Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6634743-IMAGp.5                28 END     15         60       53                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012771105 Xl3.1-xlk138m18ex.5 - 25 ESTs
                                                                       ......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk138m18ex.5                                                                                                                                                                                                                                                                                                                                                                                                   CATATCACTGGAGTCTGTAAAATGCCCCCACTTAGTGGATGTCTGGCTTTTCCTGAGTAACAGACACACCTTAGTGAAAAGACATTCTTGCTCGGTCCCTCCAGAAAACAGGAGAGCTGGTCGGACAGGGTGGGAGATGCAGTTTACTGATGCAAGAGGGAGAACTGGGTATCACATGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGTTAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGTAAAGTATTCCCTCAGAGAGGGGGAGCCTTAACAGATCATTGATAAAACTGTGTTGTTTGATGCAATAAAAAGTTTGGACTTT
                                                  Xl3.1-CHK-1012688699                                                                                                                                                                                                                                                                                                                                                                                                         ACTGGAGTCTGTAAAATGCCCCCACTTAGTGGATGTCTGGCTTTTCCTGAGTAACAGACACACCTTAGTGAAAAGACATTCTTGCTCGGTCCCTCCAGAAAACAGGAGAGCTGGTCGGACAGGGTGGGAGATGCAGTTTACTGATGCAAGAGGGAGAACTGGGTATCACATGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGTTAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGTAAAGTATTCCCTCAGAGAGGGGGAGCCTTAACAGATCATTGATAAAACTGTGTTGTTTGATGCAATAAAAAGTTTGGACTTTTGAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                        2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     3     6     4     7     4     8     8    12     9    12    11    13    14    16    17    18    17    18    17    18    17    19    17    19    18    19    18    19    18    19    18    19    18    19    17    19    17    19    17    19    17    19    18    19    18    19    17    18    18    19    18    19    18    19    18    18    18    19    19    20    19    20    20    21    20    21    20    21    20    21    20    21    20    21    20    21    18    21    18    21    17    21    17    21    18    21    18    21    17    21    17    21    18    21    18    21    17    21    17    20    16    20    18    22    17    22    18    22    19    22    19    22    18    22    19    22     8    22     9    22     7    21     3    17     3    10     2     5     3     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --A-G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----A-------
  5   1   2       add Ga18      in                      xlk142o02ex.5p TGCTTCCTGGAACTTTCTTGCTCTNNNNGAACATCATTGTCAGCCTGCACCCCTATGCCACCTGCTTGGATACGTTAATAGCTGCTTAAACCCTTTCCTTTATGCCTTCTTTGACTTGCGATTCCGCTCTCAATGtttttttttttttGGATTTAAGAAAGTCCTCCAAGGGCACCTCAGCAACACATCTTCCAGTTTAAGTGCACAGACTCAAAAATCCGAAATTCACTCACTAGCCACAAAGGTCTAATTCGGCAAAGGGACATTTCATTGGGTGTGGGGGCAGAGACTTTGTTCTAAAGACTTTTAGGGTTGATTGAACGTTATCTCTTGTTGCTGCAAAGGGAAGCTGATTACAGAACAGGGACTTACACAGTCTACTGGATCATATCACTGGAGTCTGTAAAATGCCCCCACTTAGTGGATGTCTGGCTTTTCCTGAGTAACAGACACACCTTAGTGAAAAGACATTCTTGCTCGGTCCCTCCAGAAAACAGGAGAGCTGGTCGGACAGGGTGGGAGATGCAGTTTACTGATGCAAGAGGGAGAACTGGGTATCACATGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGNAATTTTGGAGNNNAATGNAATTNCAATNNTATTTAACCANTTCACTTCTGTGAGAAAGTCCCACAATTTGNG
  3   1   2       bld Ga18      in                      xlk142o02ex.3p                                                                                                                                                                                                                                                                                                                                                   ANANGGGNANCNNNNTACNGAACAGGGNNTNACACAGTCTACNGGATCATATCNCTGGANNCTGTAAAATGCCCCCACTTAGNGGATGTCTGGCTTTTCCTGAGTAACAGNCACNCNTTAGTGNAAAAGACATTCTNGCTCGNTCCCTCCAGAAANCAGGAGAGCTGGTCGGACAGGGTGGGAGATGCAGTTTACTGATGCAAGAGGGAGAACTGGGTATCACATGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGATAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGTAAAGTATTNCCTCAGAGAGGGGGANCCNNANCAGNTCATTGATAAAAC
  3   1   2       add Ga18      out                     xlk135k10ex.3p                                                                                                                                                                                                                                                                                                                                                                                       TCTACTGGATCATNTNNCTNNANTCTGTAAANTNCCCCCACTTAGNNGATNTCTGGCTTTTCCTGAGTAANAGACACNCCTNAGTGNAAAAGACATTCTNGCTCGNTCCCTCCAGAANACANNAGAGCTGGTCGGACAGGGNTGGGAGATGCAGNTTACTGATGCAAGAGGGAGANCTGGGTATCACATGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATATGTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAAAGGTAATTTTGGAATGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGTTAATAAAAAAAGCAAAGAATCCCTTTGTAGGGTTAAACTATAGGCCCCTATGGCAGTTGTTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATTATCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTAATTTGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATnCTTATAGCATATATATATGTGTAAAGTANNNNNNAGAGAGGGGGANNCNNANCNGNTCATNGANAAAAC
