Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012771417 Xl3.1-IMAGE:7203015.5 - 21 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7203015.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGACGCTCGCACTGGAAACAGTGAAAAGTCAGCGTTACCGAGTTCTGAGTCTCAGTCTCTCCGCTCTCCGCGCCTGATCTTCCCTCCACCGACCCCTGAGCCCTCTGACCCCTCAGACTTACCACTCGTGTCTCTGTCAGACCCTGAATCCGGAACATGTCCGAACTGGGATCCGAGGAATTCGAGGAGGAAGCGGAACCCGATCTTGGGGAGTACGAGGGGGAGCGCAATGAGGCGGGCGAGAGGAACGGGCACGGGAGGGCAAGACTGCCCAATGGAGATACTTACGAGGGACAGTATGAGGGGGGGAAGAGACACGGGCAGGGAACATATCGATTTAAGAACGGGGCCCGATACATCGGAGATTATCATCAGAACAAAAAGCACGGGATGGGCACGTTTATGTACCCCGATGGCTCGAAATATGAAGGTGACTGGGTAGATGATCAGCGACAGGGTCAGGGAGTTTACTATTATCCCAATGGAGACACCTACAGTGGGGACTGGCTGTCTCACCAGAGACACGGACAGGGAGTTTACACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAGGGATCCGGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAATTTGTTGGCAACACGCTCCTCGGCCCCGGCAAATACATATTTGACATTGGATGTGAGCAGCACGGGACCTATGAACAGACAGAGCAGGAGAAAGATGAAGATGAAGAAGAGGAGCCCCTGGCAGTGCCAGTAACTAAGTGGAACCCTGACAATATCACTGGCCTGACCCACTTGTCACCAACTGCTGAGGCCACACCCCCTGCCCCAGTGGTTGGAGATCCCAGTGAGGCTGAAGCAGCAAGTTCCGAGGATTTACCCACAGAAGGTGGCGCTCTGCTCACAGACCAGGAGGCGGAGCTTCCATTACCGTTAGTGAGTGAAACTGAGGCAGTGGGCGTGGCCTCGGAATCCCTAGAAGAAAAAGCTGAAGTCACCTCTAGGATCTCTGAAAGTGAGGAGACATTTGCTGAAGAATGACTCTCATCCAAGGACCTGAAAACGACACAAGGACTGAGTGTCAGGTACTGAGATTTCTATCGTTGCCCTGTCTTATCCTCATAGAGACTGTTCCAGCCCGTCAGACCTTCCTGCACATCAGTTCCAGCCTCTCCATCATCACTGGGCTCAGTTCTTGCAAGTTCATTAATAAAGGA
                                                  Xl3.1-CHK-1012689689                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCGCACTGGAAACAGTGAAAAGTCAGCGGTACCGAGTTCTGAGTCTCAGTCTCTCCGCTCTCCGCGCCTGATCTTCCCTCCACCGACCCCTGAGCCCTCTGACCCCTCAGACTTACCACTCGTGTCTCTGTCAGACCCTGAATCCGGAACATGTCCGAACTGGGATCCGAGGAATTCGAGGAGGAAGCGGAACCCGATCTTGGGGAGTACGAGGGGGAGCGCAATGAGGCGGGCGAGAGGAACGGGCACGGGAGGGCAAGACTGCCCAATGGAGATACTTACGAGGGACAGTATGAGGGGGGGAAGAGACACGGGCAGGGAACATATCGATTTAAGAACGGGGCCCGATACATCGGAGATTATCATCAGAACAAAAAGCACGGGATGGGCACGTTTATGTACCCCGATGGCTCGAAATATGAAGGTGACTGGGTAGATGATCAGCGACAGGGTCAGGGAGTTTACTATTATCCCAATGGAGACACCTACAGTGGGGACTGGCTGTCTCACCAGAGACACGGACAGGGAGTTTACACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAGGGATCCGGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAATTTGTTGGCAACACGCTCCTCGGCCCCGGCAAATACATATTTGACATTGGATGTGAGCAGCACGGGACCTATGAACAGACAGAGCAGGAGAAAGATGAAGATGAAGAAGAGGAGCCCCTGGCAGTGCCAGTAACTAAGTGGAACCCTGACAATATCACTGGCCTGACCCACTTGTCACCAACTGCTGAGGCCACACCCCCTGCCCCAGTGGTTGGAGATCCCAGTGAGGCTGAAGCAGCAAGTTCCGAGGATTTACCCACAGAAGGTGGCGCTCTGCTCACAGACCAGGAGGCGGAGCTTCCATTACCGTTAGTGAGTGAAACTGAGGCAGTGGGCGTGGCCTCGGAATCCCTAGAAGAAAAAGCTGAAGTCACCTCTAGGATCTCTGAAAGTGAGGAGACATTTGCTGAAGAATGACTCTCATCCAAGGACCTGAAAACGACACAAGGACTGAGTGTCAGGTACTGAGATTTCTATCGTTGCCCTGTCTTATCCTCATAGAGACTGTTCCAGCCCGTCAGACCTTCCTGCACATCAGTTCCAGCCTCTCCATCATCACTGGGCTCAGTTCTTGCAAGTTCATTAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     7     7     9    10    11    11    11    11    11    11    11    11    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    12    14    12    14    12    15    12    15    13    15    12    15    13    15    13    17    13    18    13    18    15    