Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6877717.3                      10 END     2          11       20                (no blast hit)
     2   2.0    0Xl3.1-xl313k15.5                            9 END     2          11       22                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:8636148.5                     363 PI      76        176      849                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:8741703.5                     118 PI      77        512      841                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:6874928.5                      75 PI      77        512      841                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:8543895.5                      31 PI      95          1     1176                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:5537445.5                       3 PI      91        926     1176                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012771051 Xl3.1-IMAGE:4724692.5 - 17 ESTs
                                                                       ......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:4724692.5                                                                                                                                                                                                                         TCAACCTGGACCACCTGGTCCCCCTGGTCCTCCTGGCCCTGGAATTGACATGTCTGCTTTTGCTGGCCTATCTCAACCTGAAAAAGGACCCGACCCTATGCGTTACATGCGTGCTGACCAAGCCTCCAACTCTCTCCCTGTTGATGTTGAAGCCACTTTGAAATCCCTCAATAACCAGATTGAAAACATCCGCAGCCCAGATGGTACCAAGAAGAACCCAGCCCGCACATGCCGTGACCTGAAACTCTGCCACCCTGAATGGAAGAGCGGTGACTATTGGATTGATCCCAACCAGGGCTGCACTGTTGATGCTATCAAAGTTTTCTGCGACATGGAGACTGGAGAGACCTGTGTATACCCCAACCCATCAAAGATCCCCAAGAAGAACTGGTGGAGCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGTTCAGCACCCAACACTGCTAACATTCAGATGACCTTCCTGCGTCTGCTGTCTACTGATGCATCCCAGAACATCACTTATCACTGCAAGAACAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTCAAGAAGGCTGTTCTACTCCAAGGATCAAATGATGTAGAAATCAGAGCTGAGGGCAACAGTAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATACAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGTGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGTAAAAACCAAAAAAGCATAATAAAAATAAATAAAACCCTAAGGACCTGAGTACTTTCCAATCACTTTTAGGACTTCTGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTTTGGACTTTTTTTTTTTTTTGAATTGCAAGGCCAGAACTGGGCAGACTGAAAAAGTAAAAATCACGGTATATTTATTTATTGGTCTTCCTGTAAGACCTATGGGTCAGGTGAAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCTCTAACTGTTGTATGAAGTGCAGTTTAAAGCAGCCCTCCCCCCTCACAGTGTATATC
                                                  Xl3.1-CHK-1012690765                                                                                                                                                                                                                               TGGACCACCTGGTCCCCCTGGTCCTCCTGGCCCTGGAATTGACATGTCTGCTTTTGCTGGCCTATCTCAACCTGAAAAAGGACCCGACCCTATGCGTTACATGCGTGCTGACCAAGCCTCCAACTCTCTCCCTGTTGATGTTGAAGCCACTTTGAAATCCCTCAATAACCAGATTGAAAACATCCGCAGCCCAGATGGTACCAAGAAGAACCCAGCCCGCACATGCCGTGACCTGAAACTCTGCCACCCTGAATGGAAGAGCGGTGACTATTGGATTGATCCCAACCAGGGCTGCACTGTTGATGCTATCAAAGTTTTCTGCGACATGGAGACTGGAGAGACCTGTGTATACCCCAACCCATCAAAGATCCCCAAGAAGAACTGGTGGAGCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGTTCAGCACCCAACACTGCTAACATTCAGATGACCTTCCTGCGTCTGCTGTCTACTGATGCATCCCAGAACATCACTTATCACTGCAAGAACAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTCAAGAAGGCTGTTCTACTCCAAGGATCAAATGATGTAGAAATCAGAGCTGAGGGCAACAGTAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATACAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGTGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGTAAAAACCAAAAAAGCATAATAAAAATAAATAAAACCCTAAGGACCTGAGTACTTTCCAATCACTTTTAGGACTTCTGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTTTGGACTTTTTTTTTTTTTTGAATTGCAAGGCCAGAACTGGGCAGACTGAAAAAGTAAAAxxxxCGGTATxxTTxxTTxxTxGTCTTCCTGTAAGACCTATGGGTCAGGTGAAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCTCTAACTGTTGTATGAAGTGCAGTTTAAAGCAGCCCTCCCCCCTCACAGTGTATATCAACAGG
                                                      consensus depths                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     4     4     4     4     4     4     5     5     7     7     7     7     8     8     8     8     8     8     8     8     9     9     9     9     9     9    10    10    10    10    10    10    10    10    11    11    11    11    11    11    10    10    10    10    10    10    10    11    10    11    10    11    10    12    13    13    13    13    13    13    13    13    13    13    13    13    12    13    13    13    13    13    13    13    14    14    14    14    14    14    13    13    13    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    11    12    11    12    11    13    12    13    12    13    11    13    11    12    11    12    10    12     9    12     8    12     7    10     6     9     7     9     7     9     7     9     7     9     6     9     6     9     6     9     6     9     5     8     3     7     3     7     3     7     2     7     3     6     3     6     3     6     3     6     3     5     3     5     2     4     2     4     2     4     2     4     2     4
  5   1   2       bld Neu7      out                        XL016g08.5p GAGGAGAGGATTNACTGGTCTTCAGGGTCTGCCTGGTCCCCCTGGTTCTGCTGGTGATCAAGGTGCTACTGGTCCTGCCGGTCCTGCTGGTCCTAGAGGTCCCCCTGGCCCTGTTGGTCCTTCTGGAAAAGATGGCTCTAATGGTATCTCTGGTCCCATTGGTCCACCTGGTCCACGTGGTCGTAGTGGTGAaactggcccctctggtccacctggtcaacctggaccacctggtccccctggtcctcctggccctGGAATTGACATGTCTGCTTTTGCTGGCCTATCTCAACCTGAAAAAGGACCCGACCCTATGCGTTACATGCGTGCTGACCAAGCCTCCAGCTCTCTCCCTGTTGATGTTGAAGCCACTTTGAAATCCCTCAATAACCAGATTGAAAACATCCGCAGCCCAGATGGTACCAAGAAGAACCCAGCCCGCACATGCCGTGACCTGAAACTCTGCCACCCTGAATGGAAGAGCGGTGACTATTGGATTGATCCCAACCAGGGCTGCACAGTTGATGCTATCAAAGTTTTCTGCGACATGGAGACTGGAGAGACCTGTGTATACCCCAACCCATCAAAGAT
  5   1   2       bld Tbd7                                 XL077k06.5p                                                                                                                                                                         CCTGGTCCCGTGGTCGTAGTGGTGAAACTGGCccctctggtcccctggtcaacctggaccacctggtccccctggtcctcctggccctgGAATTGACATGTCTGCTTTTGCTGGCCTATCTCAACCTGAAAAAGGACCCGACCCTATGCGTTACATGCGTGCTGACCAAGCCTCCAACTCTCTCCCTGTTGATGTTGAAGCCACTTTGAAATCCCTCAATAACCAGATTGAAAACATCCGCAGCCCAGATGGTACCAAGAAGAACCCAGCCCGCACATGCCGTGACCTGAAACTCTGCCACCCTGAATGGAAGAGCGGTGACTATTGGATTGATCCCAACCAGGGCTGCACTGTTGATGCTATCAAAGTTTTCTGCGACATGGAGACTGGAGAGACCTGTGTATACCCCAACCCATCAAAGATCCCCAAGAAGAACTGGTGGAGCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGTTCAGCACCCAACACTGCTAATATTCAGATGACCTTCCTGCGTCTGCTGTCTACTGATGCATCCCAGAACATCACTTATCACTGCAAGAACAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTCAAGAAGGCTGTTCTACTCCAAGGATCAAATGATGTAGAAATC
