Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 27 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7204517.5                      32 PI      91         35     1133                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012771124 Xl3.1-IMAGE:8076147.5 - 23 ESTs
                                                                       -30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8076147.5                               GGTTACTCAGCCAGTGCGTCCACATTGCTCAAGGGAACCTGAAATAAACGCTCACCGCGATGTTGTTCGTAGCTCTGAAACAGGCGGCGCTTGGGCAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCCGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGCCACGCAGACCACATCACTGGCACGGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAAATCAAGTTTGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATCAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGCCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCAACAACTGCCTTCTGTACCCTGGGCATGACTACACAGGTCAGACTGTGTCATCAGTAGAGGAAGAGAAGCGCCTGAACCCTCGACTCACTAAAGACGAAGCGGAGTTTGTGAAGATCATGAACAATTTAAACCTGCCCAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGCATCCAGGATCCCTGATGACATCACTTTTATCCCGATGACCTCATTCTGATGTCTAACCAGCTGCTGGCCGTAACATTAGAAAGAAAATGGAACTTTCTATTTCTACAATATTTTTGTATGAGGGGCAGGTGACTAAATGCTCCTTTTATTTTTAACGGATGAAACAATGTTTGTCATGTTCTTTCGGGGAAATGGTTTTGCTTGCCTTTTTAAAGTTCATACAATGAGCTCATACCTGCTTGATGCCTTCCAAAAAAAATGATCTCTTTTGATAGCCCATGCCCAGGTACAGAGCCTGCATTGCTGTATATATTGTAAATTATTATTTGTTTTTCAAGTA
                                                  Xl3.1-CHK-1012689144                                     TCAGCCAGTGCGTCCACATTGCTCAAGGGAACCTGAAATAAACGCTCACCGCGATGTTGTTCGTAGCTCTGAAACAGGCGGCGCTTGGGCAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCCGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGCCACGCAGACCACATCACTGGCACGGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAAATCAAGTTTGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATCAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGCCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCAACAACTGCCTTCTGTACCCTGGGCATGACTACACAGGTCAGACTGTGTCATCAGTAGAGGAAGAGAAGCGCCTGAACCCTCGACTCACTAAAGACGAAGCGGAGTTTGTGAAGATCATGAACAATTTAAACCTGCCCAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGCATCCAGGATCCCTGATGACATCACTTTTATCCCGATGACCTCATTCTGATGTCTAACCAGCTGCTGGCCGTAACATTAGAAAGAAAATGGAACTTTCTATTTCTACAATATTTTTGTATGAGGGGCAGGTGACTAAATGCTCCTTTTATTTTTAACGGATGAAACAATGTTTGTCATGTTCTTTCGGGGAAATGGTTTTGCTTGCCTTTTTAAAGTTCATACAATGAGCTCATACCTGCTTGATGCCTTCCAAAAAAAATGATCTCTTTTGATAGCCCATGCCCAGGTACAGAGCCTGCATTGCTGTATATATTGTAAATTATTATTTGTTTTT
                                                      consensus depths                                    2     2     3     3     5     6     5     6     7     8     9    10    10    11    11    11    12    12    12    12    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    16    18    16    18    16    20    15    20    14    20    17    21    16    21    17    21    17    21    17    21    17    21    16    20    16    20    16    19    16    19    16    19    16    19    16    19    16    18    16    18    16    18    14    18    15    18    15    18    15    18    15    18    14    17    14    17    13    16    11    15    10    15    10    15     9    15     9    15     8    15     8    13     8    11     8    11     8    10     7     8     7     8     6     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     8     7     8     8     8     8     8     8     8     8     8     8     8     7     8     6     8     6     8     6     8     4     7     3     6     2     5
                                                                   SNP                                                                                                                                                                                                                   ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                               ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --GG--------
