Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL198o15.3.5                          8 END     1           2       12                ubiquitously-expressed transcript [Bos taurus]
     2   2.0    0Xl3.1-XL217g11.3                            6 END     1           2       16                (no blast hit)
     3   2.0    0Xl3.1-xlk123f17ex.5                         3 END     2           5       66                frizzled-8 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4   0.0    0Xl3.1-rxlk122i22ex.3                        8 PI      86       1017     1210                (no blast hit)
     5   0.0    0Xl3.1-xlk123f17ex.5                         3 PI      92         89      273                frizzled-8 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012771232 Xl3.1-xlk147l17ex.3 - 35 ESTs
                                                                       .-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk147l17ex.3                                                                                  AACGGGCACAGGGCGATTTAAAAGTTAAAACTGTCTTGGTGGGGGGTTTTTTCGGTAAAAAGAAACAAATTTAAAAAAAAATATGTTACTGGTCCTTTAAAGTAATAAAAATATAATACCGTGTTGTCCTGCACTGGTTAAACTGCTGTGTTTGTTTCAGAAACACTACTATTGTTTACAATATTTTTACCAATTACATTTTTATGTTGCTGGTCCTTTAAAACACTTTAATTTTTTTGGTGTTACTGTTCCTTTAAGACTCCCAGGGTGAGGTTTGCAAGCGGTTCTGCAATCTTATCCCGTCTATGGGGGTAACATAACCAATGCCTCCGTTTGCGAAACCCTTACCCGGGCAGTGCCCAACCTGTTGCCATTCAGCTCTTGTTAATCCACAACTTCTATTAGTGCTTCTGGGAGTTGAAGTTTCACAACAGCTGGAAGGCTGCAGCAAGGACTTTATCCTTATACGTAAATTGCAGGGGGAGACCTGAGACTGTTTAAGAGTTGCCAACCTCACCCAACTTGCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTGCTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGTGACCCCCCTACGAGTGCCAAGTGTGCCTAAATAATGTTTATTTCTTCTTGGCATGGCGGGAGTCATAACAGCAAGGTGCGGGTTCTATGAATTAACCAAGTCTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTAGAGGGGCACCGGTTGGACAGACTCGGCTTTATTTTTGTTTATGTTTTTTTTTTTAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGNCTTCTCGACAAGAGCAAATATTGGAGTATTCTATTTTGTCAATAAAATGACTTTTTTT
                                                  Xl3.1-CHK-1012687596                                                                                        CACAGGGCGATTTAAAAGTTAAAACTGTCTTGGTGGGGGGTTTTTTCGGTAAAAAGAAACAAATTTAAAAAAAAATATGTTACTGGTCCTTTAAAGTAATAAAAATATAATACCGTGTTGTCCTGCACTGGTTAAACTGCTGTGTTTGTTTCAGAAACACTACTATTGTTTACAATATTTTTACCAATTACATTTTTATGTTGCTGGTCCTTTAAAACACTTTAATTTTTTTGGTGTTACTGTTCCTTTAAGACTCCCAGGGTGAGGTTTGCAAGCGGTTCTGCAATCTTATCCCGTCTATGGGGGTAACATAACCAATGCCTCCGTTTGCGAAACCCTTACCCGGGCAGTGCCCAACCTGTTGCCATTCAGCTCTTGTTAATCCACAACTTCTATTAGTGCTTCTGGGAGTTGAAGTTTCACAACAGCTGGAAGGCTGCAGCAAGGACTTTATCCTTATACGTAAATTGCAGGGGGAGACCTGAGACTGTTTAAGAGTTGCCAACCTCACCCAACTTGCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTGCTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGTGACCCCCCTACGAGTGCCAAGTGTGCCTAAATAATGTTTATTTCTTCTTGGCATGGCGGGAGTCATAACAGCAAGGTGCGGGTTCTATGAATTAACCAAGTCTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTAGAGGGGCACCGGTTGGACAGACTCGGCTTTATTTTTGTTTATGTTTTTTTTTTTAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGNCTTCTCGACAAGAGCAAATATTGGAGTATTCTATTTTGTCAATAAAATGACT