19    15    19    15    19    15    19    14    19    15    19    16    19    16    19    16    19    16    19    17    20    18    20    16    18    15    18    15    18    15    18    14    18    15    18    15    17    13    16    15    17    13    16    13    16    12    16    12    16    10    15     9    14    10    13    10    13     9    12     8    12     8    11     8    11     9    11     8    11     8    10     8    10     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     4     7     4     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------T-----
                                               BLH ATG     157     432                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     157     117                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     157      99                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI      29      41                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     157       5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN -== Ce ==== 2e-012     NP_492193.2 JunctoPHilin (83.1 kD) (jph-1) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 2e-014     AAI23948.1 Unknown (protein for IMAGE:7692845) [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ci ---- 1e-021     FAA00235.1 TPA: zinc finger protein [Ciona intestinalis] -----------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- At ---- 4e-026     NP_187453.1 phosphatidylinositol-4-phosphate 5-kinase family protein [Arabidopsis thaliana] ==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Os ---- 4e-028     NP_001060522.1 Os07g0658700 [Oryza sativa (japonica cultivar-group)] --------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ag ---- 2e-032     XP_001238147.1 AGAP010199-PA [Anopheles gambiae str. PEST] ---------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dm ---- 2e-037     NP_609609.1 CG5458-PA [Drosophila melanogaster] ==============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Sp ---- 5e-064     XP_001200826.1 PREDICTED: similar to TSGA2 epididymal isoform [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Bt ==== 8e-072     NP_001033194.1 hypothetical protein LOC514556 [Bos taurus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Gg ==== 1e-089     XP_416745.1 PREDICTED: similar to testes specific A2 homolog; meichroacidin; testes specific gene A2 (mouse) homolog [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Dr ==== 4e-091     XP_001343012.2 PREDICTED: im:6909388 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Cf ---- 2e-091     XP_535597.2 PREDICTED: similar to testis-specific gene A2 [Canis familiaris] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 4e-099     NP_543136.1 testis-specific gene A2 [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Mm ==== 3e-101     NP_079566.1 testis specific gene A2 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Xl ==== 0          NP_001088789.1 hypothetical protein LOC496054 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7203015.