Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl276m17.3                            8 END     2          11       25                Xiro3 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xlk51f06ex.5                          2 PI      84         28      434                homeobox transcription factor iriquois 3 [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012771087 Xl3.1-IMAGE:7982631.5 - 18 ESTs
                                                                       ........-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7982631.5                                                                                                             GAGAGAGAGAGAGAGAGAGAGAGAGACTAGAAGACTTGGGAGGAGCTTACGCTGGGCTTGAAATGTCAATCAGAGTGTGAGTGCCAATGATCTGAAGCAATCTGTTAGGAACTGACCTGGTCCACTCAGATCAATAGCATCAGAGGGAGAGGACAGAGTCACCGAGATCCCTGCTGGAACCCTAGCAGCCCGGTTCCCCCTTCCTCGGTCACTTGATGTGTAGGGAGAGGGGGAAACAAAGTCAGGTCATAAAAGGGGATTCCCTGTGCCTCCGGCTGCACCATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAAGGCCTGGCTCAATGAGCACAGAAAGAACCCCTATCCGACCAAGGGCGAGAAAATCATGCTTGCTATCATCACTAAAATGACCCTCACGCAGGTGTCCACCTGGTTTGCTAACGCAAGGAGGAGACTTAAAAAGGAGAACAAAATGACTTGGGCCCCTAGGAGCCGAACAGACGAGGAAGGTAACGCCTATGGCAGCGACCACGAAGAAGACAAGCACGAGGACGAGGAGGAGATTGACTTGGAGAACATCGACACTGAGGACATTGAGAGTAAAGAAGATTTGGATGACCCAGACACTGATATACACTCGGACTCTAAAACTGATACTAGGAGTGACTCGGAAGTCTCGGATGGG
                                                  Xl3.1-CHK-1012690406                                                                                                                   GAGAGAGAGAGAGAGAGAGACTAGAAGACTTGGGAGGAGCTTACGCTGGGCTTGAAATGTCAATCAGAGTGTGAGTGCCAATGATCTGAAGCAATCTGTTAGGAACTGACCTGGTCCACTCAGATCAATAGCATCAGAGGGAGAGGACAGAGTCACCGAGATCCCTGCTGGAACCCTAGCAGCCCGGTTCCCCCTTCCTCGGTCACTTGATGTGTAGGGAGAGGGGGAAACAAAGTCAGGTCATAAAAGGGGATTCCCTGTGCCTCCGGCTGCACCATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAAGGCCTGGCTCAATGAGCACAGAAAGAACCCCTATCCGACCAAGGGCGAGAAAATCATGCTTGCTATCATCACTAAAATGACCCTCACGCAGGTGTCCACCTGGTTTGCTAACGCAAGGAGGAGACTTAAAAAGGAGAACAAAATGACTTGGGCCCCTAGGAGCCGAACAGACGAGGAAGGTAACGCCTATGGCAGCGACCACGAAGAAGACAAGCACGAGGACGAGGAGGAGATTGACTTGGAGAACATCGACACTGAGGACATTGAGAGTAAAGAAGATTTGGATGACCCAGACACTGATATACACTCGGACTCTAAAACTGATACTAGGAGTGACTCGGAAGTCTCGGATGGGTTTGAA
                                                      consensus depths                                                                                                                  2     2     2     2     2     3     2     3     2     3     2     3     3     4     3     4     4     5     4     5     4     5     4     5     6     7    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    11    13    11    13    11    13    12    14    12    14    12    14    14    16    15    17    15    17    15    17    15    18    15    18    15    18    15    18    15    18    15    18    15    18    17    18    17    17    17    17    17    17    17    17    17    17    17    17    17    17    15    17    15    17    15    17    15    17    15    16    13    16    12    16    12    16    12    16    12    16    11    15    11    15     9    13     9    12     9    12     9    12     9    12     7    12     6    11     7    11     7    11     6     9     6     9     6     7     5     6     5     6     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4
                                               BLH ATG     282     482                                                                                                             
                                               BLH MIN     222     117                                                                                                             