                                                      consensus depths                                                                                       2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     2     3     3     5     7    10     6    10     7    11     8    12     8    12     8    13     8    13    11    13     8    13     8    13     8    14     8    14     8    14     8    14     8    14     8    14     8    15    10    16    14    16    15    16    15    16    15    16    13    16    15    17    17    17    16    18    16    18    16    19    15    19    17    20    15    20    14    20    19    20    19    20    20    21    22    22    22    22    22    22    22    22    22    22    21    21    21    21    20    20    20    20    19    19    20    20    20    21    19    21    18    21    17    20    20    21    20    20    20    20    20    20    19    20    19    20    18    20    17    17    16    17    16    17    13    18    15    18    16    18    14    19    15    19    16    18    16    18    16    19    16    19    11    18    13    19    17    18    13    19    11    18    11    19    13    19    13    19    13    19    13    19    13    18    13    17    12    17    13    17    13    17    13    17    13    17    13    17    13    17    11    16     8    10     3     5     3     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G-------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -G----------
                                                   Xl3.1-xlk147l17ex.3                                                                                                    TAA---------------------------------------------------------------------------------TAATAA------------------------------TAA---------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------TAA---------------------------------TAG---------------ATG---ATG------TAA---------------------TGAATG------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------------------TAG---------------------------------ATG------------------------------TAA---ATG---------------------------------------------------TGA------------------ATG------------------------------------------------------------------------------------------------TAA------TAA------TAA------------------------------TGA------------------------ATG------------------------------TAA------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                  ]
  5   1   2       bld Ga12      in                         XL211m08.5p CCAAAACAGATCTAACTTTTAAGTAGCAAAGCTTTTATTAAGAAATGACTTACCAATTCTCTGCACGCGCTCCTCTTCATAAACGGGCACAGGGCGatttaaaagttaaaactgtcttggtggggggttttttcggtaaaaagaaacaaatttaaaaaaaaaTATGTTACTGGTCCTTTAAAGTAATAAAAATATAATACCGTGTTGTCCTGCACTGGTTAAACTGCTGTGTTTGTTTCANAAACACTACTATTGTttacaatatttttaccaattacatttttatgttgctggtcctttaaaacactttaatttttttGGTGTTACTGTTCCTTTAAGACTCCCAGGGTGAGGTTTGCAAGCGGTTCTGCAATCTTATCCCGTCTATGGGGGTAACATAACCAATGCCTCCGTTTGCGAAACCCTTACCCGGGCAGTGCCCAACCTGTTGCCATTCAGCTCTTGTTAATCCACAACTTCTATTAGTGCTTCTGGGAGTTGAAGTTTCACAACAGCTGGAAGGCTGCAGCAAGGACTTTATCCTTATACGTAAATTGCAGGGGGA
  5   1   2       bld Ga12      in                         XL150f21.5p                                                                      GCTCCTCTTATAAACGGGCACAGGGCGATTTAAAAGTTAAAACTGTCTTGGTGGGGGGTTTTTTCGGTAAAAAGAAACAAATTTAAGAAAGGATATGTTACTGGTCCTTTAAAGTAATAAAAATGTGGTGCCGTGTTGTCCTGCACTGGTTAAACTGCTGTGTTTGTTTCAGAAACACTACTATTGTTTACAAtatttttaccaattacatttttatgttgctggtcctttaaaacactttaatttttttGGTGTTACTGTTCCTTTAAGACTCCCAGGGTGAGGTTTGCAAGCGGTTCTGCAATCTTATCCCGTCTATGGGGGTAACATAACCAATGCCTCCGTTTGCGAAACCCTTACCCGGGCAGTGCCCAACCTGTTGCCATTCAGCTCTTGTTAATCCACAACTTCTATTAGTGCTTCTGGGAGTTGAAGTTTCACAACAGCTGGAAGGCTGCAGCAAGGACTTTATCCTTATACGTAAATTGCAGGGGGAGACCTGAGACTGTTTAAGAGTTGCCAACCTCACCCAACTTGCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCC
  5   1   2       bld Ga18      in                      xlk142f24ex.5p                                                                                               GCGATTTAAAAGTTAAAACTGTCTTGGTGGGGGGNTTTTTCGGTAAAAAGAAACAAATTTAAAAAGGGATATGTTACTGGTCCTTTAAAGTAATAGAAATGTAGTGCCGTGTTGTCCTGCACTGGTTGAACTGCTGTGTTTGTTTCAGAAACACTACTATTGTTTACAATATTTTTACCAATTACATTTTTATGTTGCTGGTCCTTTAAAACACTTTAATTTTTTTGGTGTTACTGTTCCTTTAAGACTCCCAGGGTGAGGTTTGCAAGCGGTTCTGCAATCTTATCCCGTCTATGGGGGTAACATAACCAATGCCTCCGTTTGCGAAACCCTTACCCGGGCAGTGCCAACCTGTTGCCATTCAGCTCTTGTTAATCCACAACTTCTATTAGTGCTTCTGGGAGTTGAAGTTTCACAACAGCTGGAAGGCTGCAGNAAGGACTTTATCCTTATACGTAAATTGCAGGGGGAGACCTGAGACTGTTTAAGAGTTGCCAACCTCACCCAACTTGCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGNCGGAACAATGTACCTGGGATTGAAGNCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTNAGCAGGGGNCGGGAATGAACTCCCTCCCTCGGCTGNNNNNNAAGAGTTTGTNC
  5   1   2       bld Ga18                               xlk75i20ex.5p                                                                                                                                                                                                            TGTTGTCCTGCACTGGTTAAACTGCTGTGTTTGTTTCAGAAACACTACTATTGTTTACAATATTTTTACCAATTACATTTTTATGTTGCTGGTCCTTTAAAACACTTTAATTTTTTTGGTGTTACTGTTCCTTTAAGACTCCCAGGGTGAGGTTTGCAAGCGGTTCTGCAATCTTATCCCGTCTATGGGGGTAACATAACCAATGCCTCCGTTTGCGAAACCCTTACCCGGGCAGTGCCAACCTGTTGCCATTCAGCTCTTGTTAATCCACAACTTCTATTAGTGCTGCTGGGAGCTGAAGTTTCACAACAGCTGGAAGGCTGCAGNAAGGACTTTATCCTTATACGTAAATTGCAGGGGGAGACCTGAGACTGTTTAAGAGTTGCCAACCTCACCCAACTCGCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGNCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCANGGAAAGAGTTTGTNCTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTNCACATCCATGGGTGACCCCCCCACGAG
  5   1   2       bld Gas4                            IMAGE:3419852.5p                                                                                                                                                                                                                  CCGGGCTGGTTAAACTGCTGTGTTTGTTTCAGAAATACTACTATTGTTTACAATATTTGTACCAATTACATTTTTATGTTGCTGGTCCTTTAAAACACTTTAATTTTTTTGGTGTTACTGTTCCTTTAAGACTCCCAGGGTGAGGTTTGCAAGCGGTTCTGCAATCTTATCCCGTCTATGGGGGTAACATAACCAATGCCTCCGTTTGCGAAACCCTTACCCGGGCAGTGCCCAACCTGTTGCCATTCAGCTCTTGTTAATCCACAACTTCTATTATTGCTGCTGGGAGCTGAAGTTTCACAACAGCTGGAAGGCTGCAGCAAGGACTTTATCCTTATACGTAAATTGCTCGGGGAGACCTGAGACTGTTTAAGAGTTGCCAACCTCACCCAACTCGCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGC
  5   1   2       bld Gas4                   IMAGE:3419852-IMAGp.IMAGp                                                                                                                                                                                                                       CTGGTTAAACTGCTGTGTTTGTTTCAGAAACACTACTATTGTTTACAATATTTTTACCAATTACATTTTTATGTTGCTGGTCCTTTAAAACACTTTAATTTTTTTGGTGTTACTGTTCCTTTAAGACTCCCAGGGTGAGGTTTGCAAGCGGTTCTGCAATCTTATCCCGTCTATGGGGGTAACATAACCAATGCCTCCGTTTGCGAAACCCTTACCCGGGCAGTGCCCAACCTGTTGCCATTCAGCTCTTGTTAATCCACAACTTCTATTAGTGCTGCTGGGAGCTGAAGTTTCACAACAGCTGGAAGGCTGCAGCAAGGACTTTATCCTTATACGTAAATTGCAGGGGGAGACCTGAGACTGTTTAAGAGTTGCCAACCTCACCCAACTCGCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTGCTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGTGACCCCCCCACGAGTGCCAAGTGTGCCTAAATAATGTTTATTTCTTCTTGGCATGGGCGGGAGTCATAACAGCAAGGTGCGGGTTCTATGAATTAACCAAGTCTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTAGAGGGGCACCGGTTGGACAGACTCGGCtttatttttgtttatgtttttttttttAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGGTTTCTTTCCATGATAGGATGT
  5   1   2       bld Ga15      out                      XL483j10ex.5p                                                                                                                                                                                                                       CTGGTTAAACTGCTGTGTTTGTTTCAGAAACACTACTATTGTTTACAATATTTTTACCAATTACATTTTTATGTTGCTGGNCCTTTAAAACACTTTAATTTTTTTGGTGTTACTGTTCCTTTAAGACTCCCAGGGTGAGGTTTGCAAGCGGTTCTGCAATCTTATCCCGNCTATGGGGGTAACATAACCAATGCCTCCGTTTGCGAAACCCTTACCCGGGCAGTGCCCAACCTGTTGCCATTCAGCTCTTGTTAATCCACAACTTCTATTAGTGCTGCTGGGAGTTGAAGTTTCACAACAGCTGGAAGGCTGCAGCAAGGACTTTATCCTTATACGTAAATTGCAGGGGGAGACCTGAGACTGTTTAAGAGTTGCCAACCTCACCCAACTCGCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGC
  5   1   2       bld Ga18      in                      xlk147l17ex.5p                                                                                                                                                                                                                       ACTGGTTAAACTGCTGTGTTTGTTTCAGAAACACTACTATTGTTTACAATATTTTTACCAATTACATTTTTATGTTGCTGGTCCTTTAAAACACTTTAATTTTTTTGGTGTTACTGTTCCTTTAAGACTCCCAGGGTGAGGTTTGCAAGCGGTTCTGCAATCTTATCCCGTCTATGGGGGTAACATAACCAATGCCTCCGTTTGCGAAACCCTTACCCGGGCAGTGNCAACCTGTTGCCATTCAGCTCTTGTTAATCCACAACTTCTATTAGTGCTTCTGGGAGTTGAAGTTTCACAACAGCTGGAAGGCTGCAGNAAGGACTTTATCCTTATACGTAAATTGCAGGGGGAGANCTGAGACTGTTTAAGAGTTGCCAACCTCACCCAACTTGCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGNATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCNTCGGCTGCAAGGAAAGAGNTTGTGCTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGNCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGTGANCCCCCTACGAGT
  5   1   2       bld Ga15      in                       XL502i11ex.5p                                                                                                                                                                                                                          GTTAAACTGCTGTGTTTGTTTCAGAAACACTACTATTGTTTACAATATTTTTACCAATTACATTTTTATGTTGCTGGTCCTTTAAAACACTTTAATTTTTTTGGTGTTACTGTTCCTTTAAGACTCCCAGGGTGAGGTTTGCAAGCGGTTCTGCAATCTTATCCCGTCTATGGGGGTAACATAACCAATGCCTCCGTTTGCGAAACCCTTACCCGGGCAGTGCCCAACCTGTTGCCATTCAGCTCTTGTTAATCCACAACTTCTATTAGTGCTTCTGGGAGTTGAAGTTTCACAACAGCTGGAAGGCTGCAGCAAGGACTTTATCCTTATACGTAAATTGCAGGGGGAGACCTGAGACTGTTTAAGAGTTGCCAACCTCACCCAACTTGCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTGCTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGTGACCCCCCTACNAG
  3  -1   2       bld Neu4      in                    IMAGE:4084934.3p                                                                                                                                                                                                                              AACTGCTGTGTTTGTTTCAGAAACACTACTATTGTTTACAATATTTTTACCAATTACATTTTTATGTTGCTGGTCCTTTATTACACTTTAATTTTTTTGGTGTTACTGTTCCTTTAAGACTCCCAGGGTGAGGTTTGCAAGCGGTTCTGCAATCTTATCCCGTCTATGGGGGTAACATAACCAATGCCTCCGTTTGCGAAACCCTTACCCGGGCAGTGCCCAACCTGTTGCCATTCAGCTCTTGTTAATCCACAACTTCTATTAGTGCTTCTGGGAGTTGAAGTTTCACAACAGCTGGAAGGCTGCAGCAAGGACTTTATCCTTATATTTAAATTGCAGGGGGAGACCTGAGACTGTTTAAGAGTTGCCAACCTCACCCAACTTGCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTGCTGCTGCCATGAGCTTTA
  3   1   2       bld Ga18      out                     xlk145a17ex.3p                                                                                                                                                                                                                                                         TNNTTTCAGNANNNCTNCNNNTGTTANANNTTTTNCNANTACATTTNNNNTGCTGTNCTTTAANCNCTTNNTTTTTGNNNNACTGTNCTTAGACTCCCNGGGTGANGTTNNNAANNGNTTCTGNAATNNNATCCCGTCTATGGGGNTAACATANCCAATGCNTCNGTTTGNGAAACCCTTACCCGGCANNGCCCANCCTGTTNCCATTCAGCTCNTGTTAATCCACAACTTCTANTAGTGCTTCTGGGAGTTGAANNTTCACAACAGCTGGAAGGCTGCAGCAAGGNCTTTANCCTTATACGTAAATTGCAGGGGGAGACCTGAGNCTGTNTAAGAGTTGCCAACCTCNCCCANCTTGNCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTGCTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGTGACCCCCCTACGAGTGCCAAGTGTGCCTAAATAATGTTTATTTCTTCTTGGCATGGCGGGAGTCATAACAGCAAGGTGCGGGTTCTATGAATTAACCAAGTCTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTAGAGGGGCACCGGTTGGACAGACTCGGCTTTATTTTTGTTTATGTTTTTTTTTTTAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGNCTTCTCGACAAGAGCAAATATTGGAGTNNCT
  5   1   2       bld Gas5                            IMAGE:3750426.5p                                                                                                                                                                                                                                                            ATTGTTTACAATATTTTTACCAATTACATTTTTATGTTGCTGGTCCTTTAAAACACTTTAATTTTTTTGGTGTTACTGTTCCTTTAAGACTCCCAGGGTGAGGTTTGCAAGCGGTTCTGCAATCTTATCCCGTCTATGGGGGTAACATAACCAATGCCTCCGTTTGCGAAACCCTTACCCGGGCAGTGCCCAACCTGTTGCCATTCAGCTCTTGTTAATCCACAACTTCTATTAGTGCTGCTGGGAGTTGAAGTTTCACAACAGCTGGAAGGCTGCAGCAAGGACTTTATCCTTATACGTAAATTGCAGGGGGAGACCTGAGACTGTTTAAGAGTTGCCAACCTCACCCAACTCGCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCAT
  3   1   2       bld Ga18      in                      xlk147l17ex.3p                                                                                                                                                                                                                                                                                      TTTTNCNNTNCATTTTANNTGCNGNNTTAAANNCTTTAATTTTTNNNNGNTACTNNNNTTTAAGACNCCANGNTGAGGTTTNCAAGCGGNTCTGNANTCTNATNCNGTCTATGGGGGTAACATANCNAANGCCTCCNTTTGCGAAACCCTTACCCGGCAGNGCCCAACCTGTTGCCATNCAGCTCTTGNTAATCCACANCTTCTATTAGTGCTTCTGGGAGTTGAANNNNCACAACAGCTGGAAGNCTGCAGCAAGGACTTTATCCTTATACGTAAATTGCAGGGGGAGNCCTGAGACTGTTTAAGAGTTNCCANCCTCACCCANCTTNNCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTGCTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGTGACCCCCCTACGAGTGCCAAGTGTGCCTAAATAATGTTTATTTCTTCTTGGCATGGCGGGAGTCATAACAGCAAGGTGCGGGTTCTATGAATTAACCAAGTCTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTAGAGGGGCACCGGTTGGACAGACTCGGCTTTATTTTTGTTTATGTTTTTTTTTTTAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGNCTTCTCGACAAGAGCAAATATTNGA
  3   1   2       bld Ga18      in                      xlk142f24ex.3p                                                                                                                                                                                                                                                                                                                                                       CNCCCAGNNTGNNNTTNNNAAGCGGNTCTGCANTCTNATCCNNTCTATGGNNNNACATAACNAATGCCTCCGTTTGNGAANCCNTTANCNGGCAGTGCCCANCCTGTTGNCATTCAGCTCTTGTTAATCCACAACTTCTATTAGTGCTTCTGGGAGTTGAANTTTCACAACAGCTGGAAGNCTGCAGCAAGGACTTTANCCTTATACGTAAATTGCAGGGGGAGNCCTGAGACTGTTTAAGAGTTNCCANCCTCACCCANCTTNCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTGCTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGTGACCCCCCTACGAGTGCCAAGTGTGCCTAAATAATGTTTATTTCTTCTTGGCATGGCGGGAGTCATAACAGCAAGGTGCGGGTTCTATGAATTAACCAAGTCTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTAGAGGGGCACCGGTTGGACAGACTCGGCTTTATTTTTGTTTATGTTTTTTTTTTAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGNCTTCTCNNCAAGAGCAAATATTNGA
