Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012771213 Xl3.1-IMAGE:5156957.5 - 24 ESTs
                                                                       ..-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5156957.5                                                                                                                                                                                                                                                                                                               TACACATAACGTCACGCGGGGACGAATCGCTACTAGGGACAAGGCTCAACTGTGACCCAAGGTGACTGGAGAGAATGGGAGCCCACCTTGCCCGGAGATACTGGGGGGAACCGGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGGCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTAATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCATAAAATCCTGCAAGCTTGCATATTCTTCTGTACTAAGCACAATTCAGCAGGAAGAGCACCTAATTCTGCTCACAGCTCCTACAAAGAGTTTCAAAATGTCAGTGTGCGTTTTAGCGTATCCATAGTAAAACCACCACCAAAATACACAGTATATGTAATATGTAACTTCTATGAACCTAACATATAATTGGTGTATTTTAATGTTAATGGGTGACACTGTGGTCCCGGCTAAACGTAGCCCTTTTATTGTTTATTCCAAAATGCACTAGTAAATTGCACTTCTCAGCTCATAATATCACACAGGTAGAAGCAGAAATATAAATCTGAATGTCACATGGCTTGTGAGTACATTGATATCACATATACATCCCATTCCCGCAGCTATGTTGTAAGTAGAG
                                                  Xl3.1-CHK-1012688994                                                                                                                                                                                                                                                                                                                     TAACGTCACGCGGGGACGAATCGCTACTAGGGACAAGGCTCAACTGTGACCCAAGGTGACTGGAGAGAATGGGAGCCCACCTTGCCCGGAGATACTGGGGGGAACCGGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGGCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTAATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCATAAAATCCTGCAAGCTTGCATATTCTTCTGTACTAAGCACAATTCAGCAGGAAGAGCACCTAATTCTGCTCACAGCTCCTACAAAGAGTTTCAAAATGTCAGTGTGCGTTTTAGCGTATCCATAGTAAAACCACCACCAAAATACACAGTATATGTAATATGTAACTTCTATGAACCTAACATATAATTGGTGTATTTTAATGTTAATGGGTGACACTGTGGTCCCGGCTAAACGTAGCCCTTTTATTGTTTATTCCAAAATGCACTAGTAAATTGCACTTCTCAGCTCATAATATCACACAGGTAGAAGCAGAAATATAAATCTGAATGTCACATGGCTTGTGAGTACATTGATATCACATATACATCCCATTCCCGCAGCTATGTTGTAAGTAGAGACTTGG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                    3     5     5     8     6     9     8    11    10    13    11    14    12    15    14    17    13    16    13    18    15    18    15    18    17    19    16    20    17    20    19    21    18    22    18    21    22    22    22    22    22    22    20    20    21    21    21    21    20    21    21    21    20    20    21    21    21    21    21    21    20    20    22    22    18    22    22    22    23    23    21    22    21    22    20    21    20    20    20    20    17    18    16    16    13    15    12    13    12    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    12    12    12    12    11    11    11    11    11    11    10    11     8    11     7    11     6    11     5    10     5    10     5    10     5    10     3    10     3    10     3    10     3    10     3     8     3     8     3     7     2     6     2     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --------A---
                                               BLH ATG      74     190                                                                                                                                                                                                                                                                                                               
                                               BLH MIN      74      46                                                                                                                                                                                                                                                                                                               