                                               BLH OVR     282     925                                                                                                             
                                               ORF LNG     282      31                                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 7e-033     NP_492533.2 IRoquois subclass of homeoboX family member (irx-1) [Caenorhabditis elegans] ------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 4e-039     NP_524045.2 araucan CG10571-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Ag ---- 2e-040     XP_315117.4 AGAP005010-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ci ---- 1e-042     NP_001071746.1 transcription factor protein [Ciona intestinalis] ---------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Sp ---- 4e-044     NP_001123285.1 iroquois homeobox A [Strongylocentrotus purpuratus] -------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Gg ==== 7e-071     NP_001025509.1 iroquois homeobox protein 1 [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Mm ==== 7e-097     NP_032419.2 Iroquois related homeobox 3 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Bt ==== 7e-098     NP_001098466.1 iroquois homeobox 3 [Bos taurus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Cf ==== 5e-098     XP_544403.2 PREDICTED: similar to Iroquois related homeobox 3 [Canis familiaris] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Hs ==== 9e-099     NP_077312.1 iroquois homeobox protein 3 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Dr ==== 1e-111     NP_571342.1 iroquois homeobox protein 3 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 6e-137     CAJ82766.1 iroquois homeobox protein 3 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 2e-141     NP_001084204.1 homeobox transcription factor iriquois 3 [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7982631.5                                                                                                                                        TAG---------------------------------------------------------TGA---------------TAG---------------------------------------------------------------------------------------------------------TGA---------------------------------TAA------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2       bld Em10 5g                         IMAGE:7982563.5p                                                                                                   gagagagagagagagagagagagagagagagagagaCTAGAAGACTTGGGAGGAGCTTACGCTGGGCTTGAAATGTCAATCAGAGTGTGAGTGCCAATGATCTGAAGCAATCTGTTAGGAACTGACCTGGTCCACTCAGATCAATAGCATCAGAGGGAGAGGACAGAGTCACCGAGATCCCTGCTGGAACCCTAGCAGCCCGGTTCCCCCTTCCTCGGTCACTTGATGTGTAGGGAGAGGGGGAAACAAAGTCAGGTCATAAAAGGGGATTCCCTGTGCCTCCGGCTGCACCATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAATGCCTGGCTTCATGAGCACAGAAAGAACCTCTATCCGACCAGAGGCGAGAAAACATGCTTGCTTCATCACTAAAATGACCCTCC
  5   1   2       bld Em10 5g                         IMAGE:7979577.5p                                                                                                             gagagagagagagagagagagagagaCTAGAAGACTTGGGAGGAGCTTACGCTGGGCTTGAAATGTCAATCAGAGTGTGAGTGCCAATGATCTGAAGCAATCTGTTAGGAACTGACCTGGTCCACTCAGATCAATAGCATCAGAGGGAGAGGACAGAGTCACCGAGATCCCTGCTGGAACCCTAGCAGCCCGGTTCCCCCTTCCTCGGTCACTTGATGTGTAGGGAGAGGGGGAAACAAAGTCAGGTCATAAAAGGGGATTCCCTGTGCCTCCGGCTGCACCATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAAGGCCTGGCTCATGAGCACAGAAAGAACCCTATCCGACCAGGGCGAGAAATCATGCTGCTATCTCACTAAATGACCTCACGCAGTGTCACCTGTTTGCTACGCAGAGAGACTTAAAGAGACAATGACTGGCCCTAGAGCGACAACGAGAGTACGCTTGCGCGACCAGAAAAGCCAGACAGAGATGCTGAACTCACTGG