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGA---------------------TGA------------------------------------------------TGA------TGA------------------------------------TGA---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------TGA------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2       bld Te1  5g                         IMAGE:6930080.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGATGGAAACGGGACGCTCGCACTGGAAACAGTGAAAAGTCAGCGTTACCGAGTTCTGAGTCTCAGTCTCTCCGCTCTCCGCGCCTGATCTTCCCTCCACCGACCCCTGAGCCCTCTGACCCCTCAGACTTACCACTCGTGTCTCTGTCAGACCCTGAATCCGGAACATGTCCGAACTGGGATCCGAGGAATTCGAGGAGGAAGCGGAACCCGATCTTGGGGAGTACGAGGGGGAGCGCAATGAGGCGGGCGAGAGGAACGGGCACGGGAGGGCAAGACTGCCCAATGGAGATACTTACGAGGGACAGTATGAGGGGGGGAAGAGACACGGGCAGGGAACATATCGATTTAAGAACGGGGCCCGATACATCGGAGATTATCATCAGAACAAAAAGCACGGGATGGGCACGTTTATGTACCCCGATGGCTCGAAATATGAAGGTGACTGGGTAGATGATCAGCGACAGGGTCAGGGAGTTTACTATTATCCCAATGGAGACACCTACAGTGGGGACTGGCTGTCTCACCAGAGACACGGACAGGGAGTTTACACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAGGGATCCGGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAAATTTTGTTGGGCAACACGCTCCTCGGGCCCCGGGCAAAATACATATTTTGACA
  5   1   2       bld Te2  5g3  in                    IMAGE:7207901.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGACGCTCGCACTGGAAACAGTGAAAAGTCAGCGGTACCGAGTTCTGAGTCTCAGTCTCTCCGCTCTCCGCGCCTGATCTTCCCTCCACCGACCCCTGAGCCCTCTGACCCCTCAGACTTACCACTCGTGTCTCTGTCAGACCCTGAATCCGGAACATGTCCGAACTGGGATCCGAGGAATTCGAGGAGGAAGCGGAACCCGATCTTGGGGAGTACGAGGGGGAGCGCAATGAGGCGGGCGAGAGGAACGGGCACGGGAGGGCAAGACTGCCCAATGGAGATACTTACGAGGGACAGTATGAGGGGGGGAAGAGACACGGGCAGGGAACATATCGATTTAAGAACGGGGCCCGATACATCGGAGATTATCATCAGAACAAAAAGCACGGGATGGGCACGTTTATGTACCCCGATGGCTCGAAATATGAAGGTGACTGGGTAGATGATCAGCGACAGGGTCAGGGAGTTTACTATTATCCCAATGGAGACACCTACAGTGGGGACTGGCTGTCTCACCAGAGACACGGACAGGGAGTTTACACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAGGGATCCGGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAATTTGTTGGCAACACGCTCCTCGGCCCCGGCAAATACATATTTGACATTGGATGTGAGCAGCACGGGACCTATGAACAGACAGAGCAGGAGAAAGATGAAGATGAAGAAGAGGAGCCCCTGGCAGTGCCAGTAACTAAGTGGAACCCTGGACATATCACTGGCCTGACCCACTTGTCACCNACTGCTGAGGccccccccccGGTCGGCCCCCCGGGGGGTTGGGAAATCCCACAGTAAAGGCTTAAAGCCAGCAAAGTC
  5   1   2       bld Te2  5g3  in                    IMAGE:7390251.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCAGCGGTACCGAGTTCTGAGTCTCAGTCTCTCCGCTCTCCGCGCCTGATCTTCCCTCCACCGACCCCTGAGCCCTCTGACCCCTCAGACTTACCACTCGTGTCTCTGTCAGACCCTGAATCCGGAACATGTCCGAACTGGGATCCGAGGAATTCGAGGAGGAAGCGGAACCCGATCTTGGGGAGTACGAGGGGGAGCGCAATGAGGCGGGCGAGAGGAACGGGCACGGGAGGGCAAGACTGCCCAATGGAGATACTTACGAGGGACAGTATGAGGGGGGGAAGAGACACGGGCAGGGAACATATCGATTTAAGAACGGGGCCCGATACATCGGAGATTATCATCAGAACAAAAAGCACGGGATGGGCACGTTTATGTACCCCGATGGCTCGAAATATGAAGGTGACTGGGTAGATGATCAGCGACAGGGTCAGGGAGTTTACTATTATCCCAATGGAGACACCTACAGTGGGGACTGGCTGTCTCACCAGAGACACGGACAGGGAGTTTACACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAGGGATCCGGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAATTTGTTGGCAACACGCTCCTCGGCCCCGGCAAATACATATTTGACATTGGATGTGAGCAGCACGGGACCTATGAACAGACAGAGCAGGAGAAAGATGAAGATGAAGAAGAGGAGCCCCTGGCAGTGCCAGTAACTAGTGGACCCTGACATT
