Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7766821.5                      63 END     1           5        1                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:3302026-IMAGp.5                50 PI      90          9     1287                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6636340.5                      48 PI      80        233      629                (no blast hit)
     4   0.0    0Xl3.1-xl328k08.5                           38 PI      81        236      629                hairy2b [Xenopus laevis]

 This cluster: approximate FL confidence score = 92%

 1012771481 Xl3.1-XL510d18ex.3 - 19 ESTs
                                                                       ...-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL510d18ex.3                        CAGGACGTTTGCTGCGGGACTTTGCCTCACTCTCTCTTCTAGTGGACACTGGTTTCATTCTTTTATTGGATTGCCAATTGCTTTCTTGCTCACATCCTATATAAACCTGGACTTTTAATCCATTTGTGTTCAGTGTGTTGTTCAGTTGGTGTGAGATCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCCTCATCCCCAGTGGCTGCCACTCCGGCCAGTGTGAGCAATACCCCGGATAAGCCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCCGGATCAACGAGAGCCTCGGGCAACTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTAGAGAAGGCTGATATACTAGAGATGACAGTAAAGCACCTGAGGAACCTGCAGCGGGTACAGATGACTGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTTAGCGAGTGCATGAATGAAGTAACTCGATTCTTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCGTGAATCAGATACATGCCATGAATTACCCTGCCCAGCCTCAGATCCCTTCTGCAGCCGCACCCCATCCTGCCTATGGACAGCCTATGGTCCAGCTCCCAGCAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCTTGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCTTCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCAGAACGGATCTGTCATTCCTTTATACACCAACTCCAATGTGGGCACTGCACTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCTGTTTGGAGGCCCTGGTAAAGGGAAATAACTGTGGGACATCTGGTAGCTGGAAATTAGTTACAAATAGTAACCCCTCATGGGATAGTGAGAATGCGGATGCACTATATTTGTATATAGGAAATGTTCATATTGAATTATATCCTTGTATTATAAGATTATTCAGATTTCGTTTTGTAAATGGAATTATGCTATTATTATGCCAAAGACATGGAATGCTCTTATATTGTTCTTCCTATTTTCTGGAAGTTTTACTTGTATGTAATAAAAACGCACATTGTATTTTCTCTAATTCCTAAACACAGAATTAGTAATTTGTATATTTTGCCCTTTTTCTATTTGACTGCAATCTTGCTAACTAAACCTGCCATGTAAATGCAGGGGTTATCACATTCAAAGGAACAATTCTTTACATAGCCCAGAGGTTTTGGCCATCTTGGATCCAAGCTCCTCTTTATACTTCAACCCATCCCCTGTTATAATAGGGCTTACAGCTCTATTCAAAT
                                                  Xl3.1-CHK-1012690132                              GTTTGCTGCGGGACTTTGCCTCACTCTCTCTTCTAGTGGACACTGGTTTCATTCTTTTATTGGATTGCCAATTGCTTTCTTGCTCACATCCTATATAAACCTGGACTTTTAATCCATTTGTGTTCAGTGTGTTGTTCAGTTGGTGTGAGATCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCCTCATCCCCAGTGGCTGCCACTCCGGCCAGTGTGAGCAATACCCCGGATAAGCCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCCGGATCAACGAGAGCCTCGGGCAACTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTAGAGAAGGCTGATATACTAGAGATGACAGTAAAGCACCTGAGGAACCTGCAGCGGGTACAGATGACTGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTTAGCGAGTGCATGAATGAAGTAACTCGATTCTTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCGTGAATCAGATACATGCCATGAATTACCCTGCCCAGCCTCAGATCCCTTCTGCAGCCGCACCCCATCCTGCCTATGGACAGCCTATGGTCCAGCTCCCAGCAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCTTGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCTTCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCAGAACGGATCTGTCATTCCTTTATACACCAACTCCAATGTGGGCACTGCACTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCTGTTTGGAGGCCCTGGTAAAGGGAAATAACTGTGGGACATCTGGTAGCTGGAAATTAGTTACAAATAGTAACCCCTCATGGGATAGTGAGAATGCGGATGCACTATATTTGTATATAGGAAATGTTCATATTGAATTATATCCTTGTATTATAAGATTATTCAGATTTCGTTTTGTAAATGGAATTATGCTATTATTATGCCAAAGACATGGAATGCTCTTATATTGTTCTTCCTATTTTCTGGAAGTTTTACTTGTATGTAATAAAAACGCACATTGTATTTTCTCTAATTCCTAAACACAGAATTAGTAATTTGTATATTTTGCCCTTTTTCTATTTGACTGCAATCTTGCTAACTAAACCTGCCATGTAAATGCAGGGGTTATCACATTCAAAGGAACAATTCTTTACATAGCCCAGAGGTTTTGGCCATCTTGGATCCAAGCTCCTCTTTATACTTCAACCCATCCCCTGTTATAATAGGGCTTACAGCTCTATTCAAATAATCAC
                                                      consensus depths                             2     2     5     5     6     7     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     8     8     9     8     9     8     9     8     9     8     9     9    11     9    11     9    11    10    12    10    12    12    13    12    13    12    13    11    13    11    13    11    13    11    12    11    12    10    11     9    11    10    13    10    13    11    13    10    13     9    12     9    12     9    12     9    12    10    13     9    12     9    11     8    11    10    12     7    10     7    10     7    10     7     9     8     9     8     8     7     7     7     7     7     7     7     7     7     7     7     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     5     6     3     5     3     5     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     162     696                        
                                               BLH MIN     156     113                        
                                               BLH OVR     162      43                        
                                               EST CLI       6      17                        
                                               ORF LNG     162       1                        
  5   1   2       bld FaBN 5g3  in                    IMAGE:8075349.5p GCAGAGAGCAGCTCAGTATCAGTCAGGACGTTTGCTGCGGGACTTTGCCTCACTCTCTCTTCTAGTGGACACTGGTTTCATTCTTTTATTGGATTGCCAATTGCTTTCTTGCTCACATCCTATATAAACCTGGACTTTTAATCCATTTGTGTTCAGTGTGTTGTTCAGTTGGTGTGAGATCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCCTCATCCCCAGTGGCTGCCACTCCGGCCAGTGTGAGCAATACCCCGGATAAGCCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCCGGATCAACGAGAGCCTCGGGCAACTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTAGAGAAGGCTGATATACTAGAGATGACAGTAAAGCACCTGAGGAACCTGCAGCGGGTACAGATGACTGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTTAGCGAGTGCATGAATGAAGTAACTCGATTCTTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCGTGAATCAGATACATGCCATGAATTACCCTGCCCAGCCTCAGATCCCTTCTGCAGCCGCACCCCATCCTGCCTATGGACAGCCTATGGTCCAGCTCCCAGCAG
  5   1   2       bld Tad1 5g                         IMAGE:6938694.5p            GGGAGTATCAGTCAGGACGTTTGCTGCGGGACTTTGCCTCACTCTCTCTTCTAGTGGACACTGGTTTCATTCATTTATTGGATTGCCAATTGCTTTCTTGCTCATATCCTATATAAACCTGGACTTTTAATCCATTTGTGTTCAGTGTGTTGTTCAGTTGGTGTGAGATCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCCTCATCCCCAGTGGCTGCCACTCCGGCCAGTGTGAGCAATACCCCAGATAAGCCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGACAAGAGAAGGAGAGCCCGGATCAACGAGAGCCTCTGGCAAGTCAGAAGCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTAGAGAAGGCTGATATACTAGAGATGACAGTAAAGCACCTGAGGAACCTGCAGCGGGTACAGATGACTGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTTAGCGAGTGCATGAATGAAGTAACTCCATTCTTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACGCGACTCCTGTGGCATCTTGACAACTGCGTGAATTCAGATACCTGCCATGGAATTACCCTGCCCCAACCATCAGATCCCCTTCTGCAACCCGCGACCCCCGTTCCTGGCCCTAAAGGAAAAAGCCCTATGGGTTTCCAAT