  5   1   2       bld Neu4                            IMAGE:4085574.5p                                                                                                                                                                                                                                                                                                                                              CCAAGCCTCCAACTCTCTCCCTGTTGATGTTGAAGCCACTTTGAAATCCCTCAATAACCAGATTGAAAACATCCGCAGCCCAGATGGTACCAAGAAGAACCCAGCCCGCACATGCCGTGACCTGAAACTCTGCCACCCTGAATGGAAGAGCGGTGACTATTGGATTGATCCCAACCAGGGCTGCACTGTTGATGCTATCAAAGTTTTCTGCGACATGGAGACTGGAGAGACCTGTGTATACCCCAACCCATCAAAGATCCCCAAGAAGAACTGGTGGAGCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGTTCAGCACCCAACACTGCTAACATTCAGATGACCTTCCTGCGTCTGCTGTCTACTGATGCATCCCAGAACATCACTTATCACTGCAAGAACAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTCAAGAAAAGC
  3   1   2       bld DMZ       out                        xl313k15.3p                                                                                                                                                                                                                                                                                                                                                            CTCTCCCTGTTGATGTTGAAGCCACTTTGAAATCCCTCAATAACCAGATTGAAAACATCCGCAGCCCAGATGGTACCAAGAAGAACCCAGCCCGCACATGCCGTGACCTGAAACTCTGCCACCCTGAATGGAAGAGCGGTGACTATTGGATTGATCCCAACCAGGGCTGCACTGTTGATGCTATCAAAGTTTTCTGCGACATGGAGACTGGAGAGACCTGTGTATACCCCAACCCATCAAAGATCCCCAAGAAGAACTGGTGGAGCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGTTCAGCACCCAACNCTGCTAACATTCAGATGACCTTCCTGCGTCTGCTGTCTNCTGATGCATCCCAGAACATCANTTATCACTGCAAGANCAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTCAAGAAGGCTGTTCTACTCCAAGGATCAAATGATGTAGAAATCAGAGCTGAGGGCAACAGTAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATACAGGACACAGAAAACATCTCGCCNGCCCATCGTAGACATTGCACCTATGGATATTGGTGGNGCTGNTCAGGAATTTG
  5   1   2       bld Emb4                            IMAGE:4724692.5p                                                                                                                                                                                                                                                                                                                                                                                           ATCCCTCAATAACCAGATTGAAAACATCCGCAGCCCAGATGGTACCAAGAAGAACCCAGCCCGCACATGCCGTGACCTGAAACTCTGCCACCCTGAATGGAAGAGCGGTGACTATTGGATTGATCCCAACCAGGGCTGCACTGTTGATGCTATCAAAGTTTTCTGCGACATGGAGACTGGAGAGACCTGTGTATACCCCAACCCATCAAAGATCCCCAAGAAGAACTGGTGGAGCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGTTCAGCACCCAACACTGCTAACATTCAGATGACCTTCCTGCGTCTGCTGTCTACTGATGCATCCCAGAACATCACTTATCACTGCAAGAACAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTCAAGAAGGCTGTTCTACTCCAAGGATCAAATGATGTAGAAATCAGAGCTGAGGGCAACAGTAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATACAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGTGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGtaaaaccaaaaaagcctaataaaaataaataaaCCCCTAAGGGACCTGAGTACTTTCCAATCACTTTTAGGACTTCTGCACTGAATGGCTGAACCCGACCCCAAATTTTCCATTTCTCCCCCGCGCTTACCTTTTTGGGACtttttttttttttttttGAATTGCCAAGGCAAAAACTGGGGCCGACTGTAAAAAGTAAAATCCCCGGGATTATTTTATTTAATGGGCCTTCCCGGGAAGACCCTATGGGGTCC
