCTGAGAGCTGTAGTACCACCTATGATAGCGATGGATCCTACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATGTGCCCTGCATANAGGTGTCCCCTGACTTTGGACTAAAGGCCGGCATGC
  5   1   2       bld Tbd7 5g                              XL068o23.5p                                                                                                                                               GTCCTGCTTGTAAGTNACCTGCAAGCCTGGTGCTGCTTCCTGGGGAGCACGTTAGGATGAGTGTGGCTTTCTCAACCCTACAACCAGTGGAAGACAAGCAGCTTGGCATGGTATCGGTCATGGCAATGGAGGAGCTGAGGCCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGCAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGCACGCCGGTAGGACATGGTGGCGCCTACCCATTGCCCGAGACCCCTGAGAGCTGTAGTACCACCTATGATAGCGATGGATCCTACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATCTGCCCTGCATAGAGGTGTCCCCTGACTTTGG
  5   1   2       bld Em10                            IMAGE:8319429.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGCATTAGACAGGTTCGGTCCGGAATTCCGGGATTCCACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTAAAGGCCGGCATGCACAGCAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCCATCGGAGCACCTACAGCACCTGAGCCATAGAATTAAAAAGGAGCGACCTGAGCAGTCGTGCATGCTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATCATGGAGCAGAAGGCTGGCATCATGCAAATGCACGGCCAACTCCTTCCCAATCCTGCCTATTCTCAGCACAGGCTCAGCCCCCCAGTACCCACAGAGGATATGCCCCCCAATGACTGCCACATGATCCCTGACATGCACTGCCTGTCCCTTATGTCAATGGCACAGCATTACCCAATGGCAAGCCCCTACCAAACTCATTTTACCAGCCAGCCCAACGTGCAGTTTCATGGACAATTTGGAGTTTACAGAGACCCCATGAAGGTTCACCCATCTATGCATGGAATGATTGTCACCCCTCCCTCCTCCCCCTTGCTCGAGTATTATCCTGCCATGGCTGCCACGGATGAACTGCAAACCAAGAGGGGTCGGAGATCTTGGGCCAAAAAAAGACCTGCCACTCACAGCTGCGAGTACCCGGGCTGCGGCAAAC
  5   1   2       bld Egg1                               PBX0139F08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCACGAGGGCGATGGATCCTACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCTGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTAAAGGCCGGCATGCACAGCAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCCATCGGAGCACCTACAGCACCTGAGCCATAGAATTAAAAAGGAGCGACCTGAGCAGTCGTGCATGCTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATCATGGAGCAGAAGGCTGGCATCATGCAAATGCACGGCCAACTCCTTCCCAATCCTGCCTATTCTCAGCACAGGCTCAGCCCCCCAGTACCCACAGAGGATATGCCCCCCAATGACTGCCACATGATCCCTGACATGCACTGCCTGTCCCTTATGTCAATGGCACAACATTACCCAATGGCAAGCCCCTACCAAACTCATTTTACCAGCCAGCCCAACGTGCAGTTTCATGGACAATTTG
  5   1   2       bld FaBN      out                   IMAGE:8074783.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACTCCAGATGTGCCCTGCATAGAGGTGTCCAATGACTTTGGACTAAAGGCCGGCATGCACAGCAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCTATCGGAGCACCTACAGCACTTGAGCCATAGAATTAAAAAGGAGCGACCTGAGCAGTCGTGCATGCTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCTATCATGGAGCAGAAGGCTGGCATCATGCAGATGCACGGCCAACTCCTTCCCAATCCTGCCTATTCTCAGCACAGGCTCAGCCCCCCAGTGCCCACAGAGGCTATGCCCCCCAATGACTGCCACATGATCCCTGACATGCACTGCCTGTCCCTCATGTCAATGGCACAGCACTACCCAATAGCAACCTCCTACCCCACTCATTTTACCAGCCAGCCCCCCGCTCAGTTTCATGGACAATTTGGAGTTTACAGAGACCCTATGAAGGTTCACCCATCTATGCATGGAATGATTGTCACCCCTCCCTCCTCCCCCTTGCTTGAGTATTATCCTGCCATGGCTGCCACGGATGACTGCAAACCAAAGAGGGGTCGGAGATCGTGGGCCAGGAAAAGAACTGCCACTCACAGCTGCGAGTACCCGGGCTGCGGCAAAACCTACACCAAGAGCTCCCACCTGAAGGCTCATATGCGAACGCATACAGGAGAAAACCATATCACTG
  5   1   2       bld Ga15      out                      XL503o01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGACTTTGGACTAAAGGCCGGCATGCACAGCAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCCATCGGAGCACCTACAGCACCTGAGCCATAGAATTAAAAAGGAGCGACCTGAGCAGTCGTGCATGCTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATCATGGAGCAGAAGGCTGGCATCATGCAAATGCACGGCCAACTCCTTCCCAATCCTGCCTATTCTCAGCACAGGCTCAGCCCCCCAGTACCCACAGAGGATATGCCCCCCAATGACTGCCACATGATCCCTGACATGCACTGCCTGTCCCTTATGTCAATGGCACAGCATTACCCAATGGCAAGCCCCTACCAAACTCATTTTACCAGCCAGCCCAACGTGCAGTTTCATGGACAATTTGGAGTTTACAGAGACCCCATGAAGGTTCACCCATCTATGCATGGAATGATTGTCACCCCTCCCTCCTCCCCCTTGCTCGAGTATTATCCTGCCATGGCTGCCACGGATGACTGCAAACCAAAGAGGGGTCGGAGATCTTGGGCCAAGAAAAGAACTGCCACTCACAGCTGCGAGTACCCGGGCTGCGGCAAAACCTACACCAAGAGCTCCCACCTGAAGGCTCATATGCGAACACATACAGGAGAGAAACCATATCACTGTAACTGGGAGGGCTGCGGATGGAAATTCG
  5   1   2       bld Egg1                               PBX0012B01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGGCATGCACAGCAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCCATCGGAGCACCTACAGCACCTGAGCCATAGAATTAAAAAGGAGCGACCTGAGCAGTCGTGCATGCTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATCATGGAGCAGAAGGCTGGCATCATGCAAATGCACGGCCAACTCCTTCCCAATCCTGCCTATTCTCAGCACAGGCTCAGCCCCCCAGTACCCACAGAGGATATGCCCCCCAATGACTGCCACATGATCCCTGACATGCACTGCCTGTCCCTTATGTCAATGGCACAGCATTACCCAATGGCAAGCCCCTACCAAACTCATTTTACCAGCCAGCCCAACGTGCAGTTTCATGGACAATTTGGAGTTTACAGAGACCCCATGAAGGTTCACCCATCTATGCATGGAATGATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)