Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6642708.5.5                    18 PI      92         90     1041                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012771387 Xl3.1-IMAGE:7206707.5 - 19 ESTs
                                                                       -80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7206707.5                                                                                 GATCAGGAAGAGCCCCTGGAAGACGCTGCTTTCCTATTGCAAGTGTGGGCGCAACCTGTAGTACAGAGGTCTCCTTCATCCATTGCACACACAGCGCACAGGTGACAATGGAGGACCGGTGGCAAGAGTGCATGGATTTTGCTGTTTCAATAGCAAGAAAGGCAGGCTCAGTGGTGTGTGCAGCACTAAAGGAAGATGTTTCAATAATGGTTAAAAGCTCCCCAGCAGATCTGGTGACAGCCACAGATCAAAAAGTAGAAGAAATGATTATCTCATCCATTAAGGAAAAATATCCATCGCACAGTTTTATTGGCGAGGAGTCTGTAGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACTAACTTCGTACACAGGTTTCCATTTGTGGCTGTGTCTATTGGATTTGCTGTGCACAAGCAGGTTGAATTTGGAGTTGTCTACAGCTGTGTAGAAGACAAAATGTACACTGGGAGAAAGGGAAAAGGTTCATTCTGTAATGGTCAGAAATTACAAGTCTCCGGACAGAAAGATATTACCAAATCCATGATAATAACGGAGCTAGGGTCAAATCGGAATCCAGAGGTTATTAAAACGGTGCTGTCTAACATGGAGAGACTGCTGTGTATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCTACTGGAGGTGCAGATGCTTATTATGAGATGGGTCTTCATTGCTGGGATATGGCAGCTGCGTCCGTCATCGTTACAGAAGCAGGCGGAACGATCCTGGATGCAACAGGAGGCCTGTTTGACCTGATGTCCTGCAGGATCATATCCGCTAGCAGCCGAGAAATAGCGGAGCGAATCGCTAAAGAGCTACAGATTATACCCCTGGAACGGGATGATGGCAAAAGTACCAACTGAAATGCCAGTTTTAACTAAAGGTGTTTTTGTACATATTGGCATAAGAATCTATGAATATTTATGGAATTATGTACATATGTTTATGTATTATGTTCTGTAATGAGTTTTTATTTTCATGTTTATGTATTATTTAGCAAACATGGTTTTTATTTTCTCTGTTATATTCAATTTTAATTATTGTTCTTTGTTTTACTAATAAGTTTACCTATTTCATTGTTTTACTTATAAGTTTACCTATGTTGGAATAAAAGTACCATAGTGC
                                                  Xl3.1-CHK-1012690240                                                                                       GAAGAGCCCCTGGxxxxxGCTGCTTTCCTATTGCAAGTGTGGGCGCAACCTGTAGTACAGAGGTCTGCTTCATCCATTGCACACACAGCGCACAGGTGACAATGGAGGACCGGTGGCAAGAGTGCATGGATTTTGCTGTTTCAATAGCAAGAAAGGCAGGCTCAGTGGTGTGTGCAGCACTAAAGGAAGATGTTTCAATAATGGTTAAAAGCTCCCCAGCAGATCTGGTGACAGCCACAGATCAAAAAGTAGAAGAAATGATTATCTCATCCATTAAGGAAAAATATCCATCGCACAGTTTTATTGGCGAGGAGTCTGTAGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACTAACTTCGTACACAGGTTTCCATTTGTGGCTGTGTCTATTGGATTTGCTGTGCACAAGCAGGTTGAATTTGGAGTTGTCTACAGCTGTGTAGAAGACAAAATGTACACTGGGAGAAAGGGAAAAGGTTCATTCTGTAATGGTCAGAAATTACAAGTCTCCGGACAGAAAGATATTACCAAATCCATGATAATAACGGAGCTAGGGTCAAATCGGAATCCAGAGGTTATTAAAACGGTGCTGTCTAACATGGAGAGACTGCTGTGTATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCTACTGGAGGTGCAGATGCTTATTATGAGATGGGTCTTCATTGCTGGGATATGGCAGCTGCGTCCGTCATCGTTACAGAAGCAGGCGGAACGATCCTGGATGCAACAGGAGGxCxGTTTGACCTGATGTCCTGCAGGATCATATCCGCTAGCAGCCGAGAAATAGCGGAGCGAATCGCTAAAGAGCTACAGATTATACCCCTGGAACGGGATGATGGCAAAAGTACCAACTGAAATGCCAGTTTTAACTAAAGGTGTTTTTGTACATATTGGCATAAGAATCTATGAATATTTATGGAATTATGTACATATGTTTATGTATTATGTTCTGTAATGAGTTTTTATTTTCATGxxxxxxTATTATxTxxxxxAxxxxGTTTTTxTTTxxTCTGTTATATTCAATTTTAATTATTGTTCTTTGTTTTACTAAxxxxTxxxxxTxTTTCATxxTTxxACTTATAAGTTTxxCxxxGTTGGAATAAAAGTACCATAGTGCTGAAAA