  5   1   2       bld Int2 5g                         IMAGE:8526774.5p                          GGACGTTTGCTGCGGGACTTTGCCTCACTCTCTCTTCTAGTGGACACTGGTTTCATTCTTTTATTGGATTGCCAATTGCTTTCTTGCTCACATCCTATATAAACCTGGACTTTTAATCCATTTGTGTTCAGTGTGTTGTTCAGTTGGTGTGAGATCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCCTCATCCCCAGTGGCTGCCACTCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCCGGATCAACGAGAGCCTCGGGCAACTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTAGAGAAGGCTGATATACTAGAGATGACAGTAAAGCACCTGAGGAACCTGCAGCGGGTACAGATGACTGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTTAGCGAGTGCATGAATGAAGTAACTCGATTCTTGTCTACCTGTGAAAGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGGCATCTTGCCAACTGCGTGAATCAAATCCTGCCATGATTTACCTGCCCAGCTCTAATCCTTCTGCACCGTACCCATCCTGCTATGAAGCCTATGGTCACTCCATCACACTCCAAAGAACCACTTCCAATGTTGTAAAAGGGGGCCACTGAACTCCAATGTTGGGCTCCCCTGTTACCTTAAGAAAATTTTCATCATACAATTCCTAAGATTTTTATATCATCCTGGGTA
  5   1   2       bld Ga15 5g3  in                       XL482b01ex.5p                               TTTGCTGCGGGACTTTGCctctctctctctTCTAGTGGACACTGGTTTCATTCTTTTATTGGATTGCCAATTGCTTTCTTGCTCACATCCTATATAAACCTGGACTTTTAATCCATTTGTGTTCAGTGTGTTGTTCAGTTGGTGTGAGATCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCCTCATCCCCAGTGGCTGCCACTCCGGCCAGTGTGAGCAATACCCCGGATAAGCCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCCGGATCAACGAGAGCCTCGGGCAACTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTAGAGAAGGCTGATATACTAGAGATGACAGTAAAGCACCTGAGGAACCTGCAGCGGGTACAGATGACTGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTTAGCGAGTGCATGAATGAAGTAACTCGATTCTTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCGTGAATCAGATACATGCCATGAATTACCCTGCCCAGCCTCAGATCCCTTCTGCAGCCGCACCCCATCCTGCCTATGGACAGCCTATGGtccagctcccagcagcagctccacagagcagcccagctcccaTTGCTTGCAAGATGGGTGGT
  5   1   2       bld Ga15 5g3  in                       XL510d18ex.5p                                 TGCTGCGGGACTTTGCCTCACTCTCTCTTCTAGTGGACACTGGTTTCATTCTTTTATTGGATTGCCAATTGCTTTCTTGCTCACATCCTATATAAACCTGGACTTTTAATCCATTTGTGTTCAGTGTGTTGTTCAGTTGGTGTGAGATCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCCTCATCCCCAGTGGCTGCCACTCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCCGGATCAACGAGAGCCTCGGGCAACTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTAGAGAAGGCTGATATACTAGAGATGACAGTAAAGCACCTGAGGAACCTGCAGCGGGTACAGATGACTGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTTAGCGAGTGCATGAATGAAGTAACTCGATTCTTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCGTGAATCAGATACATGCCATGAATTACCCTGCCCAGCCTCAGATCCCTTCTGCAGCCGCACCCCATCCTGCCTATGGACAGCCTATGGtccagctcccagcagcagctccacagagcagcccagctcccaTTGCTTGCAAGATGGGTGGTCC
  5   1   2       bld Neu7 5g3  in                         XL021d19.5p                                        GGACTTTGCCTCACTCTCTCTTCTAGTGGACACTGGTTTCATTCTTTTATTGGATTGCCAATTGCTTTCTTGCTCACATCCTATATAAACCTGGACTTTTAATCCATTTGTGTTCAGTGTGTTGTTCAGTTGGTGTGAGATCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCCTCATCCCCAGTGGCTGCCACTCCGGCCAGTGTGAGCAATACCCCGGATAAGCCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCCGGATCAACGAGAGCCTCGGGCAACTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTAGAGAAGGCTGATATACTAGAGATGACAGTAAAGCACCTGAGGAACCTGCAGCGGGTACAGATGACTGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTTAGAGTGCATGAATGAAGTAACTCGATTCTTGTCTACC