  5   1   2       bld Tad2      in                    IMAGE:6875808.5p                                                                                                                                                                                                                                                                                                                                                                                                    TAACCAGATTGAAAACATCCGCAGCCCAGATGGTACCAAGAAGAACCCAGCCCGCACATGCCGTGACCTGAAACTCTGCCACCCTGAATGGAAGAGCGGTGACTATTGGATTGATCCCAACCAGGGCTGCACTGTTGATGCTATCAAAGTTTTCTGCGACATGGAGACTGGAGAGACCTGTGTATACCCCAACCCATCAAAGATCCCCAAGAAGAACTGGTGGAGCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTATCCAATTCAGCTATGGAGATGACAGTTCAGCACCCAACACTGCTAACATTCAGATGACCTTCCTGCGTCTGCTGTCTACTGATGCATCCCAGAACATCACTTATCACTGCAAGAACAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTCAAGAAGGCTGTTCTACTCCAAGGATCAAATGATGTAGAAATCAGAGCTGAGGGCAACAGTAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAAAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATACAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGCGGGGCTGATCAGGAATTTGGTGTTGACATTGGCGCCAGCCGGCTTCTTGGCACAAACCAAAAGCGGCTTAACCAACGATAAAATAAGACCCCCTAAGGGACCCTGAAGAATCGTTTCCAATCCACTCTTTTAAGGGACTTCCTGGCACCCTGAATTGGGTCTGGAAACCCAAACCCGCCAAATATTGTCCCCT
  3   1   2      seed Neu7                                 XL013o19.3p                                                                                                                                                                                                                                                                                                                                                                                                             TGAAAACATCCGCAGCCCAGATGGTACCAAGAAGAACCCAGCCCGCACATGCCGTGACNTGAAACTCTGCCACCCTGAATGGAAGAGCGGTGACTATTGGATTGATCCCAACCAGGGCTGCACTGTTGATGCTATCAAAGTTTTCTGCGACATGGAGACTGGAGAGACCTGTGTATACCCCAACCCATCAAAGATCCCCAAGAAGAACTGGTGGAGCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGTTCAGCACCCAACACTGCTAACATTCAGATGACCTTCCTGCGTCTGCTGTCTACTGATGCATCCCAGAACATCACTTATCACTGCAAGAACAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTCAAGAAGGCTGTTCTACTCCAAGGATCAAATGATGTAGAAATCAGAGCTGAGGGCAACAGTAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATACAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGTGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGTAAAAACCAAAAAAGCATAATAAAAA
  5   1   2       bld Brn3                            IMAGE:8537195.5p                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGATGGTACCAAGAAGAACCCAGCCCGCACATGCCGTGACCTGAAACTCTGCCACCCTGAATGGAAGAGCGGTGACTATTGGATTGATCCCAACCAGGGCTGCACTGTTGATGCTATCAAAGTTTTCTGCGACATGGAGACTGGAGAGACCTGTGTATACCCCAACCCATCAAAGATCCCCAAGAAGAACTGGTGGAGCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGTTCAGCACCCAACACTGCTAACATTCAGATGACCTTCCTGCGTCTGCTGTCTACTGATGCATCCCAGAACATCACTTATCACTGCAAGAACAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTCAAGAAGGCTGTTCTACTCCAAGGATCAAATGATGTAGAAATCAGAGCTGAGGGCAACAGTAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATACAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGTGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGtaaaaaccaaaaagcnatataaaaataataaaaCCTAAGGACTGATACTTTCNATCATTTTAGGACTCTGCACTGATGCTGAACGACCCAATTTCATCATCACCGCTACATTTGACttttttttGATTGCAGCGACTGGCGACTGAATAATCCGGTTATATATGCTCTGAACTTGTAGGAGTGACTACGAGTTAGCCACGTTTAGCTA