                                                      consensus depths                                                                                      2     4     2     7     4     7     7    10     8    11     8    12     7    12    10    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    12    13    13    13    13    13    13    13    12    12    12    12    11    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    12    12    11    12    12    12     9    12    12    12    12    12    11    12    12    12    12    13    10    13    12    13    13    14    13    14    13    14    13    14    12    14    12    14     9    11     9    11     9    11     9    12     8    12     9    13    10    12     8    10     7     9     7    10     9     9     8     8     8     8     8     8     8     8     8     8     6     8     6     9     7     9     7     9     7     9     7     9     6     9     6     8     6     8     6     8     6     7     6     7     6     7     5     7     3     7     3     7     3     7     3     6     3     6     3     6     3     6     3     6     2     6     2     6     2     6     2     6     2     6     2     6     2     6     2     6     2     6     2     6     2     6     2     6
                                                                   SNP                                                                                                                                                         G-----------
                                                                   SNP                                                                                                                                                                                                                                             ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                         ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----G-----C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -A-C--------
                                               BLH ATG     107    1075                                                                                 
                                               BLH MIN      80     137                                                                                 
                                               EST CLI       5       3                                                                                 
  5   1   2       bld Egg1 5g                            PBX0055A02.5p GGCCTACACGCAAAGGGTTCTGGGAGCGCAGTGAACGGAAAAGCCAGTGTGTTCTTGAAGATCAGCGTTCCGAACGGAAGAGGAAGTGCTGCACTACGCCCGGAAGCGCTTTCCTATTGCAAGTGTGGGCGCAACCTGTAGTACAGAGGTCTGCTTCATCCATTGCACACACAGCGCACAGGTGACAATGGAGGACCGGTGGCAAGAGTGCATGGATTTTGCTGTTTCAATAGCAAGAAAAGCAGGCTCAGTGGTGTGTGCAGCACTAAAGGAAGATGTTTCAATAATGGTTAAAAGCTCCCCAGCAGATCTGGTGACAGCCACAGATCACAAAGTAGAAGAGATGATTATCTCATCCATTAAGGAAAAAT
  5   1   2       chi Tbd7      in                         XL092c06.5p                     AACCTGTAGTACAGAGGTCTCCTTCATCCTTGCACACACAGCGCACAGACTGTTGCAGGCGATCAGGAAGAGCCCCTGGAAGACATCTGCCTCGTGGTTCCTGTCTGTGTGCTGTGGGGGCGGAGATCGACGATCCGGTGCAGGCTGCAGCAGCAGGACACGTGACAATGGAGGACCGGTGGCAAGAGTGCATGGATTTTGCTGTTTCAATAGCAAGAAAGGCAGGCTCAGTGGTGTGTGCAGCACTAAAGGAAGATGTTTCAATAATGGTTAAAAGCTCCCCAGCAGATCTGGTGACAGCCACAGATCAAAAAGTAGAAGAAATGATTATCTCATCCATTAAGGAAAAATATCCATCGCACAGTTTTATTGGCGAGGAGTCTGTAGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACTAACTTCGTACACAGGTTTCCATTTGTGGCTGTGTCTATTGGATTTGCTGTGCACAAGCAGTTTGAATTTGGAGTTGTCTACAGCTGTGTAGAAGACAAAATGTACACTGGGAGAAAGGGAAAAGGTTCATTCTGTAATGGTCAGAAATTACAAGTCTCCGGACAGAAAGATATTACCAAATCCATGATAATAACGGAGCTAGGGTCAAATCGGAATCC
  5   1   2       chi DMZ       in                         xl229p02.5p                                                  CCTTCATCCATTGCACACACAGCGCACAGGCGATCAGGAAGAGCCCCTGGAAGACATCTGCCTCGTGGTTCCTGTCTGTGTGCTGTGGGGGCGGAGATCGACGATCCGGTGCAGGCTGCAGCAGCAGGACACGTGACAATGGAGGACCGGTGGCAAGAGTGCATGGATTTTGCTGTTTCAATAGCAAGAAAGGCAGGCTCAGTGGTGTGTGCAGCACTAAAGGAAGATGTTTCAATAATGGTTAAAAGCTCCCCAGCAGATCTGGTGACAGCCACAGATCAAAAAGTAGAAGAAATGATTATCTCATCCATTAAGGAAAAATATCCATCGCACAGTTTTATTGGCGAGGAGTCTGTAGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACTAACTTCGTACACAGGTTTCCATTTGTGGCTGTGTCTATTGGATTTGCTGTGCACAAGCAGGTTGAATTTGGAGTTGTCTACAGCTGTGTAGAAGACAAAATGTACACTGGGAGAAAGGGAAAAGGTTCATTCTGTAATGGTCAGAAATTACAAGTCTCCGGACAGAAAGATATTACCAAATCCATGATAATAACGGAGCTAGGGTCAAATCGGAATCCAGAGGTTATTAAAACGGTGCTGTCTAACATGGAGAGACTGCTGTGTATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAAC
  5   1   2       bld Ooc3 5g                         IMAGE:3436985.5p                                                       GAGGAAGTGCTGCACTACGCCCGGAAGCGCCTTTCATTGCTGAGGGTTCTGCTGCTTTCCTATTGCAAGTGTGGGCGCAACCTGTAGTACAGAGGTCTCCTTCATCCATTGCACACACAGCGCACAGGTGACAATGGAGGACCGGTGGCAAGAGTGCATGGATTTTGCTGTTTCAATAGCAAGAAAGGCAGGCTCAGTGGTGTGTGCAGCACTAAAGGAAGATGTTTCAATAATGGTTAAAAGCTCCCCAGCAGATCTGGTGACAGCCACAGATCAAAAAGTAGAAGAAATGATTATCTCATCCATTAAGGAAAAATATCCATCGCACAGTTTTATTGGCGAGGAGTCTGTAGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACTAACTACGTACACAGGTTTCCATTTGTGGCTGTGTCTATTGGATTTGCTGTGCACAAGCATGTTGAATTTGGAGTTGTCTACAGCTGTGTAGAAGACTAAATGTACACTGCGAGAAAGGGAATAAGTTCATTCTGTTATGGTCAGAAATTACAAGTCTCCTGACAGAAAGATATTACCAAATCCATGATAATAACCGAGCTAGGGTCAAATCTGAATCCACACGTAATTAAAACGGTGCTGTCTAACATGGAGAGACTGCTGTGTATTTCCATCCACTGGATTAGAACAGTTGGTTCA