                                               BLH ATG      53     315                               
                                               BLH MIN      53     135                               
                                               BLH OVR      53     818                               
                                               CDS MIN      53       3                               
                                               EST CLI      -6       3                               
                                               ORF LNG      53      38                               
  5   1   2       bld Te1  5g                         IMAGE:6928374.5p GGGACCCCTCTGTAATAATACGCGATTCATGGTTACTCAGCCAGTGCGTCCACATTGCTCAAGGGAACCTGAAATAAACGCTCACCGCGATGTTGTTCGTAGCTCTGAAACAGGCGGCGCTTGGGCAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCCGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGGCACGCAGACCACATCACTGGCACGGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCCCGTGCCGATCTCTACAACGGGGAAGGAGATCCAATCAAGTTTGGGAAATTTTGGGTAAAGGCGCGTTCCACTCCAAGACAAACAAAACGGCTGCCTCACATACTTACTGAATGATAAGAGCCTGGGCGTTTACTGGAAGATGCGCCTTCTCATCAAAAGGTGCGGGACCAAAAGATTTTCCAGGCAGGGGTTTGTCCCAAAAACTCTGGTACCCCTCCTGGAGGCACAGCATAGAAAATTCTTACCCTGGCCCGGGGTAACCTGGCCTTTCTGAGAACCCCTGGGGCCATGAACCTTACCCAAAGGGACAAAAACATGTTTTTCTCTCCCAGTTAtaaacggaaaaaaagaaacgcccccctttgaaacccctccccccAAACTCTACCCGTAGAAGAGAA
  5   1   2       bld FaBN 5g                         IMAGE:8075447.5p                               GGTTACTCAGCCAGTGCGTCCACATTGCTCGAGGGAACCCGATATAAACGCTCACCGCGATGTTGTTCGTAGCTCTGAAACAGGCGGCGCTTGGGCAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCTGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGCCACGCAGACCACATCACTGGCACGGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGTGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAATCAAGTTTGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAAAGCATGGCGTTTACTGGAGAATGC
  5   1   2       bld Tad2      in                    IMAGE:6875155.5p                                           AGTGCGTCCACATTGCTCGAGGGAACCCGATATAAACGCTCACCGCGATGTTGTTCGTAGCTCTGAAACAGGCGGCGCTTGGGCAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCTGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGCCACGCAGACCACATCACTGGCACAGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGTGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAAATCAAGTTTGGGAAATTTTGGGTAGAGGCCCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATCAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGCCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCAACAACTGCCTACTGTACCCTGNGCATGACTACACAGGGTCAGACTGTGTCATCCAGTAGAGGGAAGAGAAGCGCCCTGAACCCTCGACTCACTANAGAACGAAAGGCGGAGTTTGGTGAAAGATCATGAAACAANTTTTAAACCTGCCCCAAACTAAAAACAGAA
  5   1   2       bld Emb4 5g3  in                    IMAGE:5536726.5p                                              CCCACGCGTCCGCCCACGCGTCCGTGAAATAAACGCTCACCGCGATGTTGTTCGTAGCTCTGAAACAGGCGGCGCTTGGGCAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCCGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGCCACGCAGACCACATCACTGGCACGGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAAATCAAGTTTGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATCAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGCCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCGGCAACTGCCTTCTGTACCCTGNGCATGACTACACAGGTCAGACTGTGTCATCAGTAGAGGAAGAGAAGCGCCTGAACCCTCGACTCACTAAAGA