  5   1   2       bld Te2  5g3  in                    IMAGE:7390211.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCAGCGGTACCGAGTTCTGAGTCTCAGTCTCTCCGCTCTCCGCGCCTGATCTTCCCTCCACCGACCCCTGAGCCCTCTGACCCCTCAGACTTACCACTCGTGTCTCTGTCAGACCCTGAATCCGGAACATGTCCGAACTGGGATCCGAGGAATTCGAGGAGGAAGCGGAACCCGATCTTGGGGAGTACGAGGGGGAGCGCAATGAGGCGGGCGAGAGGAACGGGCACGGGAGGGCAAGACTGCCCAATGGAGATACTTACGAGGGACAGTATGAGGGGGGGAAGAGACACGGGCAGGGAACATATCGATTTAAGAACGGGGCCCGATACATCGGAGATTATCATCAGAACAAAAAGCACGGGATGGGCACGTTTATGTACCCCGATGGCTCGAAATATGAAGGTGACTGGGTAGATGATCAGCGACAGGGTCAGGGAGTTTACTATTATCCCAATGGAGACACCTACAGTGGGGACTGGCTGTCTCACCAGAGACACGGACAGGGAGTTTACACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAAGGATCCGGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAATTTGTTGGCAACACGCTCCTCGGCCCCGGCAAATACATATTTGACATTGGATGTGAGCAGCACGGGACCTATGAACAGACAGAGCAGGAGAAAGAT
  5   1   2       bld Te2N 5g                         IMAGE:7768738.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGTACCGAGTTCTGAGTCTCAGTCTCTCCGCTCTCCGCGCCTGATCTTCCCTCCACCGACCCCTGAGCCCTCTGACCCCTCAGACTTACCACTCGTGTCTCTGTCAGACCCTGAATCCGGAACATGTCCGAACTGGGATCCGAGGAATTCGAGGAGGAAGCGGAACCCGATCTTGGGGAGTACGAGGGGGAGCGCAATGAGGCGGGCGAGAGGAATGGGCACGGGAGGGCAAGACTGCCCAATGGAGATACTTACGAGGGACAGTATGAGGGGGGGAAGAGACACGGGCAGGGAACATATCGATTTAAGAACGGGGCCCGATACATCGGAGATTATCATCAGAACAAAAAGCACGGGATGGGCACGTTTATGTACCCCGATGGCTCTAAATATGAAGGTGACTGGGTAGATGATCAGCGACAGGGTCAGGGAGTTTACTATTATCCCAATGGAGACACCTACAGTGGGGACTGGCTGTCTCACCAGAGACACGGACAGGGAGTTTACACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAGGGATCCGGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAATTTGTTGGCAACACGCTCCTCGGCCCCGGCAATACATATTTGACATTGGATGTGAGCAGCACGGGACTATGACAGACAGAGCAGAGAAGATGAGATGAGAAGAGGAGCCTGGCATGCAGTACTAGTGGACCTGACATTCCTGGCTGACACTGTCCACTGTGAGCACACCTGCCCATGTGAATCAGGAGTGACACAGTTAGATACACGAGGCTCGTCGA
  5   1   2       bld Em10 5g3  in                    IMAGE:7980462.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGTACCGAGTTCTGAGTCTCAGTCTCTCCGCTCTCCGCGCCTGATCTTCCCTCCACCGACCCCTGAGCCCTCTGACCCCTCAGACTTACCACTCGTGTCTCTGTCAGACCCTGAATCCGGAACATGTCCGAACTGGGATCCGAGGAATTCGAGGAGGAAGCGGAACCCGATCTTGGGGAGTACGAGGGGGAGCGCAATGAGGCGGGCGAGAGGAACGGGCACGGGAGGGCAAGACTGCCCAATGGAGATACTTACGAGGGACAGTATGAGGGGGGGAAGAGACACGGGCAGGGAACATATCGATTTAAGAACGGGGCCCGATACATCGGAGATTATCATCAGAACAAAAAGCACGGGATGGGCACGTTTATGTACCCCGATGGCTCGAAATATGAAGGTGACTGGGTAGATGATCAGCGACAGGGTCAGGGAGTTTACTATTATCCCAATGGAGACACCTACAGTGGGGACTGGCTGTCTCACCAGAGACACGGACAGGGAGTTTACACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAGGGATCCGGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAATTTGTTGGCAACACGCTCCTCGGCCCCGGCAAATACATATTTGACATTGGATGTGAGCAGCACGGGACCTATGAACAGACAGAGCAGAGAAAGATGAAGATGAAGAAGAGGAGCCCCTGGCAGTGCCAGTAACTAAGTGGGAA
  5   1   2      seed Te2N 5g3  in                    IMAGE:7203015.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCCGAGTTCTGAGTCTCAGTCTCTCCGCTCTCCGCGCCTGATCTTCCCTCCACCGACCCCTGAGCCCTCTGACCCCTCAGACTTACCACTCGTGTCTCTGTCAGACCCTGAATCCGGAACATGTCCGAACTGGGATCCGAGGAATTCGAGGAGGAAGCGGAACCCGATCTTGGGGAGTACGAGGGGGAGCGCAATGAGGCGGGCGAGAGGAACGGGCACGGGAGGGCAAGACTGCCCAATGGAGATACTTACGAGGGACAGTATGAGGGGGGGAAGAGACACGGGCAGGGAACATATCGATTTAAGAACGGGGCCCGATACATCGGAGATTATCATCAGAACAAAAAGCACGGGATGGGCACGTTTATGTACCCCGATGGCTCGAAATATGAAGGTGACTGGGTAGATGATCAGCGACAGGGTCAGGGAGTTTACTATTATCCCAATGGAGACACCTACAGTGGGGACTGGCTGTCTCACCAGAGACACGGACAGGGAGTTTACACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAGGGATCCGGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAATTTGTTGGCAACACGCTCCTCGGCCCCGGCAAATACATATTTGACATTGGATGTGAGCAGCACGGGACCTATGAACAGACAGAGCAGGAGAAAGATGAAGATGAAGAAGAGGAGCCCCTGGCAGTGCCAGTAACTAAGTGGAACCCTGANCATATCACTGGCCTGACCCACTTGTCACCNACTGC