  3   1   2       bld DMZ       out                        xl241d03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ANCCTGAATGGAAGAGCGGTGACTATTGGATTGATCCCAACCAGGGCTGCACTGTTGATGCTATCAAAGTTTTCTGCGACATGGAGACTGGAGAGACCTGTGTATACCCCAACCCATCAAAGATCCCCAAGAAGAACTGGTGGAGCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGTTCAGCACCCAACACTGCTAACATTCAGATGACCTTCCTGCGTCTGCTGTCTACTGATGCATCCCAGAACATCACTTATCACTGCAAGAACAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTCAAGAAGGCTGTTCTACTCCAAGGATCAAATGATGTAGAAATCAGAGCTGAGGGCAACAGTAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATACAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGTGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCT
  5   1   2       bld Emb4                            IMAGE:5572413.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCCAACCAGGGCTGCACTGTTGATGCTATCAAAGTTTTCTGCGACATGGAGACTGGAGAGACCTGTGTATACCCCAACCCATCAAAGATCCCCAAGAAGAACTGGTGGAGCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGTTCAGCACCCAACACTGCTAACATTCAGATGACCTTCCTGCGTCTGCTGTCTACTGATGCATCCCAGAACATCACTTATCACTGCAAGAACAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTCAAGAAGGCTGTTCTACTCCAAGGATCAAATGATGTAGAAATCAGAGCTGAGGGCAACAGTAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATACAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGTGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGTANAAACCAAAAAAGCATAATaaaaaaaaaaaaaaaaG
  5   1   2       bld Tad2                            IMAGE:6874440.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGACATGGAGACTGGAGAGACCTGTGTATACCCCAACCCATCAAAGATCCCCAAGAAGAACTGGTGGAGCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGTTCAGCACCCAACACTGCTAACATTCAGATGACCTTCCTGCGTCTGCTGTCTACTGATGCATCCCAGAACATCACTTATCACTGCAAGAACAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTCAAGAAGGCTGTTCTACTCCAAGGATCAAATGATGTAGAAATCAGAGCTGAGGGCAACAGTAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAGACGTTATTGATACGGACACAAACTCTCCCTGCATCGAACTTGCAGATATGTGGTGCGATGGTGTGCACTTGACAACAAAATACAGCGCTCCTGTCAGACCTTCCTTGTTTATGCAGCAACTTTTCACGGGGAGTCTTGACGCAGGCN
  3   1   2       bld Tad2      in                    IMAGE:6875808.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGGGAAAAGGAAGCCCCTTTTGTTTGGGAGAGACCATCAAATGGTGTTTTCCAATTCAGTTAGGGAGATGACAGTTCAGCACCCAACACTGCTAACATTCAGATGACCTTCCTGCGTCTGCTGTCTAGTGATGCATCCCAGAACATCACTTATCACTGCAAGAACAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTCAAGAAGGCTGTTCTACTCCAAGGATCAAATGATGTAGAAATCAGAGCTGAGGGCAACAGTAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATACAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGTGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGTAAAAACCAAAAAAGCATAATAAAAATAAATAAAACCCTAAGGACCTGAGTACTTTCCAATCACTTTTAGGACTTCTGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTTTGGACTTTTTTTTTTTTTTGAATTGCAAGGCCAGAACTGGGCAGACTGAAAAAGTAAAATCACGGTATTATTTATTTATTGTCTTCCTGTAAGACCTATGGGTCAGGTGAAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCTCTAACTGTTGTATGAAGTGCAGTTTAAAGCAGCCCTCCCCCCTCACAGTGTATATCAACAGGAAAACTGTGTGTAATTGAATGAAATGGTACTATGTAAAACAGTTCCGTTTTGGGAA
  5   1   2       bld Tad1                            IMAGE:6940770.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGTGGTTTCCAATTCAGCTATGGAGATGACAGTTCAGCACCCAACACTGCTAACATTCAGATGACCTTCCTGCGTCTGCTGTCTACTGATGCATCCCAGAACATCACTTATCACTGCAAGAACAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTCAAGAAGGCTGTTCTACTCCAAGGATCAAATGATGTAGAAATCAGAGCTGAGGGCAACAGTAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATACAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGTGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGTaaaaaccaaaaaagcataataaaaataaataaaaCCCTAAGGACCTGAGTACTTTCCAATCACTTTTAGGACTTCTGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTTTGGACttttttttttttttGAATTGCAAGGCCCGAACTGGGCAGACTGAAAAAGTAAAATCACCGGATTATTTATTTATTGGTCTTCCTGTAAGACCTATGGGGTCAGGTGAAAGGTTTGAAACTAACTGGGCATGTTTGGAAAGCCCCTCTAACTTGTTGTATGGAGGTGCAGTTTTAAAGCAAccccctcccccccTCCACGGTGTTATTATTCACCCGGGGAAAAACTGGTGGTGGTAAATTTGAATGGAAACAGGGTGGCCTTTATTGTGTAAAACAAAGTGTTTTGGTTATTTTTCAAAAAAATATCCAACCCTGGTGAATATaaaaaaaaaaatccttcttttttttGGGAAAAAAGATCACAAAAGATGTGGAGATTTCTGTGGGGCCCTTTTTTGTTTTCTCTTT