  5   1   2       bld Emb4 5g                IMAGE:5537336-IMAGp.IMAGp                                                    ACATTGCTCAAGGGAACCTGAAATAAACGCTCACCGCGATGTTGTTCGTAGCTCTGAAACAGGCGGCGCTTGGGCAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCCGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGCCACGCAGACCACATCACTGGCACGGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAAATCAAGTTTGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATCAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGCCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCGGCAACTGCCTTCTGTACCCTGGGCATGACTACACAGGTCAGACTGTGTCATCAGTAGAGGAAGAGAAGCGCCTGAACCCTCGAC
  5   1   2       bld Emb4 5g                         IMAGE:5537336.5p                                                     CATTGCTCAAGGGAACCTGAAATAAACGCTCACCGCGATGTTGTTCGTAGCTCTGAAACAGGCGGCGCTTGGGCAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCCGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGCCACGCAGACCACATCACTGGCACGGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAAATCAAGTTTGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATCAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGCCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCCGGAACTGCCTTCTGTAACCTGGGGCATGACTACACCGGTCCGACTGTGGTCATCCGTAAAGGAAAGACAAGCCGCCTGAACCCCTCGACTCCCCTAAAGACCAAACCGGGAATTTTGTGGAAGACCCTGGAACAAATTTAAACCCTGGCCCAAACCTAAACAAAATAAAGGGTTGCTGGTTTCACGCCCACTTGCAAATGTCGCCATCCCCGAAATCCCCGGAGGAACTCACCTTTTTATCCCCCATGGACCCTCCTTTCCGGAGGGCCAAAACCACACTGCGTGGGCCGCGTACACTTTAGAAAACAAAAAGGGGAATCTTTTCTACTTTTCCACACAGTATTATTTTGATAGCAGACGGGAAGCGTGGACACCACAGTGCTCCCTTTN
  5   1   2       bld FaBN 5g3  in                    IMAGE:8076147.5p                                                                    CCCGATATAAACGCTCACCGCGATGTTGTTCGTAGCTCTGAAACAGGCGGCGCTTGGGCAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCTGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGCCACGCAGACCACATCACTGGCACGGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGTGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAAATCAAGTTTGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATTAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGCCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCAACAACTGCCTTCTGTACCCTGGGCATGACTACACAGGTCAGACTGTGTCATCAGTAGAGGAAGAGAAGCGCCTGAACCCTCGACTCACTNAAGACGAAGCGGAAGTTGTGAAGATCATGAACAATTTAACCTGCCCAACCTAANCGATAGATGTTGCTGTTCAGCCACTTGAATGCG
  5   1   2       bld Neu7 5g3  in                         XL043c02.5p                                                                              CACGAGGCCGCGATGTTGTTCGTAGCTCTGAAACAGGCGGCGCTTGGGCAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCCGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGCCACGCAGACCACATCACTGGCACGGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGTGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAAATCAAGTTTGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATCAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGCCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCGGCAACTGCCTTCTGTACCCTGGGCATGACTACACAGGTCAGACTGTGTCATCAGTAGA
  5   1   2       bld Lu1  5g3  in                    IMAGE:4057918.5p                                                                                  TCACCGCGATGTTGTTCGTAGCTCTGAAACAGGCGGCGCTTGGGCAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCCGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGCCACGCAGACCACATCACTGGCACGGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCCCGTGCCGATCTCTACATACAGGAAGGGAGATCAAAATTAAAGTTTGGGAAAATTTTGGGTAAGAAGGCGCCGTTCCACTTTCCAGGACACACA
  5   1   2       bld Skin 5g3  in                    IMAGE:8641224.5p                                                                                    TCCCGCGATGTTGTTCGTAGCTCTGAACAGGCGGCGCTTGGGCAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCCGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGCCACGCAGACCACATCACTGGCACGGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAAATCAAGTTTGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATCAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGTCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCGGCAACTGCCTTCTGTACCCTGGGCATGACTACACAGGTCAGACTGTGTCATCAGTAGAGGAAGAGAAGCGCCTGAACCCTCGACTCACTAAAGACGAAGCGGAGTTTGTGAGATCATGAAACATTTAACCTGCCAAACCTAACAGATAGATGTGCTGTTCAGCCACTTGAATGCGGCATCAG