  5   1   2       bld Lu1       in                    IMAGE:4058567.5p                                                                                                                                                                                                                                                                                                                                                                                        GTCTACTGGATCATATCACTGGAGTCTGTAAAATGCCCCCACTTAGTGGATGTCTGGCTTTTCCTGAGTAACAGACACACCTTAGTGAAAAGACATTCTTGCTCGGTCCCTCCAGAAAACAGGAGAGCTGGTCGGACAGGGTGGGAGATGCAGTTTACTGATGCAAGAGGGAGAACTGGGTATCACATGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGGAGGTGAACTGGTTAAAAAGCCGGGTAAATTAACCACTGTCTTGAACCCTT
  3   1   2       bld Thy  5g3  out                   IMAGE:8550351.3p                                                                                                                                                                                                                                                                                                                                                                                              GTGGCGGTGTTAGTTAGTATACTATTGTTCAGGAGGATCGACGGATCCGTTTGATATTCAGATCGTAAGCCCATAGTGAGTTGCTTCNGATACAGCCCTAGGAAAGACTTCTGTCGTCCTCAGAAACAGAGAGTGTCGACAGGTGGAGATGCAGTTACTGAGCAGAGGGAGAACTGNTATCACATGGGTAACACATGCTGTTATTGCTGGATTCTTCTTTGCATTGNAGAACTATTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGATAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGTAAAGTATTCCCTCAGAGAGGGGGAGCCTTACCAGATCATTGTAAAGCGCTGGGTCCCTCAGCTTA
  3   1   2       bld Ga12 5g3  out                        XL206d14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCNTCCAGAAAACAGGAGAGCTGGTCGGACAGGGTGGGAGATGCAGTTTACCTGATGCAAGAGGGAGAACTGGGTATCACATGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGTTAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATACTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGTAAAGTATTCCCTCAGAGAGGGGGAGCCTTAACAGATCATT
  3   1   2       bld DMZ       out                        xl327k24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAACCAGGAGAGCTGGTCGGACAGGGTGGGAGATGCAGTTTACTGATGCAAGAGGGAGAACTGGGTATCACATGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGTTAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCNTATGTACTGTGCCNCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATACTGTGTAAAGTATTCCCTCAGAGAGGGGGAGCCTNAACAGATCA
  3   1   2       bld Tbd7      out                        XL064h24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGGACAGGGTGGNAGATGCAGTTTACTGATGCAAGAGGGAGAAACTGGGTATCACATGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGTTAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGATTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGTAAGTATTCCCTCAGAGAGGGGGAGCCTTAACAGATCATNATAAAACTGTG
  3   1   2       bld DMZ       out                        xl243d10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGACAGGGTGGGAGATGCAGTTTACTGATGCNAGAGGGAGAACTGGGTATCACATGGGTTAACACATGCTGTATATTGCTGGNNTTCTTCTTTGCATTTGAGANCTATTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGTTAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCCGTATAnGTATGTGTGTTTATGTATATACTTATAGCATATATATACTGTGTAAAGTATTCCCTCAGAGAGGGGGAGCCNNAACAGATCA
  3   1   2       bld Ga18      in                      xlk138m18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TNCGCTTTGGAGATGCAGTTTACTGATGCAAGAGGGAGAACTGGGTATCACATGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGATAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGTAAAGTATNCCTCAGAGAGGGGGANCCTTAACAGATCATTGATAAAACT
  5   1   2       bld Ga18      in                      xlk138m18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGGAGATGCAGTTTACTGATGCAAGAGGGAGAACTGGGTATCACATGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGATAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGNGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCagtatatgtatgtgtgtttatgtatatacttatagcatatatatatgtgtaAAGNANTCCCTCAGAGAGGGGGAGNCTTAACAGATCATTGATAAAACTGTGTTGTTTGATGCAATAAAAAGTTTGGACTTTNNNANANNNAAA
  3   1   2       add Neu7 5g3  out                        XL033n17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GNAGATGCAGTTTACTGATGCAAGAGGGAGAACTGGGTATCACATGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATATGTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAAAGGTAATTTTGGAATGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGTTAATAAAAAAGCAAAGAATCCCTTTGTAGGGTTAAACTATAGGCCCCTATGGCAGTTGTTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATTATCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTAATTTGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGTAAGTATTCCCTCAGAGAGGGGGAGCCTTAACAGATCATNATAAAACT