  5   1   2       bld Ga18      in                        xlk5e02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                       ATNCCTCCGTTTGCGAAACCCTTACCCGGGCAGTGCNACCTGTTGCCATTCAGCTCTTGTTAATCCACAACTTCTATTAGTGCTTCTGGGAGTTGAAGTTTCACAACAGCTGGAAGGCTGCAGNAAGGACTTTATCCTTATACGTAAATTGCAGGGGGAGANCTGAGACTGTTTAAGAGTTGCCAACCTCACCCAACTTGCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTGCTGCTGNCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGTGACCCCCCTACGAGTGCCAAGTGTGCCTAAATAATGTTTATTTCTTCTTGGCATGNNGGGAGTCATAACAGCAAGGTGCGGGTTCTATGAATTAACCAAGTCTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTAGAGGGGCACCGGNNGGNCAGACTCGGCTTTATTTTTGNNNTGttttttttttAACTAAGCTAATTNCCTTAAATAAAATGNCTTNAGAAGCAGTACCCCAAANGAAANACGGNNTNCTT
  5   1   2      seed Ga15                               XL420j20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTTACCCGGGCAGTGCCCAACCTGTTGCCATTCAGCTCTTGTTAATCCACAACTTCTATTAGTGCTGCTGGGAGTTGAAGTTTCACAACAGCTGGAAGGCTGCAGCAAGGACTTTATCCTTATACGTAAATTGCAGGGGGAGACCTGAGACTGTTTAAGAGTTGCCAACCTCACCCAACTCGCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTGCTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGTGACCCCCCTACGAGTGCCAAGTGTGCCTAAATAATGTTTATTTCTTCTTGGCATGGCGGGAGTCATAACAGCAAGGTGCGGGTTCTATGAATTAACCAAGTCTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTANAGGGGCACCGGTTGGACAGACTCGGCtttatttttgtttatgtttttttttttAACT
  5   1   2       bld Ga15                               XL422a06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAGTTTCACAACAGCTGGAAGGCTGCAGCAAGGACTTTATCCTTATACGTAAATTGCAGGGGGAGACCTGAGACTGTTTAAGAGTTGCCAACCTCACCCAACTCGCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCNTCCCTCGGCTGCAAGGAAAGAGTTTGTGCTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGTGACCCCCCTACGAGTGCCAAGTGTGCCTAAATAATGTTTATTTCTTCTTGGCATGGCGGGAGTCATAACAGCAAGGTGCGGGTTCTATGAATTAACCAAGTCTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTANAGGGGCACCGGTTAGACAGACTCGGCtttatttttgtttatgtttttttttttANC
  3   1   2       bld Ga18      in                        xlk5e02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCNGNANGGCTGCAGNAAGGNNNTTANCCTNATNCNTNANTNGCNNGGGAGACCTGAGACTGTTNNAGAGTTNCCAACCTCACCCNNCTTNCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGNCTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTNATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTGNTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGTGACCCCCCTACGAGTGCCAAGTGTGCCTAAATAATGTTTATTTCTTCTTGGCATGGCGGGAGTCATAACAGCAAGGTGCGGGTTCTATGAATTAACCAAGTCTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTAGAGGGGCACCGGTTGGACAGACTCGGCTTTATTTTTGTTTATGTTTTTTTTTTAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGNCTTCTCGACAAGAGNAANTATTNG
  3   1   2       bld Ga18      in                      xlk140c13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCNNNNNCCGCCCACGCGTCCGGAGNCCTGAGACTGTTTAAGAGTTNNCANCCTCACCCANCTTNNCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTGCTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGTGACCCCCCTACGAGTGCCAAGTGTGCCTAAATAATGTTTATTTCTTCTTGGCATGGCGGGAGTCATAACAGCAAGGTGCGGGTTCTATGAATTAACCAAGTCTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTAGAGGGGCACCGGTTGGACAGACTCGGCTTTATTTTTGTTTNTNTTTTTTTTTTTAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGNCTTCTCGACAAGAGCAAATATTGGAGTNNCTATTT