  5   1   2       bld Eye1                            IMAGE:4756985.5p                                                                                             TTGTTCGTTGCTCTGAAACAGGCGGCGCTTGGGCAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCCGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGCCACGCAGACCACATCACTGGCACGGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAAATCAAGTTTGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATCAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGTCCCAAAACTCTGTAC
  5   1   2       bld Tad2                            IMAGE:6933796.5p                                                                                                                            GGGAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCCGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGCCACGCAGACCACATCACTGGCACGGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAAATCAAGTTTGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATCAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGTCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCGGCAACTGCCTTCTGTACCCTGNGCATGACTACACAGGTCAGACTGTGTCATCAGTAGAGGAAGAGAAGCGCCTGAACCCTCGACTCACTAAAGACGAAACGGAAGTTTNGTGAAGATCATGAAACAATTTAAACCCTGCCCCAAAACCTAAAACAGATAGATGGTTTGCTGTTTCCAGCCCAAACTTGAAAATTGCGGGCAAC
  5   1   2       bld Egg1                               PBX0075H10.5p                                                                                                                                                GCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCTGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGCCACGCAGACCACATCACTGGCACAGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGTGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAAATCAAGTTTGGGAAATTTTGGGTAGAGGCCCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCA
  5   1   2       bld DMZ       in                         xl286p01.5p                                                                                                                                                GCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCTGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGCCACGCAGACCACATCACTGGCACGGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGTGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAAATCAAGTTTGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATTAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGCCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCAACAACTGCCTTCTGTACCCTGGGCATGACTACACAGGTCAGACTGTGTCATCAGTAGAGGAAGAGAAGCGCCTGAACCCTCGACTCACTAAAGACGAAGCGGAGTTTGTGAAGATCATGAACAATTTAAACCTGCCCAAACCTAAACAGATAGAATGTTGCTGTTCCAGCCAACTTGAAATGCGGCATCCAGGATCCCTGATGACATCACTTTTATC
  5   1   2      seed DMZ       in                         xl255k03.5p                                                                                                                                                GCTATGGCTGCCAGCAGTGGTCTCGTCTTCAGGCAGTTGTTTGAACCAGTGAGTTGTACGTACACTTACCTACTGGCTGATAAAAACACCAAGGAGGCCATTCTTATTGACCCGGTGCTGGATAAAGCAGAGCGAGATGCAAAACTCATCAAGGACCTTGGGCTCAATATGATCTATGCAGCCAACACCCACTGCCACGCAGACCACATCACTGGCACGGGCATTCTGAAGAAGCTTCTCCCTGGCTGCAAAAGTGTCATCTCCAAGGACAGCGGTGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAAATCAAGTTTGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATTAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGCCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCAACAACTGCCTTCTGTACCCTGGGCATGACTACACAGGTCAGACTGTGTCATCAGTAGAGGAAGAGAAGCGCCTGAACCCTCGACTCACTAAAGACGAAGCGGAGTTTGTGAAGATCATGAACAATTTAAACCTGCCCAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGCATCCAGGATCCCTGATGACATCACTTTTA