  5   1   2       add Ga18      out                     xlk154k19ex.5p                                                                                                                                   AGAGAGANTAGAAGACTTGNNAGGAGNTTACGCTGGGNTTGAAATGTCAATCAGAGTGTGAGTGCCAATGATCTGAAGCAATCTGTTAGGAACTGACCTGGTCCACTCAGATCAATAGCATCAGAGGGAGAGGACAGAGTCACCGAGATCCCTGCTGGAACCCTAGCAGCCCGGTTCCCCCTTCCTCGGTCACTTGATGTGTAGGGAGAGGGGGAAACAAAGTCAGGTCATAAAAGGGGATTCCCTGTGCCTNNNNNNCACCATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCNNNNNNCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGNCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGNCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTNAGGNCTGGNTCAATGAGNACAGAAAGAANCCCTATNCGACNNANGGCGAGAAANCATGCTT
  5   1   2      seed DMZ  5g3  out                        xl276m17.5p                                                                                                                                                                             GTCAATCAGAGTGTGAGTGCCAATGATCTGAAGCAATCTGTTAGGAACTGACCTGGTCCACTCAGATCAATAGCATCAGAGGGAGAGGACAGAGTCACCGAGATCCCTGCTGGAACCCTAGCAGCCCGGTTCCCCCTTCCTCGGTCACTTGATGTGTAGGGAGAGGGGGAAACAAAGTCAGGTCATAAAAGGGGATTCCCTGTGCCTCCGGCTGCACCATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAAGGCCTGGCTCAATGAGCACAGAAAGAACCCCTATCCGACCAAGGGCGAGAAAATCATGCTTGCTATCATCACTAAAATGACCCTCACGCA
  5   1   2       bld Gas9 5g                              BG409700.5p                                                                                                                                                                                                    CCCACGCGTCCGATCTGTTAGGAACTGACCTGGTCCACTCAGATCAATAGCATCAGAGGGAGAGGACAGAGTCACCGAGATCCCTGCTGGAACCCTAGCAGCCCGGTTCCCCCTTCCTCGGTCACTTGATGTGTAGGGAGAGGGGGAAACAAAGTCAGGTCATAAAAGGGGATTCCCTGTGCCTCCGGCTGCACCATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAAGGCCTGCTCAATGAGCACAGAAAGAACCCCTATCCGACCAAGGGCGAAAAAATCATGCTTGCTATCATACTAAAATGACCCTCACGCANGTGTCCACN
  5   1   2       bld Em10 5g                         IMAGE:7982631.5p                                                                                                                                                                                                                                                    AGCATCAGAGGGAGAGGACAGAGTCACCGAGATCCCTGCTGGAACCCTAGCAGCCCGGTTCCCCCTTCCTCGGTCACTTGATGTGTAGGGAGAGGGGGAAACAAAGTCAGGTCATAAAAGGGGATTCCCTGTGCCTCCGGCTGCACCATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAAGGCCTGGCTCAATGAGCACAGAAAGAACCCCTATCCGACCAAGGGCGAGAAAATCATGCTTGCTATCATCACTAAAATGACCCTCACGCAGGTGTCCACCTGGTTTGCTAACGCAAGGAGGAGACTTAAAAAGGAGAACAAAATGACTTGGGCCCCTAGGAGCCGAACAGACGAGGAAGGTAACGCCTATGGCAGCGACCACGAAGAAGACAAGCACGAGGAC
  5   1   2       bld Em10 5g                         IMAGE:8320159.5p                                                                                                                                                                                                                                                          AGAGGGAGAGGACAGAGTCACCGAGATCCCTGCTGGAACCCTAGCAGCCCGGTTCCCCCTTCCTCGGTCACTTGATGTGTAGGGAGAGGGGGAAACAAAGTCAGGTCATAAAAGGGGATTCCCTGTGCCTCCGGCTGCACCATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAAGGCCTGGCTCAATGAGCACAGAAAGAACCCCTATCCGACCAAGGGCGAGAAAATCATGCTTGCTATCATCACTAAAATGACCCTCACGCANGTGTCCACCTGGTTTGCTAACGCAAGGAGGAGACTTTAAAAGGAGAACAAATGACTTGGCCCCTAGGAGCCGACAGACGAAGAAGTAACGCCTATGCAGCGACACGAAGAGACAGCCCGAGA