  5   1   2       bld Tbd7 5g3  in                         XL106i10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGAGTTCTGAGTCTAGTCTCTCCGCTCTCCGCGCCTGATCTTCCCTCCACCGACCCCTGAGCCCTCTGACCCCTCAGACTTACCACTCGTGTCTCTGTCAGACCCTGAATCCGGAACATGTCCGAACTGGGATCCGAGGAATTCGAGGAGGAAGCGGAACCCGATCTTGGGGAGTACGAGGGGGAGCGCAATGAGGCGGGCGAGAGGAACGGGCACGGGAGGGCAAGACTGCCCAATGGAGATACTTACGAGGGACAGTATGAGGGGGGGAAGAGACACGGGCAGGGAACATATCGATTTAAGAACGGGGCCCGATACATCGGAGATTATCATCAGAACAAAAAGCACGGGATGGGCACGTTTATGTACCCCGATGGCTCGAAATATGAAGGTGACTGGGTAGATGATCAGCGACAGGGTCAGGGAGTTTACTATTATCCCAATGGAGACACCTACAGTGGGGACTGGCTGTCTCACCAGAGACACGGACAGGGAGTTTACACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAGGGATCCGGGGAACTCGTTCATCTCAATCATCGTTA
  5   1   2       bld Te2  5g                         IMAGE:7211137.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGTTCTGAGTCTCAGTCTCTCCGCTCTCCGCGCCTGATCTTCCCTCCACCGACCCCTGAGCCCTCTGACCCCTCAGACTTACCACTCGTGTCTCTGTCAGACCCTGAATCCGGAACATGTCCGAACTGGGATCCGAGGAATTCGAGGAGGAAGCGGAACCCGATCTTGGGGAGTACGAGGGGGAGCGCAATGAGGCGGGCGAGAGGAATGGGCACGGGAGGGCAAGACTGCCCAATGGAGATACTTACGAGGGACAGTATGAGGGGGGGAAGAGACACGGGCAGGGAACATATCGATTTAAGAACGGGGCCCGATACATCGGAGATTATCATCAGAACAAAAAGCACGGGATGGGCACGTTTATGTACCCCGATGGCTCTAAATATGAAGGTGACTGGGTAGATGATCAGCGACAGGGTCAGGGAGTTTACTATTATCCCAATGGAGACACCTACAGTGGGGACTGGCTGTCTCACCAGAGACACGGACAGGGAGTTTACACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAGGGATCCGGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAATTTGTTGGCAACACGCTCCTCGGCCCCGGCAAATACATATTTGACATTGGATGTGAGCAGCACGGGACCTATGAACAGACAGAGCAGGAGAAAGATGAAGATGAAGAAGAGGAGCCCCTGGCAGTGCCAGTAACTAAGTGGAACCCTGACATATCACTGGCCTGACCCCTTGTCACCCACTGCTGAGGCACACCCCCTTGCCCCCGTGGTTGGGGAATCCCGTGGAGGGCGAAGCCAGCAAGGTCCTAAGGAATTTCCCCCCCGGAAggggggggCCTCTTGTTT
  5   1   2       bld Te2N      in                    IMAGE:7765054.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGTTCTGAGTCTCAGTCTCTCCGCTCTCCGCGCCTGATCTTCCCTCCACCGACCCCTGAGCCCTCTGACCCCTCAGACTTACCACTCGTGTCTCTGTCAGACCCTGAATCCGGAACATGTCCGAACTGGGATCCGAGGAATTCGAGGAGGAAGCGGAACCCGATCTTGGGGAGTACGAGGGGGAGCGCAATGAGGCGGGCGAGAGGAACGGGCACGGGAGGGCAAGACTGCCCAATGGAGATACTTACGAGGGACAGTATGAGGGGGGGAAGAGACACGGGCAGGGAACATATCGATTTAAGAACGGGGCCCGATACATCGGAGATTATCATCAGAACAAAAAGCACGGGATGGGCACGTTTATGTACCCCGATGGCTCGAAATATGAAGGTGACTGGGTAGATGATCAGCGACAGGGTCAGGGAGTTTACTATTATCCCAATGGAGACACCTACAGTGGGGACTGGCTGTCTCACCAGAGACACGGACAGGGAGTTTACACACATGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAGGGATCCGGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAATTTGTTGGCAACACGCTCCTCGGCCCCGGCAAATACATATTTGACATTGGATGTGAGCAGCACGGGACCTATNGACAGACAGAGCAGGAGAAAGATGAAGATGAAGAAAGAGAGCCCCTGGCAGTGCCAGTAACTAAGTGGGACCCNTGACATATCACTGGGCTGAC