  3   1   2       bld Ga18      out                     xlk123f17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ANNTGCAGGGGANNNNNGNNNCTGTTTNNGANNNNCNNNCTCNNNNACTCGCCCCNNTTTAGATAATTGCTATTAGCATGATAATGNACTCTTAAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTNCTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGTGACCCCCCTACGAGTGCCAAGTGTGCCTAAATAATGTTTATTTCTTCTTGGCATGGCGGGAGTCATAACAGCAAGGTGCGGGTTCTATGAATTAACCAAGTCTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTAGAGGGGCACCGGTTAGACAGACTCGGCTTTATTTTTGTTTATTTTTTTTTTTTTAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGNCTTCTCGACAAGAGNAANTAT
  5   1   0       chi Ga15                               XL500a18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGACCTGAGACTCTTAGTAAGAGTTACCAACCTCACCCAACTTGTCCCCCTTTTTTACATTCTTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGGACCTGGGATTGAAGCCTCCCTCATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGTGATAATTATAGTTAAGCAGGGATTGTCCCCCCTCGTCAGCTATTTGCAAAGAGGCAATAAGTGTCTGTGCTGCTGCTGCTTGTCCTGGTTCCGAATTGCATTTAGCTGTGTCCCCAGCCATTTTCCCCCTTCACTTCTATGGGGGACCCCCCTTACATGTGCCAAGTGTTGCTGAAATAATGTTTATTTCTTCTTGGCATAGCAGGAGTCTTAACAGCAGGGTGCGGGTTCTATGAATTAACCAAGTCTTGCCCATAGTCTCCACAGCTGGGGTTTTAACTACAACTCCCAGCATCCTTAGAGGGACACAGGTTGGACAGACCCAGCttttttttttttttttNAA
  5   1   2       bld Ga18      in                      xlk140c13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGACCTGAGACTGTTTAAGAGTTGCCAACCTCACCCAACTTGCCCCCTTTTTAGATAATTGCTATTAGCATGATAATGAACTCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTGCTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGTGACCCCCCTACGAGTGCCAAGTGTGCCTAAATAATGTTTATTTCTTCTTGGCATGGNGGGAGTCATAACAGCAAGGTGCGGGTTCTATGAATTAACCAAGTCTTACCCATGCTCCCTCAGCTGGGGGNTTTAACTACAACTCCCAGCATCCTTAGAGGGGCACCGGTTGGACAGACTCGGCtttatttttgtttatgtttttttttttAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTANNNNTGTNCTATATTGTAAGATATTGTACATAGNCACAAAGCTATTNCGTTCTGTACATTTCTTTTGTATAAAGTTAGAGGCTTCTCGACAAGAGCAAANNT
  3   1   2       bld Ga12      in                         XL211m08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTTAATGGTATCCATTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTGCTGCTGCCATGAGCTTTATTNTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTTTCCCCTTCACATCCATGGGTGACCCCCCTACGAGTGCCAAGTGTGCCTAAATAATGTTTATTTNTTNTTGGCATGGCGGGAGTCATAACAGCAAGGTGCGGGTTTTATGAATTAACCAAGTTTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTAGAGGGGCNCCGGTTGGACAGACTCGGCTTTATTTTTGTTTATGTTTTTTTTTTTAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGGCTTCTCGACAAGAGCAAATATTGGAGTATTCTAT
  3   1   2       bld DMZ                                 rxl275m19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTAATGGTATCCANTAGCAGGGACTTGAATGACTGGTCGGAACAATGTACCTGGGATTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTGCTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGTGACCCCCCTACGAGNGCCAAGTGTGCCTAAATAATGTTTATTTCTTCTNGGCATGGCGGGAGTCATAACAGCAAGGTGCGGGTTCTATGAATTAACCAAGTCTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTAGAGGGGCACCGGTTGGACAGACTCGGCNTTATTTTTGTTTATGTTTTTTTTTTAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGGCTTCTCGACAAGAGCAAATA
  3   1   2       bld Ga15      in                       XL502i11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCGGAACAATGTACCTGGGANTGAAGCCTCCCTGATTTCTCCCATTTATATGCAAGGAGCATTTGTGAAGGAGATAATTATAACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAAGAGTTTGTGCTGCTGCCATGAGCTTTATTNTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTCTCCCCTTCACATCCATGGGNGNCCCCCCTACGAGNGCCAAGNGNGCCTAAATAATGTTTATTTNTTCTTGGCATGGCGGGAGTCATAACAGCAAGGNGCGGGTTTTATGAATTAACCAAGTNTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTAGAGGGGCCCCGGTTGGACAGACTCGGCTTTATTTTTGTTTANGTTTTTTTTTTTAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGGC
  3   1   2       bld Tbd7                                 XL056l04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACTAAGCAGGGGTCGGGAATGAACTCCCTCCCTCGGCTGCAAGGAAANAGTTTGTGCTGCTGCCATGAGCTTTATTCTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTNTCCCCTTCACATCCATGGGTGACCCCCCTACGAGTGCCAAGTGTGCCTAAATAATGTTTATTTNTTCTTGGCATGGCGGGAGTCATAACAGCAAGGTGCGGGTTNTATGAATTAACCAAGTNTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTANAGGGGCNCCGGTTGGACAGACTCGGCTTTATTTTTGTTTATGTTTTTTTTTTTTAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGGCTGCTCGACAAGAGCAA
  3   1   2       add Ga12      in                         XL150f21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGGTNGGGAATGAACTCCCTCCCTNGGNTGCAAGGAAAGAGTTTGTGNTGNTGCCATGAGCTTTATTNTGGTTCTGTTTGTGTTTAGCCGAATCCTCAGCCATTTTTCCCCTTCACATCCATGGGTGACCCCCCTACGAGTGCCAAGTGTGCCTAAATAATGTTTATTTNTTCTTGGCATGGCGGGAGTCATAACAGCAAGGTGCGGGTTNTATGAATTAACCAAGTNTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTANAGGGGCNCCGGTTGG
  3   1   2       add Tbd7      out                        XL099o09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGNTGNTNCCATNAGCTTTATTNTGGTTCTGTTTGNGTTTAGCCGAATCCTCAGCCATTTTTCCCCTTNANATCCATGGGTGACCCCCCTACGAGTGCCAAGTGNGCCTAAATAATGTTTATTTTTTNTTGGCATGGCGGGAGTNATAANAGCAAGGTGCGGGTTTTATGAATTAACCAAGTNTTACCCATGCTCCCTCAGCTGGGGGTTTTAACTACAACTCCCAGCATCCTTANAGGGGCNCCGGTTGGA
  3   1   2       bld Ga18      out                      xlk56f05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTATTTCTTCTTGNCATGGCGGGAGNNANNACANCAAGGNGCGGGTNCTATGAATTAACCAANTCTNNCCCANGCTNCCTCAGCTGGGGGNNNNNTCTACANCTCCCANCNNNCTTANAGGGGCNCCGNNNGGACAGNCTCGGCTTTATTTTTTTTTTTTTTTTTTTTTTTAACTAANCNAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGNCTTCTCNGACAAGAG
  3   1   0       add Ga18      in                       xlk51k20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCACGCGTCCGACTAGTTCTAGACAGACTCGGCTTTATTTTTGTTTNTNTTTTTTTTTTTANCTAAGCTAATNGCCTTAAATAAANTGTCTTNAGAAGCAGTNCNNCAAATGAAA
  5   1   2       bld Ga18      in                       xlk51k20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTAGTTCTAGACAGACTCGGCtttatttttgtttatgtttttttttttAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGGCTTCTCGACAAGAGCAAATATTGGAGTATTCTATTTTGTCAATAAAATGACTTTTTTTATAT
  3   1   2       add Ga18                             rxlk159o14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GNCTTTNNTTTTTTTTTTTTTTTTTTTTTTNNTAANCNANNNNNCTTAAATAAAATNTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGNCTTCTCGACAAGAGCAAATA
  5  -1   2       bld Neu4      in                    IMAGE:4084934.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGtttttttttttAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGGCTTCTCGACAAGAGCAAATATTGGAGTATTCTATTTTGTCAATAAAATGACTTTTTTTATATaaaaaaanaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk129b16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTTTTTTAACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGNCTTCTCGACAAGAGCAAATATTNGANT
  5   1   2       bld Ga18      in                      xlk129b16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACTAAGCTAATTGCCTTAAATAAAATGTCTTAAGAAGCAGTACCCCAAATGAAATACGGGTTTCTTCCATGATAGGATGTATTTATATAATTATTTGTGTTCTATATTGTAAGATATTGTACATAGTCACAAAGCTATTACGTTCTGTACATTTCTTTTGTATAAAGTTAGAGGCTTCTCGACAAGAGCAAATATTGGANNNTTCTATTTTGTCAATAAAAATGACtttttttttATNT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)