  3   1   2      seed Ga12 5g3  out                        XL144l24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGATGCAAGAGGGAGAACTGGGTATCACATGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGTTAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGnAAGTATTCCCTCAGAGAGGGGGAGCCTTAACAGATCAT
  5   1   2       bld Lmb2                            IMAGE:8638240.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGGGTATCACATGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGATAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCagtatatgtatgtgtgtttatgtatatacttatagcatatatatatgtgtaAAGTATTCCCTCAGAGAGGGGGAGCCTTAACAGATCATTGATAAAACTGTGTTGTTTGNATGCATAAAAAGTTTGGACTTTTGaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGCGCCCGCAGCTGATTCTCTAGACGCGCTCGAGCCTCGCCTATATGATCTATACTAGTCAGACTGAAGATACTGTGATTG
  3   1   2       add Neu7 5g3  out                        XL025b17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATCACATGGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATATGTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAAAGGTAATTTTGGAATGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGTTAATAAAAAAGCAAAGAATCCCTTTGTAGGGTTAAACTATAGGCCCCTATGGCAGTTGTTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATTATCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTAATTTGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGTAAGTATTCCCTCAGAGAGGGGGAGCCTTAACAGATCATNATAAAACT
  3   1   2       bld Tbd7      out                        XL104j02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTATCACATGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATTTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGTTAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGTAAGTATTCCCTCAGAGAGGGGGAGCCTTAACAGATCATNATAAAACTGTGTGTTNAGCAATAAAAAGT
  3   1   2       bld Neu7 5g3  out                        XL047e10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCACATGGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGATAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGTAAAGTATTCCCTCAGAGAGGGGGAGCCTTAACAGATCATNATAAAACTGTGTTGTTNAGCAATAAAAAG
  3   1   2       bld Tbd7                                 XL093f06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCACATGGGGTTAACACATGCTGTATATTGCTGGATTTCTTCTTTGCATTTGAGAACTATTTTTGCTTTCCTGTATATATTTTGCTTGTTAAAGCACTTGTATGATACACTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAATGTAATTGCAATGCTATTTAACCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGTTAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGnAAGTATTCCCTCAGAGAGGGGGAGCCTTAACAGATCATTATAAAACTGTGTGTTTAGCAATAAAAAGTT
  3   1   2       add Ga18      out                      xlk66f13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GNATTTGAGANNNNNNTTTGCTTTCCTGTATATNTTTTGCTTGTTAAAGCACTTGTATGATACNCTTTTAACACATTGTTTAATGGTAATTTTGGAGTGTAANGTAATTGCAATGCTATTTANCCAATTCACTTCTGTGAGAAAGTCCCACAATTTGAGGTGAACTGGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGATAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCNNCAAANCTCNGANTGGATTAAAACANGTAGAGATGGTAAAAGAGGGAACTNCNAGACACAAAAANCTGCAAACTATTNCCAAAGATAAAGGNCTNCTGAATGCTGTTANTCTGTNNCTGGTGTAAGTNAATTNCTTCTTATCCTNATGTACTGTNCCTCAGTATATGTATGTGTGTTTATGTATATNCNTATAGNATATATATATGTGTAAAGTANNNCCTNAGAGAGGNGGA
  3   1   2       bld Tbd7      out                        XL094f06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTTAAAAAGCAGGTAAAATTAACAACTGTCTTGAACCCTTAGTTAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGTAAAGTATTCCCTCAGAGAGGGGGAGCCTTAACAGATCATNATAAAACTGTGTGTTNATGCAATAAAAAGTT
  3   1   2       bld Tbd7 5g3  out                        XL102f13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGTTAATAAAAAAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGNAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGTAAAGTATTCCCTCAGAGAGGGGGAGCCTTAACAGTATCATTGNATAAAACTGTGTTGTT
  3   1   2       bld Sp1  5g3  out                   IMAGE:4965654.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGCAGAGAATCCCTCTGTAGGGTTAAACTATAGGCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTTAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGAGTATGCAGGTTTACCACCAAAACTCCCATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACAAAAAAACTGCAAAATATTACCAAAGATAAAGGACTACTGAATGCTGTTATTCTGTGACTGGTGTAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGTAAAGTATTCCCTCAGAGAGGGGGAGCCTTAACAGATCATTGATAAAACTGT
  3   1   2       bld Tbd1                                 AW782431.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCCTTATGGCAGTTGGTCTGAACTACCACTTAAAGTGTACCCAAACAGCCAGTATCTGGCTGAGGATGCTGGGAATTGTAGTTTGCATATCCTCCTCCAGATTATGCAGGTTTACCACCAAAACTCTGATTGGATTAAAACATGTAGAGATGGTAAAAGAGGGAACTACTAGACACAAAAAACTGCAAACTATTACCAAAGATAAAGGACTACTGAATGCTGTT
  3   1   2       bld Sp1                             IMAGE:4173588.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGTAAAGTATTCCCTCAGAGAGGGGGAGCCTTAACAGACCATTGATAAAACTGTGTTGTTTGATGCAATAAAAAGTTTGGACTTTGAAAAAAA
  3   1   2       bld Lu1       in                    IMAGE:4058567.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGTCAATTGCTTCTTATCCTTATGTACTGTGCCTCAGTATATGTATGTGTGTTTATGTATATACTTATAGCATATATATATGTGTAAAAGTATTCCCTCAAGAGAGGGGGAGCCTTAACAGATCATTGATAAAACTGTGTTGTTTGATGCAATAAAAAGTTTGGACTTTGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)