                                               BLH MPR      50      46                                                                                                                                                                                                                                                                                                               
                                               BLH OVR      74     560                                                                                                                                                                                                                                                                                                               
                                               CDS MIN      74       8                                                                                                                                                                                                                                                                                                               
                                               EST CLI      -5       8                                                                                                                                                                                                                                                                                                               
                                               ORF LNG      74       5                                                                                                                                                                                                                                                                                                               
  5   1   0       chi Te2N                            IMAGE:7204750.5p TGCGCTGAGTTGCCGCTCCAACAGCTGCTGCAGGTCGATATAGCCAAGTGCAACACTCCACGTGCTGAATAAGAGATTCCGtttttttagttttCTTACTACTCACTGTATTGCTACCATCACTGATAGTTTCGTGTTCTACGTCATTTAGATGGGAGGCaacagacatacagacatacagacatacagacatacagacatacatTCATTACTTCTTAAAGTGTATGGGTAGTTTTGTACCAATAAAGAAACTGTTACGCCTGTATTCTGCACATGCGCACTGTTCCACTTTAACACTCGCGTCAGATGATGTGAGCGGAGGGACGAATCGTCACTAGGAACAAAAATCAACTGTGATCCAAGGTGACTGGAAAGTATGGGAGCCCACCTTGCCCGGAGGTACTGGGGAGACCCGGAGCCGGACCCCTATAACATGCCTGCTAGCCCAGAGCCGGGGGTCCTACCAGATAGAGTTATGTTGGCATCTCAGGATCAAATGAACCTGGCACAGCTGCCACTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCAATCTGATGAAGTGCAAAAGGGATATGTGGCCCAATTTCTTGGCCTGCAAACATGAGCGCCACGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAGTACGAACGTGAGAGGAGACTCATGGTGCGAAAGAGAAACGCAGAACAAGTGGAGGCAGCGTAATTCCACTCTTTTCTTCCTATCATCAATTTATTGAGCCTCTAAACTAAGAAATAAACTTTGTTGCTGaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGNCGGCGCCTAAATTNACCTCAAGGAATGGTCCCCTATATTAGGTCGTATTTAAAACCAAGGGCACTGGCCGGC
  5   1   2       bld Te1  5x3                        IMAGE:6928876.5p                                                                                                                                                                                                                                                                           GGGACTGTTCTACTTTAACACACGCGTCAGATGACGTACACATAACGTCACGCGGGGACGAATCGCTACTAGGGACAAGGCTCAACTGTGACCCAAGGTGACTGGAGAGAATGGGAGCCCACCTTGCCCGGAGATACTGGGGGGAACCGGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCTTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGGCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTAATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCTAAAANCCNCCCTTTTAACTCTANAAANTTCCTTGTCGGCC
  5   1   2       bld Te2N 5x3                        IMAGE:7204233.5p                                                                                                                                                                                                                                                                                                          TGACGTACACATAACGTCACGCGGGGACGAATCGCTACTAGGGACAAGGCTCAACTGTGACCCAAGGTGACTGGAGAGAATGGGTGCCCACCTTGCCCGGAGATACTGGGGGGAACCGGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGACAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTTATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAATTTGTTTCTGAGGATCATAAAATCCTGCAAGCTTGCATATTCTTCTGTACTAAGCACAATTCAGCAGGAAGAGCACCTAATTCTGCTCACAGCTCCTACAAAGAGTTTCAAAATGTCAGTGTGAGTTTTAGCGTATCCATAGTAAAACCACCACCAAAATACACAGTATATGTAATATGTAACTTCTATGAACCTAACATATAATTGGTGTATTTTAATGTTAATGGGTGACACTGTGGTCCCCGCTAAACGTAGCCCTTTTTATGTTTATTCCAAAATGCACTAGTAAATTGCACTTCTCAGCTCATATTATCACACAGGTTAGAAGCAGAAATATAAATCTGAATGTTCCATGGGCTTGTTGAGTACATTGATATCACATTATACCTCCCCAATTCCCGCCAGCCTATTTG