  5   1   2       bld Neu7 5g3  in                         XL027d04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTCCGCTCTCCGCGCCTGATCTTCCCTCCACCGACCCCTGAGCCCTCTGACCCCTCAGACTTACCACTCGTGTCTCTGTCAGACCCTGAATCCGGAACATGTCCGAACTGGGATCCGAGGAATTCGAGGAGGAAGCGGAACCCGATCTTGGGGAGTACGAGGGGGAGCGCAATGAGGCGGGCGAGAGGAACGGGCACGGGAGGGCAAGACTGCCCAATGGAGATACTTACGAGGGACAGTATGAGGGGGGGAAGAGACACGGGCAGGGAACATATCGATTTAAGAACGGGGCCCGATACATCGGAGATTATCATCAGAACAAAAAGCACGGGATGGGCACGTTTATGTACCCCGATGGCTCGAAATATGAAGGTGACTGGGTAGATGATCAGCGACAGGGTCAGGGAGTTTACTATTATCCCAATGGAGACACCTACAGTGGGGACTGGCTGTCTCACCAGAGACACGGACAGGGAGTTTACACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAGGGATCCGGGGAACTCGTTCATCTCAAT
  5   1   2       bld Ga18 5g3  in                      xlk115b22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGACCCCTCAGACTTACCACTCGTGTCTCTGTCAGACCCTGAATCCGGAACATGTCCGAACTGGGATCCGAGGAATTCGAGGAGGAAGCGGAACCCGATCTTGGGGAGTACGAGGGGGAGCGCAATGAGGCGGGCGAGAGGAACGGGCACGGGAGGNNAGACTGCCCAATGGAGATACTTACGAGGGACAGTATGAGGGGGGGAAGAGACACGGGCAGGGAACATATCGATTTAAGAACGGGGCCCGATACATCGGAGATTATCATCAGAACAAAAAGCACGGGATGGGCACGTTTATGTACCCCGATGGCTCGAAATATGAAGGTGACTGGGTAGATGATCAGCGACAGGGTCAGGGAGTTTACTATTATCCCAATGGAGACACCTACAGTGGGGACTGGCTGTCTCACCAGAGACACGGACAGGGAGTTTACACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAAGGATCCGGGGAANTCGTTCATCTCAATCATCGTTACCNAGGAAAANTTGTTGGCAACACGCTCCTCGGCCCCGGNAAATACATATTTGACATTGGATGTGAGCAGCACGGGACC
  3   1   2       bld Te2  5g3  in                    IMAGE:7390211.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGCAGTCCAGGAATCAGCATTAGGGGAGACCGCAGACTTGATAGACGGCCATCTCGGATTCTCGACAAAGCCGATGGCAGTATGTACCGAGCTCGAATTGAGTGACTGGTAGAGTCAGCACAGGTCAGGAGTTACTATATCCCATGGAGACACTACAGTGGGACTGCTGTCTCACCAGAGACACGGACAGGAGTTTACACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAAGGATCCGGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAATTTGTTGGCAACACGCTCCTCGGCCCCGGCAAATACATATTTGACATTGGATGTGAGCAGCACGGGACCTATGAACAGACAGAGCAGGAGAAAGATGAAGATGAAGAAGAGGAGCCCCTGGCAGTGCCAGTAACTAAGTGGAACCCTGACAATATCACTGGCCTGACCCACTTGTCACCAACTGCTGAGGCCACACCCCCTGCCCCAGTGGTTGGAGATCCCAGTGAGGCTGAAGCAGCAAGTTCCGAGGATTTACCCACAGAAGGTGGCGCTCTGCTCACAGACCAGGAGGCGGAGCTTCCATTACCGTTAGTGAGTGAAACTGAGGCAGTGGGCGTGGCCTCGGAGTCCCTAGAAGAAAAAGCTGAAGTCACCTCTAGGATCTCTGAAAGTGAGGAGACATTTGCTGAAGAATGACTCTCATCCAAGGACCTGAAAACGACACAAGGACTGAGTGTCAGGTACTGAGATTTCTATCGTTGCCCTGTCTTATCCTCATAGAGACTGTTCCAGCCCGTCAGACCTTCCTGCACATCAGTTCCAGCCTCTCCATCATCACTGGGCTCAGTTCTGCAAGTCATAATAAGACCCTGC
  3   1   2       bld Te2  5g3  in                    IMAGE:7207901.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGATTTTCTTCAGAACAAAAAGCACGGGGATGGGCACGTTTATGTACCCCCGATGCTTCGAAATATGAANGTGACTGGGTAGATGATCAGCGACAGGGTCAGGGAGTTTACTATTATCCCAATGGAGACACCTACAGTGGGGACTGGCTGTCTCACCAGAGACACGGACAGGGAGTTTACACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAGGGATCCGGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAATTTGTTGGCAACACGCTCCTCGGCCCCGGCAAATACATATTTGACATTGGATGTGAGCAGCACGGGACCTATGAACAGACAGAGCAGGAGAAAGATGAAGATGAAGAAGAGGAGCCCCTGGCAGTGCCAGTAACTAAGTGGAACCCTGACAATATCACTGGCCTGACCCACTTGTCACCAACTGCTGAGGCCACACCCCCTGCCCCAGTGGTTGGAGATCCCAGTGAGGCTGAAGCAGCAAGTTCCGAGGATTTACCCACAGAAGGTGGCGCTCTGCTCACAGACCAGGAGGCGGAGCTTCCATTACCGTTAGTGAGTGAAACTGAGGCAGTGGGCGTGGCCTCGGAATCCCTAGAAGAAAAAGCTGAAGTCACCTCTAGGATCTCTGAAAGTGAGGAGACATTTGCTGAAGAATGACTCTCATCCAAGGACCTGAAAACGACACAAGGACTGAGTGTCAGGTACTGAGATTTCTATCGTTGCCCTGTCTTATCCTCATAGAGACTGTTCCAGCCCGTCAGACCTTCCTGCACATCAGTTCCAGCCTCTCCATCATCACTGGGCTCAGTTCTTGCAAGTTCATTAATAAAGGACCACC