  3   1   2       chi Tad2      in                    IMAGE:6875155.3p                                                                                                                                                                                                                                               GGGTGCCGGAAATGCCCAGGGTCCCCGTGGAGAACCCGGACCCTTGTGCGAGAAAGAAAGGATTTTTTCCACCTTGGGTTACGCCAAAATTTTTTTTTATGGTCGCCCAAATTTGCCCTAAGGGGTGGCCCCGGGGACAGGAATTTGGTTGTAATTACGGGGAAAAGGGGGATTGGAAGTTCAAAGGTTTGGGAAAAATTTTTGGATTAAAATGGGCCCCCGTTTCCCATTCCACAGGACCCGCACAGGGTCGGGCTGGCCTTCAACATTGTGTTACTAAAGGGCGTAGGGAGCCGTGGCTTTTTACCGGGAGAATGGCGCTTTTTCATCAGAGGTTGGCGGACGAGGCAGATTTCCCGCGAGGGTTGCCGCCGAAACTCTGTACCACTCTGTGCGCAGCAGGATATTCTCCCTGCCCAACAAATGCTTACTGTACCCTGGGCATGACTACACAGGTCAGACTGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCTCGACTCACTAAAGACGAAGCGGAGTTTGTGAAGATCATGAACAATTTAAACCTGCCCAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGCATCCAGGATCCCTGATGACATCACTTTTATCCCGATGACCTCATTCTGATGTCTAATCATCTGCTGGCCGTAACATTAGAAAGAAAATTGAACTTTCTATTTGTACATTATTTTTGTATGAGGGGCAGGTGACTAAATGCTCCTTTTATTTTTAACGGATGAAACAATGTTGTCATGTTCTTTCGGGGAAGATGGTTTTGCTTGCCTTTTTAAAGTTCATAGAATGAGCTCATACCTGCTTGATGCCTTCCAAAAAAAAAATTATCTCTTTTTTAGCCCGGGTACAGAGCCTGCATTGCCCCCTTTTGGAAAGTTAANNNTTTTCNNNCCCGACGCCTGTTGCAAGTAGGGGATAAAAAATCGTTTAAAGAAAGTAT
  3   1   2       bld FaBN 5g3  in                    IMAGE:8076147.3p                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAGTTCTCTCCAGGACAGCGTGCCCGTGCCATCTCTACATACAGGAGGAGATCAAATCAAGTTGGGAAATTTTGGTAGAGGCGCGTTCCACTNCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATTAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGCCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCAACAACTGCCTTCTGTACCCTGGGCATGACTACACAGGTCAGACTGTGTCATCAGTAGAGGAAGAGAAGCGCCTGAACCCTCGACTCACTAAAGACGAAGCGGAGTTTGTGAAGATCATGAACAATTTAAACCTGCCCAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGCATCCAGGATCCCTGATGACATCACTTTTATCCCGATGACCTCATTCTGATGTCTAATCAGCTGCTGGCCGTAACATTAGAAAGAAAATGGAACTTTCTATTTCTACAATATTTTTGTATGAGGGGCAGGTGACTAAATGCTCCTTTTATTTTTAACGGATGAAACAATGTTTGTCATGTTCTTTCGGGGAAATGGTTTTGCTTGCCTTTTTAAAGTTCATACAATGAGCTCATACCTGCTTGATGCCTTCCAAAAAAAATGATCTCTTTTGATAGCCCATGCCCAGGTACAGAGCCTGCATTGCTGTATATATGAAATTATATTGTTAGGACATCGCTTAA
  3   1   2       bld DMZ       in                         xl255k03.3p                                                                                                                                                                                                                                                                                                                                                                                                                   TCTCCAAGGACAGCGGTGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAAATCAAGTTTGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATTAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGCCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCAACAACTGCCTTCTGTACCCTGGGCATGACTACACAGGTCAGACTGTGTCATCAGTAGAGGAAGAGAAGCGCCTGAACCCTCGACTCACTAAAGACGAAGCGGAGTTTGTGAAGATCATGAACAATTTAAACCTGCCCAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGCATCCAGGATCCCTGATGACATCACTTTTATCCCGATGACCTCATTCTGATGTCTAACCAGCTGCTGGCCGTAACATTAGAAAGAAAATGGAACTTTCTATTTCTACAATATTTTTGTATGAGGGGCAGGTGACTAAATGCTCCTTTTATTTTTAACGGATGAAACAATGTTTGTCATGTTCTTTCGGGGAAATGGTTTTGCTTGCCTTTTTAAAGTTCATACAATGAGCTCATACCTGCTTGATGCCTTCCAAAAAAAATTATCTCTTTTGATAGCCCATGCCCAGGTACAGAGCCTGCATTGCTGTATATAT