  5   1   2       bld Emb1 5x3                        IMAGE:5156957.5p                                                                                                                                                                                                                                                                                                           GACGTACACATAACGTCACGCGGGGACGAATCGCTACTAGGGACAAGGCTCAACTGTGACCCAAGGTGACTGGAGAGAATGGGAGCCCACCTTGCCCGGAGATACTGGGGGGAACCGGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGGCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTAATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCATAAAATCCTGCAAGCTTGCATATTCTTCTGTACTAAGCACAATTCAGCAGGAAGAGCACCTAATTCTGCTCACAGCTCCTACAAAGAGTTTCANAATGTCAGTGTGCGTTTTAGCGTATCCATAGTANAACCACCACCAAAATACACAGTATATGTAATATGTAACTTCTATGAACCTAACATATAATTGGTGTATTTTAATGTTAATGGGTGACACTGTGGTCCCGGCTAAACGTACCCCTTTTTATTGTTTATTCCAAATGCACTAGTAAATTGCACTTCTCAGCTCATAATATCACCCAGGTAGAAGCAGAAATATAAATCTGAATGTCACATGGCTTGTGAGTACATTGATATCACATATACATCCCATTTCCCGCACCTATGNTGGTAGTTAAAGACTTGGGAAATTGGAAAGTGCCCTTCCTATTTA
  5   1   2       bld Ga18 5g3  in                      xlk112p12ex.5p                                                                                                                                                                                                                                                                                                           TGACGAACACATAACGTCACGCGGGGNCGAATCACTACTAGGGACAAGGCTCAACTGTGACCCAAGGTGACTGGAGAGAATGGGAGCCCACCTTGCCCGGAGATACTGGGGGNNNNNNAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTNCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGNAATATGAGCGTGANAGGAGACTCATGGTGCGTCAGAGAAAAGCAGAACAAGNGGAGGCAGCATAACTCTGCTCTCTCTNCTTTCTTATCATCNAGTATTTGAGCCTTTNACTTAAAGAAATAAAGTTTGTNNCTGAGGATCATaaaaaaaaaa
  3   1   2       bld Ga18 5g3  in                      xlk112p12ex.3p                                                                                                                                                                                                                                                                                                           TGACGAACACATANCGTCNCGCGGGGACGAATCACTACTAGGGACAAGGCTCAACTGTGACCCAAGGTGACTGGAGAGAATGGGAGCCCNCCTTGCCCGGAGATACTGGGGGGAACCGGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTNCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGTCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTTATCATCAAGTATTNG
  5   1   2      seed Egg1 5x3                           PBX0092E01.5p                                                                                                                                                                                                                                                                                                                        CGTCACGCGGGGACGAATCGCTACTAGGGACAAGGCTCAACTGTGACCCAAGGTGACTGGAGAGAATGGGAGCCCACCTTGCCCGGAGATACTGGGGGGAACCGGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGGCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTAATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCAT
  5   1   2       bld Egg1 5x3                           PBX0142H05.5p                                                                                                                                                                                                                                                                                                                          CACGAGGGGGACGAATCGCTACTAGGGACAAGGCTCAACTGTGACCCAAGGTGACTGGAGAGAATGGGAGCCCACCTTGCCCGGAGATACTGGGGGGAACCGGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGACAGAGAAAAGCAGAACAAGTGGAGGCAGCATAAATCTGCTCTCTCTTCTTTCTAATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCATAAAATCCTGCAAGCTTGCATATTCTTCTGTACTAAGCACAATTCAGCAGGAAGAGCACCTAATTCTGCTCACAGCTCCTACAAAGAGTTTCAAAATGTCAGTGTGAGTTTTAGCGTATCCATAGTAAAACCACCACCAAAATACACAGTATATGCAATATGTAACT