  5   1   2       add Ga18 5x   ?                        xlk81d12ex.5p                                                                                                                                                                                                                                                                  GGAGAGNNNNAGTCACCGAGATCCCTGCTGGAACCCTAGCAGCCCGGTTCCCCCTTCCTCGGTCACTTGATGTGTAGGGAGAGGGGGAAACAAAGTCAGGTCATAAAAGGGGATTCCCTGTGCCTCCNNTGCACCATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCNNNGNNCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACNANNNCAATTTGGNGATCCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAAGNNCNGNNTCAATGAGCACAGAAAGAACNNNTATCCNGANCNAGGGCGAGAAAATCATGCTTGCTATCNNNACTAAAANGNNCCTCACGCAGNGTCCACCTGNNNGCTAACNCAAGNNNNGNNTTAAAAAGGAGACAAAANGNNNTGGGCCCT
  5   1   2       bld Em10 5g                         IMAGE:8319537.5p                                                                                                                                                                                                                                                                    GACAGAGTCACCGAGATCCCTGCTGGAACCCTAGCAGCCCGGTTCCCCCTTCCTCGGTCACTTGATGTGTAGGGAGAGGGGGAAACAAAGTCAGGTCATAAAAGGGGATTCCCTGTGCCTCCGGCTGCACCATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAAGGCCTGGCTCAATGAGCACAGAAAGAACCCCTATCCGACCAAGGGCGAGAAAATCATGCTTGCTATCATCACTAAAATGACCCTCACGCAGGTGTCCACCTGGTTTGCTAACGCAAGGAGGAGACTTAAAAAGGAGAACAAAATGACTTGNNGCCCTAGGAGCCGAACAGACGAGGAAAGTAACGCCTATGGCAGCGACCACGAAGAAGACNAGCACGAAGACGAGGAGGAGATTGACTTGNAGACATCGACACG
  5   1   2       bld Em10 5g                         IMAGE:8322378.5p                                                                                                                                                                                                                                                                    GACAGAGTCACCGAGATCCCTGCTGGAACCCTAGCAGCCCGGTTCCCCCTTCCTCGGTCACTTGATGTGTAGGGAGAGGGGGAAACAAAGTCAGGTCATAAAAGGGGATTCCCTGTGCCTCCGGCTGCACCATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAAGGCCTGGCTCAATGAGCACAGAAAGAACCCCTATCCGACCAAGGGCGAGAAAATCATGCTTGCTATCATCACTAAAATGACCCTCACGCAGGTGTCCACCTGGTTTGCTAACGCAAGGAGGAGACTTTAAAAGGAGAACAAAATGACTTGGGCCCCTAGGAACCGAACAGACGAAGAAGGTAACGCCTTATGGAGC
  5   1   2       bld Em10 5g                         IMAGE:7979474.5p                                                                                                                                                                                                                                                                        GAGTCACCGAGATCCCTGCTGGAACCCTAGCAGCCCGGTTCCCCCTTCCTCGGTCACTTGATGTGTAGGGAGAGGGGGAAACAAAGTCAGGTCATAAAAGGGGATTCCCTGTGCCTCCGGCTGCACCATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAAGGCCTGGCTCAATGAGCACAGAAAGAACCCCTATCCGACCAAGGGCGAGAAAATCATGCTTGCTATCATCACTAAAATGACCCTCACGCAGGTGTCCACCTGGTTTGCTAACGCAAGGAGGAGACTTAAAAAGGAGAACAAATGACTTGGGCCCTAGGAGCCGACAGACGAGGAGGTAACGCTATGGCAGCGCCACGAAGAGACAGCACGAGACAAGAGGAATGACTTGAGACATGACCTGAGACTTGAAGTAAGAGATTGATGACCAACCTGATTCCTCGATCAAACTGACTAGATGC
  5   1   2       bld Em10 5g                         IMAGE:8318228.5p                                                                                                                                                                                                                                                                        GAGTCACCGAGATCCCTGCTGGAACCCTAGCAGCCCGGTTCCCCCTTCCTCGGTCACTTGATGTGTAGGGAGAGGGGGAAACAAAGTCAGGTCATAAAAGGGGATTCCCTGTGCCTCCGGCTGCACCATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAAGGCCTGGCTCAATGAGCACAGAAAGAACCCCTATCCGACCAAGGGCGAGAAAATCATGCTTGCTATCATCACTAAAAATGACCCCTCACGCACGTGTCCACCCTGGTTTGCTAACGCAAGGAGGAGACTTAAAAAAGGAGAACAAAATGACTTGGGCCCCTAGGAGCCCGAACAGATGAGGAAAGGTAACTCCCTATGGGCACCGAACACCAAAT