  5   1   2       bld Emb4                            IMAGE:5542558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCATTTACAATTCAGCTATGGAGATGACAGTTCAGCACCCAACACTGCTAACATTCAGATGACCTTCCTGCGTCTGCTGTCTACTGATGCATCCCAGAACATCACTTATCACTGCAAGAACAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTCAAGAAGGCTGTTCTACTCCAAGGATCAAATGATGTAGAAATCAGAGCTGAGGGCAACAGTAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATACAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGTGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGTaaaaaccaaaaaagcataataaaaataaataaaaCCCTAAGGACCTGAGTACTTTCCAATCACTTTTAGGACTTCTGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTTTGGACttttttttttttttGAATTGCAAGGCCAGAACTGGGCAGACTGAAAAAGTAAAATCACGGNATTATTTATTTATTGTCTTCCTGTAAGACCTATGGGTCAGGGTGAAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCTCTAACTGTTGTATGAAGTGCAGTTTAAAGCAGCCCTCCCCCCTCACAGTGTATATCAACAGGAAAAACTGTGGTGTAATTGAAATGAAAAGGGGGCTAATTGGTAAAAACAGGTTTTTGTAATTTTTAAAAATAATCAACCTGGATATTaaaaaaaaaTCCTTTTTTTGGGAAA
  5   1   2       bld Tbd2                            IMAGE:3199732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCATTGCATTTATGGATGAAGCTTCAGGCAACCTCAAGAAGGCTGTTCTACTCCAAGGATCAAATGATGTAGAAATCAGAGCTGAGGGCAACAGTAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATACAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGTGCTGATCAGGAATNTGGTGTTGACATTGGCCCAGTCTGCTTCTTGtaaaaaccaaaaaagcataataaaaataaataaaaCCCTAAGGACCTGAGTACTTTCCAATCACTTTTAGGACTTCTGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTTTGGACtttttttttttttttGAATTGCAAGGCCAGAACTGGGCAGACTGAAAAAGTAAAATCACGGTATTATTTATTTATTGTCTTCCTGTAAGACCTATGGGTCAGGTGAAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCTCTAACTG
  5   1   2       bld Neu7                                 XL031h07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCCTGCCCATCCGNAGACATTGCACCTATGGATATTGGTGGTGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGtaaaaaccaaaaaagcataataaaaataaataaaaCCCTAAGGACCTGAGTACTTTCCAATCACTTTTAGGACTTCTGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTTTGGACttttttttttttttNNA
  5   1   2       bld Tad1      out                   IMAGE:6877717.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCATTGGCCCAGTCTGCTTCTTGtaaaaaccaaaaaagcataataaaaataaataaaaCCCTAAGGACCTGAGTACTTTCCAATCACTTTTAGGACTTCTGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTTTGGACtttttttttttttttGAATTGCAAGGCCAGAACTGGGCAGACTGAAAAAGTAAAATCACGGTATTATTTATTTATTGTCTTCCTGTAAGACCTATGGGTCAGGTGAAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCTCTAACTGTTGTATGAAGTGCAGTTTAAAGCAGCCCTCCCCCCTCACAGTGTATATCAACAGGAAAACTGTGTGTAATTGAATGAAATGGTGCTATTGTAAAACAGTTTTGTATTTTAAAATATCAACTGATATAAAAAAATCTTTTTGGAAAGTACAAGTTGATCTGGGCTTTGTTCTTTTATATTTTTATATACTGTAGATAGAAAGAAAAAAATTCCAAGGATTGTCAGTCCACCTTCCCTTTTGTTGTGGTTTTTTCCAATATGAGATGAACGAAGTTTAGGGCAATATTAGAACTTCCCAGGTTTAAGCTACCTCACACTATCTAAAAACGAAAAAGACAAAAGTGAAATCTTTGAACTGAACTAAACATGCAGTACTGTAGGAATCAAAGAAACATTCATTTATGGGAAAAATCTTGGGGTTACGTTTCTCAAGTTCCGGGGGCTTTATCTTAATGCTTTTTGGGTTTCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)