  5   1   2       bld Ga12 5g3  in                         XL187d15.5p                                                                                                                                                                                                                                                                                                                           GAGGCGGGGACGAATCACTACTAGGGACAAGGCTCAACTGTGACCCAAGGTGACTGGAGAGAATGGGAGCCCACCTTGCCCGGAGATACTGGGGGGAACCGGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGTCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTTATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCATAAAATCaaaaaaaaaa
  3   1   2       bld Ga12 5g3  in                         XL187d15.3p                                                                                                                                                                                                                                                                                                                             GCGGGGACGAATCACTACTAGGGACAAGGCTCAACTGTGACCCAAGGTGACTGGAGAGAATGGGAGCCCACCTTGCCCGGAGATACTGGGGGGAACCGGAGCCGGACCCCTATAATTATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGTCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTTATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTG
  5   1   2       bld Brn1 5x3                        IMAGE:6954429.5p                                                                                                                                                                                                                                                                                                                                          CACTACTAGGGACAAGGCTCAACTGTGACCCAAGGTGACTGGAGAGAATGGGAGCCCACCTTGCCCGGAGATACTGGGGGGAACCGGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGTCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTTATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCATAAAATCCTGCAAGCTTGCATATTCTTCTGTACTAAGCACAATTCAGCAGGAAGAGCACCTAATTCTGCTCACAGCTCCTACAAAGAGTTTCAAAATGTCAGTGTGCGTTTTAGCGTATCCATAGCTAAACCACTACCAAAATACACAGTATATGTAATATGTAACTTCTATGAACCTAACATATAATTGGTGTATTTTAATGTTAATGGGGTGACACTGTGGTTCCCGGCTAAACGTTAGCCCTTTTTATTGGTTTATTCCCAAAAATGCACCAAGTTAAAATTGCAACTTTCGTCAGCTTCATTAACTATCCACACCAGGGTCGCAAATCCACAAAACTTTAAATTCCTCCGAAATGGCCAACAAGGGCCCTTGGGTGAGAGTTACCATTTGGATTAATCCCCCATTTAATACCCATTCCCTCCATTTCCCCCCGCGCAGGCTCCCTATTTTC
  5   1   2       bld Skin 5x3                        IMAGE:8644484.5p                                                                                                                                                                                                                                                                                                                                            CTACTAGGGACAAGGCTCAACTGTGACCCAAGGTGACTGGAGAGAATGGGAGCCCACCTTGCCCGGAGATACTGGGGGGAACCGGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGGCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTAATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCATAAAATCCTGCAAGCTTGCATATTCTTCTGTACTAAGCACAATTCAGCAGGAAGAGCACCTAATTCTGCTCACAGCTCCTACAAAGAGTTTCAAAATGTCAGTGTGCGTTTTAGCGTATCCATAGTAAAACCACCACCAAAATACACAGTATATGTAATATGTAACTTCTATGAACCTAACATATAATTGGTGTATTTTAATGTTNNATGGTGACACTGTGGTCCGGCTAANCGTAGCCCTTTTATGTTTATTCAAATGCACTAATAATTGCACTCTCACTCATATATCCACAGTAGAGCAGAATTAATCTGATGTACATGCTGTGATACTGAATCCATTACTC