  5   1   2       bld Te2  5g                         IMAGE:7211446.5p                                                                                      TTTCATTGCTGAGGGTTCTGCTGCTTTCCTATTGCAAGTGTGGGCGCAACCTGTAGTACAGAGGTCTCCTTCATCCATTGCACACACAGCGCACAGGTGACAATGGAGGACCGGTGGCAAGAGTGCATGGATTTTGCTGTTTCAATAGCAAGAAAGGCAGGCTCAGTGGTGTGTGCAGCACTAAAGGAAGATGTTTCAATAATGGTTAAAAGCTCCCCAGCAGATCTGGTGACAGCCACAGATCAAAAAGTAGAAGAAATGATTATCTCATCCATTAAGGAAAAATATCCATCGCACAGTTTTATTGGCGAGGAGTCTGTAGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACTAACTTCGTACACAGGTTTCCATTTGTGGCTGTGTCTATTGGATTTGCTGTGCACAAGCAGGTTGAATTTGGAGTTGTCTACAGCTGTGTAGAAGACAAAATGTACACTGGGAGAAAGGGAAAAGGTTCATTCTGTAATGGTCAGAAATTACAAGTCTCCGGACAGAAAGATATTACCAAATCCATGATAATAACGGAGCTAGGGTCAAATCGGAATCCAGAGGTTATTAAAACGGTGCTGTCTAACATGGAGAGACTGCTGTGTATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCTACTGGAGGTGCAGATGCTTATTATGAGATGGGTCTTCATTGCTGGGATATGGCAGCTGCGTCCGTCATCGTTACAGAAGCAGGCGGGAACAATCCTGGATGCAACAGGAAGGCCTGTTTTGACCTGNATTGTCGTGGCAGGATCATTTTCCGCCAACCAAGCCGAAAAAATAAC
  5   1   2       bld Kid  5g                         IMAGE:7008383.5p                                                                                           CGGACGCGTGGGCTGCTGCTTTCCTATTGCAAGTGTGGGCGCAACCTGTAGTACAGAGGTCTGCTTCATCCATTGCACACACAGCGCACAGGTGACAATGGAGGACCGGTGGCAAGAGTGCATGGATTTTGCTGTTTCAATAGCAAGAAAAGCAGGCTCAGTGGTGTGTGCAGCACTAAAGGAAGATGTTTCAATAATGGTTAAAAGCTCCCCAGCAGATCTGGTGACAGCCACAGATCAAAAAGTAGAAGAAATGATTATCTCATCCATTAAGGAAAAATATCCATCGCACAGTTTTATTGGCGAGGAGTCCGTAGCTGCAGGAGCTGGAAGCACGCTAACAGATAATGCAACCTGGATCATAGATCCCATAGATGGCACAACTAACTTCGTACACAGGTTTCCATTTGTGGCGGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTCTACAGCTGTGTAGAAGACAAAATGTACACTGGGAGAAAGGGAAAAGGGTCATTCTGTAATGGTCAGAAATTACAAGTCTCCGGACAGAAAGATATTACCAAATCCATGATAATAACGGAGCTAGGGTCAAATCGGAATCCAGAGGTTATTAAAACTGTGCTGTCTAACATGGAGAGACTGCTGTGTATTTCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACAT
  5   1   2       bld Tbd5 5g                IMAGE:3580461-IMAGp.IMAGp                                                                                             