  3   1   2       bld Skin 5g3  in                    IMAGE:8641224.3p                                                                                                                                                                                                                                                                                                                                                                                                                                GGCGCGCCCGTGCCGATCTTTACATACAGGAAGGAGATCAAATCAGTTTGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATCAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGTCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCGGCAACTGCCTTCTGTACCCTGGGCATGACTACACAGGTCAGACTGTGTCATCAGTAGAGGAAGAGAAGCGCCTGAACCCTCGACTCACTAAAGACGAAGCGGAGTTTGTGAAGATCATGAACAATTTAAACCTGCCCAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGCATCCAGGATCCCTGATGACATCACTTTTATCCCGATGACCTCATTCTGATGTCTAACCAGCTGCTGGCCGTAACATTAGAAAGAAAATGGAACTTTCTATTTCTACAATATTTTTGTATGAGGGGCAGGTGACTAAATGCTCCTTTTATTTTTAACGGATGAAACAATGTTTGTCATGTTCTTTCGGGGAAATGGTTTTGCTTGCCTTTTTAAAGTTCATACAATGAGCTCATACCTGCTTGATGCCTTCCAAAAAAAATGATCTCTTTTGATAGCCCATGCCCAGGTACAGAGCCTGCATTGCTGTATATATGTAATTATATTGNNCCNAAATCCNNCCCCNNNNCCCACC
  3   1   2       bld DMZ       in                         xl286p01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGCCCGTGCCGATCTCTACATACAGGAAGGAGATCAAATCAAGTTTGGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATTAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGCCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCAACAACTGCCTTCTGTACCCTGGGCATGACTACACAGGTCAGACTGTGTCATCAGTAGAGGAAGAGAAGCGCCTGAACCCTCGACTCACTAAAGACGAAGCGGAGTTTGTGAAGATCATGAACAATTTAAACCTGCCCAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGCATCCAGGATCCCTGATGACATCACTTTTATCCCGATGACCTCATTCTGATGTCTAACCAGCTGCTGGCCGTAACATTAGAAAGAAAATGGAACTTTCTATTTCTACAATATTTTTGTATGAGGGGCAGGTGACTAAATGCTCCTTTTATTTTTAACGGATGAAACAATGTTTGTCATGTTCTTTCGGGGAAATGGTTTTGCTTGCCTTTTTAAAGTTCATACAATGAGCTCATACCTGCTTGATGCCTTCCAAAAAAAATTATCTCTTTTGATAGCCCATGCCCAGGTACAGAGCCTGCATTGCTGTATATATGAAATATATT
  3   1   2       bld Emb4 5g3  in                    IMAGE:5536726.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAATCAAGTTTGGGAAATTTTGGGTAGAGGCGCGTTCCACTCCAGGACACACAGACGGCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATCAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGCCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCGGCAACTGCCTTCTGTACCCTGGGCATGACTACACAGGTCAGACTGTGTCATCAGTAGAGGAAGAGAAGCGCCTGAACCCTCGACTCACTAAAGACGAAGCGGAGTTTGTGAAGATCATGAACAATTTAAACCTGCCCAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGCATCCAGGATCCCTGATGACATCACTTTTATCCCGATGACCTCATTCTGATGTCTAACCAGCTGCTGGCCGTAACATTAGAAAGAAAATGGAACTTTCTATTTCTACAATATTTTTGTATGAGGGGCAGGTGACTAAATGCTCCTTTTATTTTTAACGGATGAAACAATGTTTGTCATGTTCTTTCGGGGAAATGGTTTTGCTTGCCTTTTTAAAGTTCATACAATGAGCTCATACCTGCTTGATGCCTTCCAAAAAAAATGATCTCTTTTGTATAAAGCATGCCCAGGTACAGAGCCTGCATTGCTGTATATATTTAAATTATANTGTTCAAGAA
  3   1   2       bld Neu7 5g3  in                         XL043c02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTGCCTCACATACGTACTGAATGATAAGAGCATGGCGTTTACTGGAGATGCGCTTCTCATCAGAGGCTGCGGACGAACAGATTTCCAGCAGGGTTGCCCCAAAACTCTGTACCACTCTGTGCACAGCAAGATATTCTCCCTGCCCGGCAACTGCCTTCTGTACCCTGGGCATGACTACACAGGGTCAGACTGTGTCATCAGTAGAGGAAGAGAAGCGCCTGAACCCTCGACTCACTAAAGACGAAGCGGAGTTTGTGAAGATCATGAACAATTTAAACCTGCCCAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGCATCCAGGATCCCTGATGACATCACTTTTATCCCGATGACCTCATTCTGATGTCTAACCAGCTGCTGGCCGTAACATTAGAAAGAAAATGGAACTTTCTATTTCTACAATATTTTTGTATGAGGGGCAGGTGACTAAATGCTCCTTTTATTTTTAACGGATGAAACAATGTTTGTCATGTTCTTTCGGGGAAATGGTTTTGCTTGCCTTTTTAAAGTTCATACAATGAGCTCATACCTGCTTGATGCCTTCCAAAAAAAATGATCTCTTTTGATAGCCCATGCCCAGGTACAGAGCCTGCATTGCTGTATATATTGTAAATTATTATTTGTTTTTCAAGTAAAAT
  3   1   2       bld Lu1  5g3  in                    IMAGE:4057918.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTTGCTTGCCTTTTTAAAGTTCATACAATGAGCTCATACCTGCTTGATGCCTTCCAAAAAAAATGATCTCTTTTGATAGCCCATGCCCAGGTACAGAGCCTGCATTGCTGTATATATTGTAAATTATTATTTGTTTTTCAAGTAAAATATCGATCCCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)