  5   1   2       bld Ga18 5g3  in                      xlk110a02ex.5p                                         GGNNTTTGCctctctctctctTCTAGTGGACACTGGTTTCATTCTTTTATTGGATTGCCAATTGCTTTCTTGCTCACATCCTATATAAACCTGGACTTTTAATCCATTTGTGTTCAGTGTGTTGTTCAGTTGGTGTGAGATCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCCTCATCCCCAGTGGCTGCCACTCCGGCCAGTGTGAGCAATACCCCGGATAAGCCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCCGGATCAACGAGAGCCTCNNNNNCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTAGAGAAGGCTGATATACTAGAGATGACAGTAAAGCACCTGAGGAACCTGCAGCGGGTACAGATGACTGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTTAGCGAGTGCATGAATGAAGTAACTCGATTCTTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGNCAACTGCGTGAATCAGATACATGCCATGAATTACCCTGCCCAGCCTCAGATCCCTTCTGCAGCCGCACCCCATCCTGCCTATGGACAGCCTATGGTCCAGCTCCCAGCAGCAGNTCCACAGAGCAGCCCAGCTCCCATTGCTTGCAAGATGGGTGGTCCNCCAGTAGAAGCTGNCAAANNGTATNGNGGC
  5   1   2       bld Neu7 5g3  in                         XL038p02.5p                                                       CTCTCTTCTAGTGGACACTGGTTTCATTCTTTTATTGGATTGCCAATTGCTTTCTTGCTCACATCCTATATAAACCTGGACTTTTAATCCATTTGTGTTCAGTGTGTTGTTCAGTTGGTGTGAGATCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCCTCATCCCCAGTGGCTGCCACTCCGGCCAGTGTGAGCAATACCCCGGATAAGCCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCCGGATCAACGAGAGCCTCGGGCAACTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTAGAGAAGGCTGATATACTAGAGATGACAGTAAAGCACCTGAGGAACCTGCAGCGGGTACAGATGACTGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTTAGCGAGTGCATGAATGAAGTAACTCGATTCTTGTCTACCTGTGAAGGGGTCAACACAGATGTCCG
  3   1   2       bld Ga18 5g3  in                      xlk110a02ex.3p                                                                                                                                                                                                                                                                                                                                                                                  CCTGGATNNNCNNAAGAAANNNNNNCNCCCGGNNCTCCAAGCTANAGANNGCTGATATNCTAGAGATGACAGTAAAGCACCTGNGNNNNNGCAGNNGGTACAGATGACTGCTGCACTGAGTANAGNCCCTTNAGTACTGGGNAAGTACAGAGCTGGATTTAGCGAGTGCATGAATGAAGTANCTCGATTCTTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCANCTGCGTGAATCAGATACATGCCATGAATTACCCTNNCCAGCCTCAGNTCCCTTCTNNAGCCGCACCCCATCCTGCCTATGGACAGCCTATGNTCCAGCTCCCAGCAGCANCTCCACAGAGCANNCCAGCTCCCATTGCTTGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGNNNNNNCAGCTTGTGCCAGCTTCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCAGAACGGATCTGTCATTCCTTTATACACCAACTCCAATGTGGNCACTGNACTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCTGTTTGGAGGCCCTGGTAAAGGGAAATAACTGTGGGACATCTGGTAGCTGGAAATTAGTTACAAATAGTAACCCCTCATGGGATAGTGAGAATGCGGATGCACTATATTTGTATATAGGAAATGTTCATATTGAATTATATCCTTGTATTATAAGATTATTCAGATTTCGTTTTGTAAATGGAATTATGCTATTATTATGCCAAAGACATGGAATGCTCTTATATTGTTCTTCCTATTTTCTNGAANNTNCTTGTATGTAATAA