  5   1   2       bld Te2N 5g3  in                    IMAGE:7764187.5p                                                                                                                                                                                                                                                                                                                                                           CTCAACTGTGACCCAAGGTGACTGGAGAGAATGGGAGCCCACCTTGCCCGGAGATACTGGGGGGAACCGGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGGCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTAATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCATAAAATCCTGCAAGCTTGCATATTCTTCTGTACTAAGCACAATTCAGCAGGAAGAGCACCTAATTCTGCTCACAGCTCCTACAAAGAGTTTCAAAATGTCAGTGTGCGTTTTAGCGTATCCATAGTAAAACCACCACCAAAATACACAGTATATGTAATATGTAACTTCTATGAACCTAACATATAATTGGTGTATTTTAATGTAATGGGTGACACTGTGGTCCCGGCAANCGTAGCCTTTTATGTTNANTTCAATGCCTAGTAAATGCACTCTCACTCATATATCCACAGTAGAGCAGAATTAATCTGATGCACTGCTTGGAGACTGAATCCTATCATCATCCCACTTGTGTAGAAACTGAATTGAGG
  5   1   2       bld Tbd2 5g                         IMAGE:3200831.5p                                                                                                                                                                                                                                                                                                                                                            TCAACTGTGACCCAAGGTGACTGGAGAGAATGGGAGCCCACCTTGCCCGGAGATACTGGGGGGAACCGGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAA
  3   1   2       bld Ga12 5g3  in                         XL188d15.3p                                                                                                                                                                                                                                                                                                                                                                     ANCCAAGGTGACTGGAGAGAATGGGAGCCCACCTTGCCCGGAGATACTGGGGGGAACCGGAGCCGGACCCNTATAATANGTCGNNTAGCCCAGAGCCGGGNGTCNTNCCAGAGAGANTTATGGTGGCATCTCAGGAGCAAATGANCNTGGCACAGGTNCCGNTGCAGCAGAGGNATTATTGTGCCCACCATCTTATCTCGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCNTGNCNTGCAAACATGANCGCCATGAGTGGGACCAGTNCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGANCGTGAGAGGAGACTCATGGTGNGTCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTNTGCTCTCTCTTCTTTNTTATCATCAA
  5   1   2       bld Te2  5x3                        IMAGE:7394460.5p                                                                                                                                                                                                                                                                                                                                                                             TGACTGGAGAGAATGGGAGCCCACCTTGCCCGGAGATACTGGGGGGAACCGGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGGCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTAATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCATAAAATCCTGCAAGCTTGCATATTCTTCTGTACTAAGCACAATTCAGCAGGAAGAGCACCTAATTCTGCTCACAGCTCCTACAAAGAGTTTCAAAATGTCAGTGTGCGTTTTAGCGTATCCATAGTAAAACCACCACCAAAATACACAGTATATGTAATATGTAACTTCTATGAACCTAACATATAATTGGTGTATTTTAATGTTAATGGGTGACACTGTGGTCCCGGCTAANCGTAGCCCTTTTATTGTTATTCCAAAATGCACTATAATTGCACTCTCACTCATATACACACAGTAGAGCAGAATTAATCTGATGTCCATGCTGTGATACTGAATCACTATCATCATCCCACTTGTGTATAAGCTGAATTGAATGCTCTATA
  5   1   2       bld Emb4                            IMAGE:5513851.5p                                                                                                                                                                                                                                                                                                                                                                                          TGGGAGCCCACCTTGCCTTGAGATACTGGGGGGAACCGGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGGCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTAATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCATAAAATCCTGCAAGCTTGCATATTCTTCTGTACTAAGCACAATTCAGCAGGAAGAGCACCTAATTCTGCTCACAGCTCCTACAAAGAGTTTCAAAATGTCAGTGTGCGTTTTAGCGTATCCATAGTAAAACCACCACCAAAATACACAGTATATGTAATATGTAACTTCTATGAACCTAACATATAATTGGTGTATTTTAATGTTAATGGGTGACACTGTGGTCCCGGCTAAACGTAGCCCTTTTATTGTTTATTCCAAATGCACNTATAAATGCACTTCTCAGCTCATATATCACACAGTAGAGCAGAATATAATCTGATGTCCATGGCTGTGAGTCTT