ACTCCCCCCGGGCTGCCTTTCCTATTGCAAGTGTGGGCGCCACCTGTAGTACAGAGGTCTGCTTCATCCCTTGCACACACAGCGCACAGGTGACAATGGAGGACCGGTGGCCAGAGTGCATGGATTTTGCTGTTTCAATAGCAAGAAAAGCAGGCTCAGTGGTGTGTGCAGCCCTAAAGGAAGATGTTTCCATAATGGTTAAAAGCTCCCCAGCAGATCTGGTGACAGCCCCAGATCAAAAAGTAGAAGAAATGATTATCTCCTCCATTAAGGAAAAATATCCATCGCACCGTTTTATTGGCGAGGAGTCCCTAGCCGCCGGAGCTGGAAGCCCGCTAACAGATAATGCAACCTGGATCATAGATCCCATAGATGGCACAACTAACTTCGTACACCGGTTTCCATTTGTGGCGGTGCCCATTGGATTTGCTGGGAACAAGCCGGTTGAATTTGGAGTTGTCTACAGCTGGGTAGAAGACAAAATGTACCCTGGGAGAAAGGGAAAAGGGTCCTTCTGTAATGGTCAGAAATTACAAGTCTCCGGACAGAAAGATATTACCAAATCCATGATAATAACGGACGCTAGGGTCAAATCGGAATCCCGAGGTTATTAAAACTGTGCTGTCTAACATGGAGAGACTGCTGTGTATTCCCATCCACGCGATTAGAGCAGTTGGTACACCAGCAGTAAACATGTGTCTCGTGGCTACTGGAGGTGCAGATGCTT
  5   1   2       bld Tbd5 5g                         IMAGE:3580461.5p                                                                                                          CTGCTTTCCTATTGCAAGTGTGGGCGCAACCTGTAGTACAGAGGTCTGCTTCATCCATTGCACACACAGCGCACAGGTGACAATGGAGGACCGGTGGCAAGAGTGCATGGATTTTGCTGTTTCAATAGCAAGAAAAGCAGGCTCAGTGGTGTGTGCAGCACTAAAGGAAGATGTTTCAATAATGGTTAAAAGCTCCCCAGCAGATCTGGTGACAGCCACAGATCAAAAAGTAGAAGAAATGATTATCTCATCCATTAAGGAAAAATATCCATCGCACAGTTTTATTGGCGAGGAGTCCGTAGCTGCAGGAGCTGGAAGCACGCTAACAGATAATGCAACCTGGATCATAGATCCCATAGATGGCACAACTAACTTCGTACACAGGTTTCCATTTGTGGCGGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTCTACAGCTGTGTAGAAGACAAAATGTACACTGGGAGAAAGGGAAAAGGGTCATTCTGTAATGGTCAGAAATTACAAGTCTCCGGACAGAAAGATATTACCAAATCCATGATAATAACGGAGCTAGGGTCAAATCGGAATCCAGAGGTTATTAAAACTGTGCTGTCTAACATGGAGAGACTGCTGTGTATTCCCATCCACGGGATGAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCTACATGATGTGCAGATGCTTATTATGAGATGCGTCTC
  5   1   2       bld Neu7 5g                              XL042o18.5p                                                                                                           CTGCGATCCTATTGCAAGTGTGGGCGCAACCTGTAGTACAGAGGTCTCTTCATCCATTTCACACACAGCGCACAGGTGACAATGGAGGACCGGTGGCAAGAGTGCATGGATTTTGCTGTTTCAATCGCAAGAAAGGCAGGCTCAGTGGTGTGTGCAGCACTAAAGGAAGATGTTTCAATAATGGTTAAAAGCTCCCCAGCAGATCTGGTGACAGCCACAGATCAAAAAGTAGAAGAAATGATTATCTCATCCATTAAGGAAAAATATCCATCGCACAGTTTTATTGGCGAGGAGTCTGTAGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACTAACTTCGTACACAGGTTTCCATTTGTGGCTGTGTCTATTGGATTTGCTGTGCACAAGCAGGTTGAATTTGGAGTTGTCTACAGCTGTGTAGAAGACAAAATGTACACTGGGAGAAAGGGAAAAGGTTCATTCTGTAATGGTCAGAAATTACAAGTCTCCGGACAGAAAGATATTACCAAATCCATGATAATAACGGAGCTAGGGTCAAATCGGAATCC
  5   1   2       bld Te2N 5g                         IMAGE:7206707.5p                                                                                                                  