  3   1   2      seed Ga15 5g3  in                       XL510d18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                           CTAGAGATGACAGTAAAGCACCNGAGGAACCTGCAGCGGGTACAGATGACTGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTTAGCGAGTGCATGAATGAAGTAACTCGATTCTTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCGTGAATCAGATACATGCCATGAATTACCCTGCCCAGCCTCAGATCCCTTCTGCAGCCGCACCCCATCCTGCCTATGGACAGCCTATGGTCCAGCTCCCAGCAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCTTGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCTTCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCAGAACGGATCTGTCATTCCTTTATACACCAACTCCAATGTGGGCACTGCACTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCTGTTTGGAGGCCCTGGTAAAGGGAAATAACTGTGGGACATCTGGTAGCTGGAAATTAGTTACAAATAGTAACCCCTCATGGGATAGTGAGAATGCGGATGCACTATATTTGTATATAGGAAATGTTCATATTGAATTATATCCTTGTATTATAAGATTATTCAGATTTCGTTTTGTAAATGGAATTATGCTATTATTATGCCAAAGACATGGAATGCTCTTATATTGTTCTTCCTATT
  3   1   2       bld Ga15 5g3  in                       XL482b01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGATGACAGTAAAGCACCTGAGGAACCTGCAGCGGGGTACAGATGACTGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTTAGCGAGTGCATGAATGAAGTAACTCGATTCTTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCGTGAATCAGATACATGCCATGAATTACCCTGCCCAGCCTCAGATCCCTTCTGCAGCCGCACCCCATCCTGCCTATGGACAGCCTATGGTCCAGCTCCCAGCAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCTTGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCTTCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCAGAACGGATCTGTCATTCCTTTATACACCAACTCCAATGTGGGCACTGCACTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCTGTTTGGAGGCCCTGGTAAAGGGAAATAACTGTGGGACATCTGGTAGCTGGAAATTAGTTACAAATAGTAACCCCTCATGGGATAGTGAGAATGCGGATGCACTATATTTGTATATAGGAAATGTTCATATTGAATTATATCCTTGTATTATAAGATTATTCAGATTTCGTTTTGTAAATGGAATTATGCTATTATTATGCCAAAGACATGGAATGCTCTTATATTGTTCTTCCTATTTTCTGGAAGTTTT
  3   1   2       bld DMZ                                 rxl240i07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGCAGCGGGTACAGATGACTGCTGCATGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTTAGCGAGTGCATGAATGAAGTAACTCGATTCTTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCGTGAATCAGATACATGCCATGAATTACCCTGCCCAGCCTCAGATCC
  3   1   2       bld FaBN 5g3  in                    IMAGE:8075349.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTTAGCGAGTGCATGAATGAAGTAACTCGATTCTTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCGTGAATCAGATACATGCCATGAATTACCCTGCCCAGCCTCAGATCCCTTCTGCAGCCGCACCCCATCCTGCCTATGGACAGCCTATGGTCCAGCTCCCAGCAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCTTGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCTTCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCAGAACGGATCTGTCATTCCTTTATACACCAACTCCAATGTGGGCACTGCACTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCTGTTTGGAGGCCCTGGTAAAGGGAAATAACTGTGGGACATCTGGTAGCTGGAAATTAGTTACAAATAGTAACCCCTCATGGGATAGTGAGAATGCGGATGCACTATATTTGTATATAGGAAATGTTCATATTGAATTATATCCTTGTATTATAAGATTATTCAGATTTCGTTTTGTAAATGGAATTATGCTATTATTATGCCAAAGACATGGAATGCTCTTATATTGTCTTCCTATTTTCTGGAAGTTTACTGTAGAAAAAAACTCTAAACGTACATTT
  3   1   2       bld Neu7                                 XL002p21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCATCTTGCCAACTGCGTGAATCAGATACATGCCATGAATTACCCTGCCCAGCCTCAGATCCCTTCTGCAGCCGCACCCCATCCTGCCTATGGACAGCCTATGGTCCAGCTCCCAGCAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCTTGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCTTCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCAGAACGGATCTGTCATTCCTTTATACACCAACTCCAATGTGGGCACTGCACTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCTGTTTGGAGGCCCTGGTAAAGGGAAATAACTGTGGGACATCTGGTAGCTGGAAATTAGTTACAAATAGTAACCCCTCATGGGATAGTGAGAATGCGGATGCACTATATTTGTATATAGGAAATGTTCATATTGAATTATATCCTTGTATTATAAGATTATTCAGATTTCGTTTTGTAAATGGAATTATGCTATTATTATGCCAAAGACATGGAATGCTCTTATATTGTTCTTCCTA