  3   1   2       bld Ga18      in                      xlk141m03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAACCGGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACNNNNACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGTCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTTATCATCAAGTATTTGANCCTTTAACTTAAAGAAATAAA
  5   1   2       bld Ga18      in                      xlk141m03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                          GGGANCGAGCCGGACCCCTATAATATGTCGGCTAGCCCAGAGCCGGGGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGTCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTTATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCATAAAATCCTGCaaaaaaaaaa
  5   1   2       bld Egg1                               PBX0142D11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACGAGGTCCTACCAGAGAGAGTTATGGTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGACAGAGAAAAGCAGAACAAGTGGAGGCAGCATAAATCTGCTCTCTCTTCTTTCTAATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCATAAAATCCTGCAAGCTTGCATATTCTTCTGTACTAAGCACAATTCAGCAGGAAGAGCACCTAATTCTGCTCACAGCTCCTACAAAGAGTTTCAAAATGTCAGTGTGAGTTTTAGCGTATCCATAGTAAAACCACCACCAAAATACACAGTATATGCAATATGTAACTTCTATGAACCTAACATATAATTGGTGCATTTTAATGTTAATGCGTGTCACTGTGGTCCCGTCTAAATGTAGCCCTTTTATT
  3   1   2       bld Skin      in                    IMAGE:8641462.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCATGATTCGAATTCGTCCGTGGCATCTCAGGAGCAAATGACCTGGCACCAGGTGCCGCTGCAGCAGAGGGATTATGGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGGCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTAATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCATAAAATCCTGCAAGCTTGCATATTCTTCTGTACTAAGCACAATTCAGCAGGAAGAGCACCTAATTCTGCTCACAGCTCCTACAAAGAGTTTCAAAATGTCAGTGTGCGTTTTAGCGTATCCATAGTAAAACCACCACCAAAATACACAGTATATGTAATATGTAACTTCTATGAACCTAACATATAATTGGTGTATTTTAATGTTAATGGGTGACACTGTGGTCCCGGCTAAACGTAGCCCTTTTATTGTTTATTCCAAAATGCACTAGTAAATTGCACTTCTCAGCTCATAATATCACACAGGTAGAAGCAGAAATATAAATCTGAATGTCACATGGCTTGTGAGTACATTGATATCACATATACATCCCATTCCCGCAGCTATGTTGTAAGTAGAGACTGGAAATTGAAAAGTCCTCTATTACACAGCTATCCNNNNAAAAGAATCC
  5   1   2       bld Skin      in                    IMAGE:8641462.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGGCATCTCAGGAGCAAATGAACCTGGCACAGGTGCCGCTGCAGCAGAGGGATTATTGTGCCCACCATCTTATCACGCTGATGAAATGCAAAAGGGATATGTGGCCCAATTTCCTGGCCTGCAAACATGAGCGCCATGAGTGGGACCAGTGCCAGCATGAAGATTATGTTCAGCGCATGAAGCAATATGAGCGTGAGAGGAGACTCATGGTGCGGCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTAATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCATAAAATCCTGCAAGCTTGCATATTCTTCTGTACTAAGCACAATTCAGCAGGAAGAGCACCTAATTCTGCTCACAGCTCCTACAAAGAGTTTCAAAATGTCAGTGTGCGTTTTAGCGTATCCATAGTAAAACCACCACCAAAATACACAGTATATGTAATATGTAACTTCTATGAACCTAACATATAATTGGTGTATTTTAATGTTAATGGGTGACACTGTGGTCCCGGCTAAACGTAGCCCTTTTATTGTTTATTCCAAAATGCACTAGTAAATTGCACTTCTCAGCTCATATATCACACAGGTAGAAGCAGAAATATAATCTGATGTCACATGGCTGTGAGTACATGATATCACATATACTCCATTCCGCACTATGTGTAGTAAGACTTGAATATGAAGTGCTCTATTAAACAGCTATATCCTGATaaaaaaaaaaaaaaaaGGCGCGCAGCTGATCTCAACGCGTCACCCGCTATAGACATACAA
  3   1   2       bld Te2N 5g3  in                    IMAGE:7764187.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATATGAGCGTGAGAGGAGACTCATGGTGCGGCAGAGAAAAGCAGACNAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTAATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCATAAAATCCTGCAAGCTTGCATATTCTTCTGTACTAAGCACAATTCAGCAGGAAGAGCACCTAATTCTGCTCACAGCTCCTACAAAGAGTTTCAAAATGTCAGTGTGCGTTTTAGCGTATCCATAGTAAAACCACCACCAAAATACACAGTATATGTAATATGTAACTTCTATGAACCTAACATATAATTGGTGTATTTTAATGTTAATGGGTGACACTGTGGTCCCGGCTAAACGTAGCCCTTTTATTGTTTATTCCAAAATGCACTAGTAAATTGCACTTCTCAGCTCATAATATCACACAGGTAGAAGCAGAAATATAAATCTGAATGTCACATGGCTTGTGAGTACATTGATATCACATATACATCCCATTCCCGCAGCTATGTTGTAAGTAGAGACTTGGAAATATGAAAAGTGCCTTCTTATATAAAACAAGCTATAAATCTCTTGATAAACACAGTTGTTTGTGTCATCTCTGTATGTGCAATGTGTACTGTAACCTATTGTACAGAGCTGCAAAATATGTTGGCACTTCATAACTACATATTAATAATAAAACAAGACAAAAGTTAAAAAAAAAA
  5   1   2       bld Ga12 5g3  in                         XL188d15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCATGGTGCGTCAGAGAAAAGCAGAACAAGTGGAGGCAGCATAACTCTGCTCTCTCTTCTTTCTTATCATCAAGTATTTGAGCCTTTAACTTAAAGAAATAAAGTTTGTTTCTGAGGATCAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)