  3   1   2       bld Ga18 5g3  in                      xlk115b22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAANNNCGGNANGGGNNCGTTNNNNNACCCNATNNCTCGAAANATNAAGNTGACNGGGTAGNNGATCAGCGANAGGGTCNNNAGTTTACTNTNTCCCAATGGAGACNCCTACAGTGGGGACTGGCTGTCTCNCCAGAGACACGGACAGGGANNTNANACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAAGGATCCGGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAATTTGTTGGCAACACNCTCCTCGNNNNCGGCAAATACATATTTGACATTGGATGTGAGCAGCACGGGACCTATGAACAGACAGAGCAGGAGAAAGATGAAGATGAAGAAGAGGANNNNNNNCAGTGCCAGTAACTAAGTGGAACCCTGACAATATCACTGGCCTGACCCACTTGTCACCAACTGCTGAGGCCACACCCCCTGCCCCAGTGGTTGGAGATCCCAGTGNNNNNNAGCAGCAAGTTCCGAGGATTTACCCACAGAAGGTNNNNNTGCTCACAGACCAGGAGGCGGAGCTTCCATTACCGTTAGTGAGTGAAACTGAGGCAGTGGGCGTGGCCTCGGAATCCCTAGAAGAAAAAGCTGAAGTCACCTCTAGGATCTCTGAAAGTGAGGAGACATTTGCTGAAGAATGACTCTCATCCAAGGACCTGAAAACGACACAAGGACTGAGTGTCAGGTACTGAGATTTCTATCGTTGCCCTGTCTTTTCCTCATAGAGACTGTTCCAGCCCGTCAGNCCTTCCTGCACATCAGTTCNACCTCTCCATCATCACTGGGCTCAGNTCTTGCAANNCATAA
  3   1   2       bld Te2N 5g3  in                    IMAGE:7203015.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTAGATGATCAGCGACAGGTCAGGNAGTTACTATATCCCAATGGAGACACCTACAGTGGGGACTGGCTGTCTCACCAGAGACACGGACAGGGAGTTTACACACACGCTGAGACCGGATCCAAGTACATTGGCACCTGGGTGAATGGAAAACAAGAGGGATCCGGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAATTTGTTGGCAACACGCTCCTCGGCCCCGGCAAATACATATTTGACATTGGATGTGAGCAGCACGGGACCTATGAACAGACAGAGCAGGAGAAAGATGAAGATGAAGAAGAGGAGCCCCTGGCAGTGCCAGTAACTAAGTGGAACCCTGACAATATCACTGGCCTGACCCACTTGTCACCAACTGCTGAGGCCACACCCCCTGCCCCAGTGGTTGGAGATCCCAGTGAGGCTGAAGCAGCAAGTTCCGAGGATTTACCCACAGAAGGTGGCGCTCTGCTCACAGACCAGGAGGCGGAGCTTCCATTACCGTTAGTGAGTGAAACGGAGGCAGTGGGCGTGGCCTCGGAATCCCTAGAAGAAAAAGCTGAAGTCACCTCTAGGATCTCTGAAAGTGAGGAGACATTTGCTGAAGAATGACTCTCATCCAAGGACCTGAAAACGACACAAGGACTGAGTGTCAGGTACTGAGATTTCTATCGTTGCCCTGTCTTTTCCTCATAGAGACTGTTCCAGCCCGTCAGACCTTCCTGCACATCAGTTCCAGCCTCTCCATCATCACTGGGCTCAGTTCTGCAAGTTCATAAAAAGGCACTGTTTTG
  3   1   2       bld Em10 5g3  in                    IMAGE:7980462.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTATATCAACACTGCGTCTAGGGTATTCATATATCCGCAAGGGGACACACATTGTGGAAACTGCTTTTCCCAGAAACGGGACGAGAGTTAACCACAGGGTGAACCAGATCCAAGTACTTTGGCACCTGGTGGATGGAAACATAGAGAGATCCGGGGAAATTGGTTCATCCCACTTCATGGTTACCCAGGGAAAATTGTTGGCAACACGTTCTTGGGCCCCGGCAAAATACTATTTGACCATGGGATGTGGGCAGCACCGGGACCTTTGAACAGACAGAGCCAGGGGGAAAGATGAAGATGAAGAAGAGGAGCCCCCTGGCAGTGCCCAGTAACTAAGTGGAACCCTGACAATTATCACTGGCCTGACCCACTTGTCACCAACTGCTGAGGCCACACCCCCTGCCCCAGTGGTTGGAGATCCCAGTGAGGCTGAAGCAGCAAGTTCCGAGGATTTACCCACAGAAGGTGGCGCTCTGCTCACAGACCAGGAGGCGGAGCTTCCATTACCGTTAGTGAGTGAAACTGAGGCAGTGGGCGTGGCCTCGGAATCCCTAGAAGAAAAAGCTGAAGTCACCTCTAGGATCTCTGAAAGTGAGGAGACATTTGCTGAAGAATGACTCTCATCCAAGGACCTGAAAACGACACAAGGACTGAGTGTCAGGTACTGAGATTTCTATCGTTGCCCTGTCTTTTCCTCATAGAGACTGTTCCAGACAGTCAGACCTTCCTGCACATCAGTTCCAGCCTCTCCATCATCACTGGGCTCAGTCTGCAAGTCATAATAAAGAA