  5   1   2       add Emb1                            IMAGE:3401938.5p                                                                                                                                                                                                                                                                                                                                                                                                         GTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTGGTACAGACAGAGCGTGGGGGAGACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTACGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCGTATGGAGCCTACCTGCGCTACAGCGCGGAGCTGCCATCTGCCCGTCTGGGG
  5   1   2       bld Em10                            IMAGE:8319175.5p                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAAGGCCTGGCTCAATGAGCACAGAAAGAACCCCTATCCGACCAAGGGCGAGAAAATCATGCTTGCTATCATCACTAAAATGACCCTCACGCAGGTGTCCACCTGGTTTGCTAACGCAAGGAGGAGACTTAAAAAGGAGAACAAAATGACTTGGGCCCCTAGGAGCCGAACAGACGAGGAAGGTAACGCCTATGGCAGCGACCACGAAGAAGACAAGCACGAGGACGAGGAGGAGATTGACTTGGAGAACATCGACACTGAGGACATTGAGAGTAAAGAAGATTTGGATGACCCAGACACTGATATACACTCGGACTCTAAAACTGATACTAGGAGTGACTCGGAAGTCTCGGATGGGTTTGAAGACCTAAATGTCCCTGAGGACAGACT
  5   1   2       bld Em10                            IMAGE:8321663.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAAGGCCTGGCTCAATGAGCACAGAAAGAACCCCTATCCGACCAAGGGCGAGAAAATCATGCTTGCTATCATCACTAAAATGACCCTCACGCAGGTGTCCACCTGGTTTGCTAACGCAAGGAGGAGACTTAAAAAGGAGAACAAAATGACTTGGGCCCCTAGGAGCCGAACAGACGAGGAAAGTAACGCCTATGGCAGCGACCACGAAGAAGACAAGCACGAGGACGAGGAGGAGATTGACTTGGAGAACATCGACACTGAGGACATTGGGAGTAAAGAAGATTTGGATGACCCAGACACTGATATACACTCGGACTCTAAAACTGATACTAGGGATGACTCGGACGTCTCGGATGGGTTTGAAGAACTTAATGTCCCTGAAGAAAAACTTCCTCAATCGG
  5   1   2       bld Em10                            IMAGE:8320150.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAAGGCCTGGCTCAATGAGCACAGAAAGAACCCCTATCCGACCAAGGGCGAGAAAATCATGCTTGCTATCATCACTAAAATGACCCTCACGCAGGTGTCCACCTGGTTTGCTAACGCAAGGAGGAGACTTAAAAAGGAGAACAAAATGACTTGGGCCCCTAGGAGCCGAACAGACGAGGAAGGTAACGCCTATGGCAGCGACCACGAAGAAGACAAGCACGAGGACGAGGAGGAGATTGACTTGGAGAACATCGACACTGAGGACATTGAGAGTAAAGAAGATTTGGATGACCCAGACACTGATATACACTCGGACTCTAAAACTGATACTAGGAGTGACTCGGAAGTCTCGGATGGGTTTGAGACCTAATGTTCCTGAGGACAGACTCTCAATCTGTGGTGGTCAAAGGCACTTTTAAATGAGAGCCTCAGACAGTGTGCACTTCTCTGATGCTAGTCCACAACTGCATGGACAGATCAACTAACAACTCCCCAGTCTCTCAGAAAAACATGCGAGCCCAAACAAATTGGCATGCA
  5   1   2       bld Em10                            IMAGE:7982670.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGACAATACCAATTTGGAGATCCGTCAAGGCCCAAAAATGCTACCAGAGAGAGCACAAGCACCCTTAAGGCCTGGCTCAATGAGCACAGAAAGAACCCCTATCCGACCAAGGGCGAGAAAATCATGCTTGCTATCATCACTAAAATGACCCTCACGCAGGTGTCCACCTGGTTTGCTAACGCAAGGAGGAGACTTAAAAAGGAGAACAAAATGACTTGGGCCCCTAGGAGCCGAACAGACGAGGAAGGTAACGCCTATGGCAGCGACCACGAAGAAGACAAGCACGAGGACGAGGAGGAGATTGACTTGGAGAACATCGACACTGAGGACATTGAGAGTAAAGAAGATTTGGATGACCCAGACACTGATATACACTCGGACTCTAAAACTGATACTAGGAGTGACTCGGAAGTCTCGGATGGGTTTGAAGAACTAATGTCCCTGAAGAAGACTTCTCAATCTGTGGTGGTCAAAGCAACTTTTAATGAGAACCTCAGGACAAGTGTGCCTTTCTCTGAGCAAAAGTCACACCTGCAGT
  5   1   2       bld Ga14                               Ga14-p14g9.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTCCTCNGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACANGCCTATGGAGCCTTCCTGCCCTAACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCCTTCTCCCACCCTCACCCAGCCTTTTATCCCTACGGCACATTACCAATTTGGANGATCCGTCANGGGCCCAAAAATGCTACCAGAGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)