CTATTGCAAGTGTGGGCGCAACCTGTAGTACAGAGGTCTCCTTCATCCATTGCACACACAGCGCACAGGTGACAATGGAGGACCGGTGGCAAGAGTGCATGGATTTTGCTGTTTCAATAGCAAGAAAGGCAGGCTCAGTGGTGTGTGCAGCACTAAAGGAAGATGTTTCAATAATGGTTAAAAGCTCCCCAGCAGATCTGGTGACAGCCACAGATCAAAAAGTAGAAGAAATGATTATCTCATCCATTAAGGAAAAATATCCATCGCACAGTTTTATTGGCGAGGAGTCCGTAGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACTAACTTCGTACACAGGTTTCCATTTGTGGCGGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTCTACAGCTGTGTAGAAGACAAAATGTACACTGGGAGAAAGGGAAAAGGGTCATTCTGTAATGGTCAGAAATTACAAGTCTCCGGACAGAAAGATATTACCAAATCCATGATAATAACGGAGCTAGGGTCAAATCGGAATCCAGAGGTTATTAAAACGGTGCTGTCTAACATGGAGAGACTGCTGTGTATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCTACTGGAGGTGCAGATGCTTATTATGAGATGGGTCTTCATTGCTGGGATATGGCAGCTGCGTCCGTCATCGTTACAGAAGCAGGCGGAAACATCCTGGNATGCACAGGAGGGCTGTTTTGACCTGATTGTCCTGCAGGATCATATCCGCTAGCAGCCCGAAGAAATAGCGGAAGCGAATCGCCTAAAGGGCCTAACGATTATTCCCCC
  5   1   2      seed DMZ  5g                              xl250h02.5p                                                                                                                             GTGGGCGCAACCTGTAGTACAGAGGTCTCCTTCATCCATTGCACACACAGCGCACAGGTGACAATGGAGGACCGGTGGCAAGAGTGCATGGATTTTGCTGTTTCAATAGCAAGAAAGGCAGGCTCAGTGGTGTGTGCAGCACTAAAGGAAGATGTTTCAATAATGGTTAAAAGCTCCCCAGCAGATCTGGTGACAGCCACAGATCAAAAAGTAGAAGAAATGATTATCTCATCCATTAAGGAAAAATATCCATCGCACAGTTTTATTGGCGAGGAGTCTGTAGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACTAACTTCGTACACAGGTTTCCATTTGTGGCTGTGTCTATTGGATTTGCTGTGCACAAGCAGGTTGAATTTGGAGTTGTCTACAGCTGTGTAGAAGACAAAATGTACACTGGGAGAAAGGGAAAAGGTTCATTCTGTAATGGTCAGAAATTACAAGTCTCCGGACAGAAAGATATTACCAAATCCATGATAATAACGGAGCTAGGGTCAAATCGGAATCCAGAGGTTATTAAAACGGTGCTGTCTAACATGGAGAGACTGCTGTGTATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGG
  5   1   2       bld Neu7 5g3  in                         XL033k01.5p                                                                                                                                            GGTAGTACAGAGGTCTCTTCTCCTTTCACACACAGCGCACAGGTGACAATGGAGGACCGGTGGCAAGAGTGCATGGATTTTGCTGTTTCAATCGCAAGAAAGGCAGGCTCAGTGGTGTGTGCAGCACTAAAGGAAGATGTTTCAATAATGGTTAAAAGCTCCCCAGCAGATCTGGTGACAGCCACAGATCAAAAAGTAGAAGAAATGATTATCTCATCCATTAAGGAAAAATATCCATCGCACAGTTTTATTGGCGAGGAGTCTGTAGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACTAACTTCGTACACAGGTTTCCATTTGTGGCTGTGTCTATTGGATTTGCTGTGCACAAGCAGGTTGAATTTGGAGTTGTCTACAGCTGTGTAGAAGACAAAATGTACACTGGGAGAAAGGGAAAAGGTTCATTCTGTAATGGTCAGAAATTACAAGTCTCCGGACAGAAAGATATTACCAAATCCATGATAATAACGGAGCTAGGGTCAAATCGGAATC
  5   1   2       bld Skin      in                    IMAGE:8640237.5p                                                                                                                                                                                                                                                                          