  3   1   2       chi Te2N      in                    IMAGE:7765054.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATACCGAGCTGATAGAGTGCTGTGAGTCAGGCAGTCGGAGTTCTTATCCATGAGCACTACATGGGACTGCGTCTCACAGGACACGACAGGAGTTACACACAGCGAGACGGATCCAGTACATGGCACCTGGTGATGAAACAAAGAGGATCCGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAATTTGTTGGCAACACGCTCCTCGGCCCCGGCAAATACATATTTGACATTGGATGTGAGCAGCACGGGACCTATGAACAGACAGAGCAGGAGAAAGATGAAGATGAAGAAGAGGAGCCCCTGGCAGTGCCAGTAACTAAGTGGAACCCTGACAATATCACTGGCCTGACCCACTTGTCACCAACTGCTGAGGCCACACCCCCTGCCCCAGTGGTTGGAGATCCCAGTGAGGCTGAAGCAGCAAGTTCCGAGGATTTACCCACAGAAGGTGGCGCTCTGCTCACAGACCAGGAGGCGGAGCTTCCATTACCGTTAGTGAGTGAAACGGAGGCAGTGGGCGTGGCCTCGGAATCCCTAGAAGAAAAAGCTGAAGTCACCTCTAGGATCTCTGAAAGTGAGGAGACATTTGCTGAAGAATGACTCTCATCCAAGGACCTGAAAACGACACAAGGACTGAGTGTCAGGTACTGAGATTTCTATCGTTGCCCTGTCTTATCCTCATAGAGACTGTTCCAGCCCGTCAGACCTTCCTGCACATCAGTTCCAGCCTCTCCATCATCACTGGGCTCAGTTCTTGCAAGTTCATTAATAAAGGACACTTTGGTTTTGTAAAAAAAAAAAAAAAGCTTAATTACCTCGAGGAGTGTCCCATATGGCATGCTA
  3   1   2       bld Te2  5g3  in                    IMAGE:7390251.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATATAAATGTTTGGGCATCCCCACAGGGAGACTGCTTTCCTCTTGTCCATTGTCGGGGAATTACACCACGGCTGAGACGTGACCAGATTCCATTGTCACTGGGGTGAATGGAATCCAGAGGAATCCGGGGAAATCGTTCATCTCAATCTTAGTTCCAAGGAAAATTTGTGGAGACACGCTCCTCGGCCCCGGCAAATTCATATTTTACATTGGATGTGCGCAGCACGGGACTTATGAACTGACAGAGCAGGAGAAAGATGAAGATGAAGAAGAGGAGCCCCTGGCAGTGCCAGTAACTAAGTGGAACCCTGACAATATCACTGGCCTGACCCACTTGTCACCAACTGCTGAGGCCACACCCCCTGCCCCAGTGGTTGGAGATCCCAGTGAGGCTGAAGCAGCAAGTTCCGAGGATTTACCCACAGAAGGTGGCGCTCTGCTCACAGACCAGGAGGCGGAGCTTCCATTACCGTTAGTGAGTGAAACTGAGGCAGTGGGCGTGGCCTCGGAATCCCTAGAAGAAAAAGCTGAAGTCACCTCTAGGATCTCTGAAAGTGAGGAGACATTTGCTGAAGAATGACTCTCATCCAAGGACCTGAAAACGACACAAGGACTGAGTGTCAGGTACTGAGATTTCTATCGTTGCCCTGTCTTATCCTCATAGAGACTGTTCCAGCCCGTCAGACCTTCCTGCACATCAGTTCCAGCCTCTCCATCATCACTGGGCTCAGTTCTGCAAGTCA
  3   1   2       bld Neu7 5g3  in                         XL027d04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGATCCGGGGAACTCGTTCATCTCAATCATCGTTACCAAGGAAAATTTGTTGGCAACACGCTCCTCGGCCCCGGCAAATACATATTTGACATTGGATGTGAGCAGCACGGGACCTATGAACAGACAGAGCAGGAGAAAGATGAAGATGAAGAAGAGGAGCCCCTGGCAGTGCCAGTAACTAAGTGGAACCCTGACAATATCACTGGCCTGACCCACTTGTCACCAACTGCTGAGGCCACACCCCCTGCCCCAGTGGTTGGAGATCCCAGTGAGGCTGAAGCAGCAAGTTCCGAGGATTTACCCACAGAAGGTGGCGCTCTGCTCACAGACCAGGAGGCGGAGCTTCCATTACCGTTAGTGAGTGAAACTGAGGCAGTGGGCGTGGCCTCGGAATCCCTAGAAGAAAAAGCTGAAGTCACCTCTAGGATCTCTGAAAGTGAGGAGACATTTGCTGAAGAATGACTCTCATCCAAGGACCTGAAAACGACACAAGGACTGAGTGTCAGGTACTGAGATTTCTATCGTTGCCCTGTCTTTTCCTCATAGAGACTGTTCCAGACAGTCAGACCTTCCTGCACATCAGTTCCAGCCTCTCCATCATCACTGGGCTCAGTTCTTGCAAGTTCATTAATAAAGAA
  3   1   2       bld Tbd7 5g3  in                         XL106i10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGACAGAGCAGGAGAAAGATGAAGATGAAGAAGAGGAGCCCCTGGCAGTGCCAGTAACTAAGTGGAACCCTGACAATATCACTGGCCTGACCCACTTGTCACCAACTGCTGAGGCCACACCCCCTGCCCCAGTGGTTGGAGATCCCAGTGAGGCTGAAGCAGCAAGTTCCGAGGATTTACCCACAGAAGGTGGCGCTCTGCTCACAGACCAGGAGGCGGAGCTTCCATTACCGTTAGTGAGTGAAACGGAGGCAGTGGGCGTGGCCTCGGAATCCCTAGAAGAAAAAGCTGAAGTCACCTCTAGGATCTCTGAAAGTGAGGAGACATTTGCTGAAGAATGACTCTCATCCAAGGACCTGAAAACGACACAAGGACTGAGTGTCAGGTACTGAGATTTCTATCGTTGCCCTGTCTTTTCCTCATAGAGACTGTTCCAGCCCGTCAGACCTTCCTGCACATCAGTTCCAGCCTCTCCATCATCACTGGGCTCAGTTCTTGCAAGTTCATTAATAAAGAACAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)