  3   1   2       bld Neu7 5g3  in                         XL038p02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTTGCCAACTGCGTGAATCAGATACATGCCATGAATTACCCTGCCCAGCCTCAGATCCCTTCTGCAGCCGCACCCCATCCTGCCTATGGACAGCCTATGGTCCAGCTCCCAGCAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCTTGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCTTCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCAGAACGGATCTGTCATTCCTTTATACACCAACTCCAATGTGGGCACTGCACTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCTGTTTGGAGGCCCTGGTAAAGGGAAATAACTGTGGGACATCTGGTAGCTGGAAATTAGTTACAAATAGTAACCCCTCATGGGATAGTGAGAATGCGGATGCACTATATTTGTATATAGGAAATGTTCATATTGAATTATATCCTTGTATTATAAGATTATTCAGATTTCGTTTTGTAAATGGAATTATGCTATTATTATGCCAAAGACATGGAATGCTCTTATATTGTTCTTCCTATTTTNCGGAAGTTTTACTTGTATGTAATAAAAAC
  3   1   2       bld Ga15      out                      XL511d18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATGGNCAGCNTATGGTCCAGCTCCCAGCAGCAGCTCCACAGAGCAGCCCAGNTCCCANTGCTTGCAAGATGGGNGGTCCACCAGTAGAAGCNGCCANAGTGTATGGAGGCTTCCAGCTTGTGCCAGCTTCAGATGGACAGTTTG
  3   1   2       bld Neu7                                 XL039p02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAGCTCCCATTGCTTGCAAGATGGGTGGTCCACCAGTAGAAGCTGNCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCTTCAGATGGACAGTTTGCCTTCCTGATCACAAANCCAGCTTTCCCTCAGANCGGATCTGTCATTCCTTTATACACCAACTCCAATGTGGGCACTGCNCTGCCACCTTCAGTGTNTCCTTCAGTAATGCCATCAGTCACAGCTGACTCTGTTTGNAGGCCCTGGTAAAGGGAAATAACTGTGGGACATCTGGTAGCTGGAAATTAGTTACAAATAGTAACCCCTCATGGGATAGTGAGAATGCGGATGCACTATATTTGTANATAGGAAATGTTCATATTGAATTANATCCTTGTATTATAAGATTATTCAGATTTCGTTTTGTAAATGGAATTATGCTATTATTATGCCAAAGACATGGAATGCTCTTATANTGTT
  3   1   2       bld Neu7                                 XL026a03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGATAGTGAGAATGCGGAATGCACTATATTTGTATATAGGAAATGTTCATATTGAATTATATCCTTGTATTATAAGATTATTCAGATTTCGTTTTGTAAATGGAATTATGCTATTATTATGCCAAAGACATGGAATGCTCTTATATTGTTCTTCCTATTTTCTGGAAGTTTTACTTGTATGTAATAAAAANGCACATTGTATTTTCTCTAATTCCTAAACNCAGAATTAGTAATTTGTATATTTTGCCCTTTTTCTATTTGACTGCAATCTTGCTAACTAAACCTGCCATGTAAATGCAGGGGTTATCACATTCAAAGGAACAATTCTTNACATAGCCCAGAGGTTTTGGCCATCTTGGATCCAAGCTCCTCTTTANACTTCAACCCATCCCCTGTTACAATAGGGCTTACAGCTCTATTCAAATAANCACCAACCAGAATCCTGGGGCCANACAATACTGGCTNATGTCATTTGAAAANCGTTTGTGT
  3   1   2       bld Neu7 5g3  in                         XL021d19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGATGCACTATATTTGTATATAGGAAATGTTCATATTGAATTATATCCTTGTATTATAAGATTATTCAGATTTCGTTTTGTAAATGGAATTATGCTATTATTATGCCAAAGACATGGAATGCTCTTATATTGTTCTTCCTATTTTCTGGAAGTTTTACTTGTATGTAATAAAAACGCACATTGTATTTTCTCTAATTCCTAAACACAGAATTAGTAATTTGTATATTTTGCCCTTTTTCTATTTGACTGCAATCTTGCTAACTAAACCTGCCATGTAAATGCAGGGGTTATCACATTCAAAGGAACAATTCTTTACATAGCCCAGAGGTTTTGGCCATCTTGGATCCAAGCTCCTCTTTATACTTCAACCCATCCCCTGTTATAATAGGGCTTACAGCTCTATTCAAATAATCACCAACCAAAATCCTGGGGCCATACAATACTGACTGATGTCATTTGAAAAACGTTTGTGTCTAAATGCAGACTTGGGACAATGAAAATCATTTGTTACACTCTATTAATATAATGCACTGTTCTAGATCAGNGTACATTATTTNNANGNAATAAAGTCCAACTAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)