CTAAAGGAAGATGTTTCAATAATGGTTAAAAGCTCCCCAGCAGATCTGGTGACAGCCACAGATCAAAAAGTAGAAGAAATGATTATCTCATCCATTAAGGAAAAATATCCATCTCACAGTTTTATTGGCGAGGAGTCTGTAGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACTAACTTCGTACACAGGTTTCCATTTGTGGCTGTGTCTATTGGATTTGCTGTGCACAAGCAGGTTGAATTTGGAGTTGTCTACAGCTGTGTAGAAGACAAAATGTACACTGGGAGAAAGGGAAAAGGTTCATTCTGTAATGGTCAGAAATTACAAGTCTCCGGACAGAAAGATATTACCAAATCCATGATAATAACGGAGCTAGGGTCAAATCGGAATCCAGAGGTTATTAAAACGGTGCTGTCTAACATGGAGAGACTGCTGTGTATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTAGTGGCTACTGGAGGTGCAGATGCTTATTATGAGATGGGTCTTCATTGCTGGGATATGGCAGCTGCGTCCGTTATCGTTACAGAAGCAGGCGGAACGATCCTGGATGCAACAGGAGGACCGTTTGACCTGATGTCCTGCAGGATCATATCCGCTAGCAGCCGAGAAATAGCGAGCGATCGCTAAGAGCTACAGATATACCCTGGACGGGAGATGCAAAGTACACTGAATGCAGTTTATTNAAGGGCTGTCTATTTGCGAGATCTGTATGTCGATTTGACTATGCTAGATCATGATATATGATAT
  3   1   2       bld Skin      in                    IMAGE:8640237.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCAGTGATGGGTTTTACAGTGGTAGGCAAATTCCTTGGGGAAGGAAAGTCCTTTTTATGTTGAAATTCAGTTTCGGCAGAAGGTTTTCCCCTCCCGGTTATACGGGGCTAGGTCAATTGATCCCAGGGTTATAAAACGGTGCTTCTAACTGGAGAGATTGCTGGTATTCCCTCCACGGATTAGAGCAGTTGTACAGCAGCAGTAAACATGTGTCTAGTGGCTACTGGAGGTGCAGATGCTTATTATGAGATGGGTCTTCATTGCTGGGATATGGCAGCTGCGTCCGTTATCGTTACAGAAGCAGGCGGAACGATCCTGGATGCAACAGGAGGACCGTTTGACCTGATGTCCTGCAGGATCATATCCGCTAGCAGCCGAGAAATAGCGGAGCGAATCGCTAAAGAGCTACAGATTATACCCCTGGAACGGGATGATGGCAAAAGTACCAACTGAAATGCCAGTTTTAATTAAAGGGGGCTGTCTAATTTTTGCAGAGGACTCTTGTATTTGTCTGATTTTTGTACATATTGGCATAAGAATCTATGAATATTTATGGAATTATGTACATATGTTTATGTATTATGTTCTGTAATGAGTTTTTATTTTCATGCAACAACATTTTTAAGCAAACATGTACATGTTATATTCAATTTTAATTATTGTTCTTTGTTTTACTTATAAGTTTACCTATTTCATACTTCCTGCCATTCATCTACAGAGTGAANAAANCCCCNGCCCCCCCCCC
  5   1   2       bld Lmb2                            IMAGE:8635737.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAATTACAAGTCTCCGGACAGAAAGATATTACCAAATCCATGATAATAACGGAGCTAGGGTCAAATCGGAATCCAGAGGTTATTAAAACGGTGCTGTCTAACATGGAGAGACTGCTGTGTATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCTACTGGAGGTGCAGATGCTTATTATGAGATGGGTCTTCATTGCTGGGATATGGCAGCTGCGTCCGTCATCGTTACAGAAGCAGGCGGAACGATCCTGGATGCAACAGGAGGCCTGTTTGACCTGATGTCCTGCAGGATCATATCCGCTAGCAGCCGAGAAATAGCGGAGCGAATCGCTAAAGAGCTACAGATTATACCCCTGGAACGGGATGATGGCAAAAGTACCAACTGAAATGCCAGTTTTAACTAAAGAGTTGGAATAAAAGTACCATAGTGCTGACACCATCGATTCTATAGTTCCAGGTCTCTCTGTGATCTACGCTGCACCCTACTGGCGACCTGAAGCAATAGAATGAATGCTGAAAGGGTTAAAGTTCTACAACTAAATTGTCCGTAGATGAAAAGTATGAGTAAGGAAAATTTACGTATGCCTTAAACAATAATATAGAGATTGTTTTTTTTTCTTGCCnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnGGGCGCGCAGGCTGAACCTGACGCGTCAGCTCCGCCAATGACGATCTAATCGATGAAGACATGTGATGACACCACGAGCGGAAAGTATGGATTGAGATGTATGACTTACGCAAATAACATGTTTT
  3   1   2       bld Tbd7      in                         XL092c06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGACTGCTGTGTATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTAGTGGCTACTGGAGGGTGCAGATGCTTATTATGAGATGGGTCTTCATTGCTGGGATATGGCAGCTGCGTCCGTTATCGTTACAGAAGCAGGCGGAACGATCCTGGATGCAACAGGAGGACCGTTTGACCTGATGTCCTGCAGGATCATATCCGCTAGCAGCCGAGAAATAGCGGAGCGAATCGCTAAAGAGCTACAGATTATACCCCTGGAACGGGATGATGGCAAAAGTACCAACTGAAATGCCAGTTTTAATTAAAGGGGGCTGTCTAATTTTTGCAGAGGACTCTTGTATTTGTCTGATTTTTGTACATATTGGCATAAGAATCTATGAATATTTATGGAATTATGTACATATGTTTATGTATTATGTTCTGTAATGAGTTTTTATTTTCATGCAACAACATTTTTAAGCAAACATGTACATGTTATATTCAATTTTAATTATTGTTCTTTGTTTTACTTATAAGTTTACCTATTTCATACTTCCTGCCATTCATTCTACAGAGTNGAATAAAAGTACCATAGTGC
  3   1   2       bld Egg2                            IMAGE:5162405.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCTACTGGAGGTGCAGATGCTTATTATGAGATGGGTCTTCATTGCTGGGATATGGCAGCTGCGTCCGTCATCGTTACAGAAGCAGGCGGAACAATCCTGGATGCAACAGGAGGCCTGTTTGACCTGATGTCCTGCAGGATCATATCCGCTAGCAGCCGAGAAATAGCGGAGCGAATCGCTAAAGAGCTACAGATTATACCCCTGGAACGGGATGATGGCAAAAGTACCAACTGAAATGCCAGTTTTAACTAAAGGTGTTTTTGTACATATTGGCATAAGAATCTATGAATATTTATGGAATTATGTACATATGTTTATGTATTATGTTCTGTAATGAGTTTTTATTTTCATGCAACAAAATTTTTTAGCAAACATGTACATTTTTTAGTCTGTTATATTCAATTTTAATTATTGTTCTTTGTTTTACTAATAAGTTTACCTATTTCATACTTCCTGACATTCATTCTACAGAGTTGGAATAAAAGTACCATAGTGCTGAAAAAAAAAAAAAAAAAAA
  3   1   2       add DMZ       in                         xl229p02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACNGGAGGTGCAGATGCTTATTATGAGATGGGTCTTCATTGCTGGGATATGGCAGCTGCGTCCGTCATCGTTACAGAAGCAGGCGGAACAATCCTGGATGCAACNGGAGGCCTGTTTGACCTGATGTCCTGCAGGATCATATCCGCTAGCNGCCGAGAAATAGCGGAGCGAATCGCTAAAGAGCTACNGATTATACCCCTGGAACGGGATGATGGCATAAGTACCAACTGAAATGCCNGTTTTAACTAAAGGTGTTTTTGTACATATTGGCATAAGAATCTATGAATATTTATGGAATTATGTACATATGTTTATGTATTATGTTCTGTAATGAGTTTTTATTTTCNTGCAACAAAATCTTTTAGCAAACATGTACNTTTTTTAGTCTGTTATATTCAATTTTAATTATTGTTCTTTGTTTTACTAATAAGTTTACCTATTTCATACTTCCTGCCNTTCNTTCTACAGAGTTGGAATAAAAGTACCATAGTGCTGACNCCNTCGATTCTATAGTTCCNGGTCTCTCTGTGATNTACGCTGCNCCCTACNGGCGACCTGAAGCNATAGAATGAATGCTGAAAGGGTTAAAGTTCTACAACTAAATTGTCCGTAGATGAAAAGTATGAGTAAGGAAAATTTACGTATG
  3   1   1       add Neu7 5g3  in                         XL033k01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGCAACAGNAGGCCTGTTTGACCTGATGTCCTGCAGGATCATATCCGCTAGCAGCCGAGAAATAGCGGAGCGAATCGCTAAAGAGCTACAGATTATACCCCTGGAACGGGATGATGGCAAAAGTACCAACTGAAATGCCAGTTTTAACTAAAGGTGTTTTTGTACATATTGGCATAAGAATCTATGAATATTTATGGAATTATGTACATATGTTTATGTATTATGTTCTGTAATGAGTTTTTATTTTCATGCAACAATTTTTTAGCAAACATGTACATTTTTTAGTCTGTTATATTCAATTTTAATTATTGTTCTTTGTTTTACTAATAAGTTTACCTATTTCATACTTCCTGCCATTCATTCTACAGAGTTGGAATAAAAGTACCATAGTGCTGACACCATCGATTCTATAGTTCCAGGTCTCTCTGTGATCTACGCTGCACCCTACTGGCGACCTGAAGCAATAGAATGAATGCTGAAAGGGTTAAAGTTCTACAACTAAATTGTCCGTAGATGAAAAGTATGAGTAAGGAAAATTTACGTATGCCTTAAAACAATAAATATAGAGNATGTTTTTTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)